##gff-version 3
#!gff-spec-version 1.21
#!processor NCBI annotwriter
#!genome-build ASM19607v1
#!genome-build-accession NCBI_Assembly:GCA_000196075.1
##sequence-region BX072543.1 1 925938
##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=218496
BX072543.1	EMBL	region	1	925938	.	+	.	ID=id0;Dbxref=taxon:218496;Is_circular=true;gbkey=Src;mol_type=genomic DNA;strain=TW08/27
BX072543.1	EMBL	gene	1	1437	.	+	.	ID=gene0;Name=dnaA;gbkey=Gene;gene=dnaA;gene_biotype=protein_coding;locus_tag=TW001
BX072543.1	EMBL	CDS	1	1437	.	+	0	ID=cds0;Parent=gene0;Dbxref=GOA:Q83NZ5,InterPro:IPR001957,InterPro:IPR003593,InterPro:IPR010921,InterPro:IPR013159,InterPro:IPR013317,InterPro:IPR018312,InterPro:IPR020591,InterPro:IPR027417,NCBI_GP:CAD66693.1;Name=CAD66693.1;Note=Similar to Streptomyces coelicolor chromosomal replication initiator protein DnaA or SCO3879 or SCH18.16c SWALL:DNAA_STRCO (SWALL:P27902) (656 aa) fasta scores: E(): 3.8e-67%2C 53.02%25 id in 347 aa%2C and to Micrococcus luteus chromosomal replication initiator protein DnaA SWALL:DNAA_MICLU (SWALL:P21173) (515 aa) fasta scores: E(): 1.1e-64%2C 42.17%25 id in 505 aa;gbkey=CDS;gene=dnaA;product=chromosomal replication initiator protein DnaA;protein_id=CAD66693.1;transl_table=11
BX072543.1	EMBL	sequence_feature	427	1360	.	+	.	ID=id1;Note=Bacterial dnaA protein Score %3D 573.7 E-value %3D 8.2e-170;gbkey=misc_feature;gene=dnaA
BX072543.1	EMBL	sequence_feature	502	525	.	+	.	ID=id2;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=dnaA
BX072543.1	EMBL	sequence_feature	535	576	.	+	.	ID=id3;Note=PS00675 Sigma-54 interaction domain ATP-binding region A signature.;gbkey=misc_feature;gene=dnaA
BX072543.1	EMBL	sequence_feature	547	570	.	+	.	ID=id4;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=dnaA
BX072543.1	EMBL	sequence_feature	1306	1362	.	+	.	ID=id5;Note=PS01008 DnaA protein signature.;gbkey=misc_feature;gene=dnaA
BX072543.1	EMBL	gene	1767	2900	.	+	.	ID=gene1;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;locus_tag=TW002
BX072543.1	EMBL	CDS	1767	2900	.	+	0	ID=cds1;Parent=gene1;Dbxref=GOA:Q83IG6,InterPro:IPR001001,InterPro:IPR022634,InterPro:IPR022635,InterPro:IPR022637,UniProtKB/TrEMBL:Q83IG6,NCBI_GP:CAD66694.1;Name=CAD66694.1;Note=Similar to Streptomyces coelicolor DNA polymerase III%2C beta chain DnaN or SCO3878 or SCH18.15c SWALL:DP3B_STRCO (SWALL:P27903) (376 aa) fasta scores: E(): 7.5e-42%2C 35.46%25 id in 375 aa;gbkey=CDS;gene=dnaN;product=DNA polymerase III%2C beta chain;protein_id=CAD66694.1;transl_table=11
BX072543.1	EMBL	sequence_feature	1767	2118	.	+	.	ID=id6;Note=DNA polymerase III beta subunit%2C N-terminal domain Score %3D 115.6 E-value %3D 6.6e-32;gbkey=misc_feature;gene=dnaN
BX072543.1	EMBL	sequence_feature	2145	2502	.	+	.	ID=id7;Note=DNA polymerase III beta subunit%2C central domain Score %3D 60.4 E-value %3D 2.7e-15;gbkey=misc_feature;gene=dnaN
BX072543.1	EMBL	sequence_feature	2508	2886	.	+	.	ID=id8;Note=DNA polymerase III beta subunit%2C C-terminal domain Score %3D 1.7 E-value %3D 0.00015;gbkey=misc_feature;gene=dnaN
BX072543.1	EMBL	gene	2890	3981	.	+	.	ID=gene2;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;locus_tag=TW003
BX072543.1	EMBL	CDS	2890	3981	.	+	0	ID=cds2;Parent=gene2;Dbxref=GOA:Q83NZ4,InterPro:IPR001238,InterPro:IPR003395,InterPro:IPR018078,InterPro:IPR027417,NCBI_GP:CAD66695.1;Name=CAD66695.1;Note=Similar to Streptomyces coelicolor DNA replication and repair protein RecF or SCO3876 or SCH18.13c SWALL:RECF_STRCO (SWALL:P36176) (373 aa) fasta scores: E(): 3.9e-24%2C 37.16%25 id in 374 aa;gbkey=CDS;gene=recF;product=DNA replication and repair protein recF;protein_id=CAD66695.1;transl_table=11
BX072543.1	EMBL	sequence_feature	2899	3316	.	+	.	ID=id9;Note=RecF/RecN/SMC N terminal domain Score %3D -8.3 E-value %3D 6e-07;gbkey=misc_feature;gene=recF
BX072543.1	EMBL	sequence_feature	2986	3009	.	+	.	ID=id10;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=recF
BX072543.1	EMBL	sequence_feature	3802	3855	.	+	.	ID=id11;Note=PS00618 RecF protein signature 2.;gbkey=misc_feature;gene=recF
BX072543.1	EMBL	gene	4011	4445	.	+	.	ID=gene3;Name=TW004;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW004
BX072543.1	EMBL	CDS	4011	4445	.	+	0	ID=cds3;Parent=gene3;Dbxref=InterPro:IPR007922,UniProtKB/TrEMBL:Q83IG5,NCBI_GP:CAD66696.1;Name=CAD66696.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO3875 or SCH18.12c SWALL:Y2H5_STRCO (SWALL:P35925) (190 aa) fasta scores: E(): 5.9%2C 24.32%25 id in 111 aa;gbkey=CDS;product=hypothetical protein;protein_id=CAD66696.1;transl_table=11
BX072543.1	EMBL	gene	4485	6434	.	+	.	ID=gene4;Name=gyrB1;gbkey=Gene;gene=gyrB1;gene_biotype=protein_coding;locus_tag=TW005
BX072543.1	EMBL	CDS	4485	6434	.	+	0	ID=cds4;Parent=gene4;Dbxref=GOA:Q83IG4,InterPro:IPR001241,InterPro:IPR002288,InterPro:IPR003594,InterPro:IPR006171,InterPro:IPR011557,InterPro:IPR013506,InterPro:IPR013759,InterPro:IPR013760,InterPro:IPR014721,InterPro:IPR018522,InterPro:IPR020568,UniProtKB/TrEMBL:Q83IG4,NCBI_GP:CAD66697.1;Name=CAD66697.1;Note=Similar to Bacillus halodurans DNA gyrase subunit B GtrB or BH0006 SWALL:GYRB_BACHD (SWALL:O50627) (637 aa) fasta scores: E(): 1.1e-136%2C 56.74%25 id in 645 aa;gbkey=CDS;gene=gyrB1;product=DNA gyrase subunit B;protein_id=CAD66697.1;transl_table=11
BX072543.1	EMBL	sequence_feature	4584	5013	.	+	.	ID=id12;Note=Histidine kinase-%2C DNA gyrase B-%2C and HSP90-like ATPase Score %3D 94.1 E-value %3D 2e-25;gbkey=misc_feature;gene=gyrB1
BX072543.1	EMBL	sequence_feature	5160	5682	.	+	.	ID=id13;Note=DNA gyrase B Score %3D 261.5 E-value %3D 7.7e-76;gbkey=misc_feature;gene=gyrB1
BX072543.1	EMBL	sequence_feature	5775	5801	.	+	.	ID=id14;Note=PS00177 DNA topoisomerase II signature.;gbkey=misc_feature;gene=gyrB1
BX072543.1	EMBL	sequence_feature	5853	6096	.	+	.	ID=id15;Note=Toprim domain Score %3D 47.8 E-value %3D 1.7e-11;gbkey=misc_feature;gene=gyrB1
BX072543.1	EMBL	sequence_feature	6204	6396	.	+	.	ID=id16;Note=DNA gyrase B subunit%2C carboxyl terminus Score %3D 135.1 E-value %3D 8.7e-38;gbkey=misc_feature;gene=gyrB1
BX072543.1	EMBL	gene	6438	8897	.	+	.	ID=gene5;Name=gyrA1;gbkey=Gene;gene=gyrA1;gene_biotype=protein_coding;locus_tag=TW006
BX072543.1	EMBL	CDS	6438	8897	.	+	0	ID=cds5;Parent=gene5;Dbxref=GOA:Q83IG3,InterPro:IPR002205,InterPro:IPR005743,InterPro:IPR006691,InterPro:IPR013758,InterPro:IPR013760,InterPro:IPR024946,UniProtKB/TrEMBL:Q83IG3,NCBI_GP:CAD66698.1;Name=CAD66698.1;Note=Similar to Streptomyces coelicolor DNA gyrase subunit A GyrA or SCO3873 or SCH18.10c SWALL:GYRA_STRCO (SWALL:P35885) (857 aa) fasta scores: E(): 1.8e-189%2C 61.26%25 id in 808 aa;gbkey=CDS;gene=gyrA1;product=DNA gyrase subunit A;protein_id=CAD66698.1;transl_table=11
BX072543.1	EMBL	sequence_feature	6525	7878	.	+	.	ID=id17;Note=DNA gyrase/topoisomerase IV%2C subunit A Score %3D 899.7 E-value %3D 6.1e-268;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	7950	8097	.	+	.	ID=id18;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 52.8 E-value %3D 5.4e-13;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	8100	8256	.	+	.	ID=id19;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 50.6 E-value %3D 2.5e-12;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	8271	8412	.	+	.	ID=id20;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 48.9 E-value %3D 7.8e-12;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	8415	8562	.	+	.	ID=id21;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 43.8 E-value %3D 2.7e-10;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	8568	8718	.	+	.	ID=id22;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 46.4 E-value %3D 4.4e-11;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	8721	8868	.	+	.	ID=id23;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 31.1 E-value %3D 1.8e-06;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	gene	8894	9274	.	+	.	ID=gene6;Name=TW007;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW007
BX072543.1	EMBL	CDS	8894	9274	.	+	0	ID=cds6;Parent=gene6;Dbxref=InterPro:IPR021949,UniProtKB/TrEMBL:Q83NZ3,NCBI_GP:CAD66699.1;Name=CAD66699.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO3872 or SCH18.09c SWALL:Q9KXX6 (EMBL:AL357152) (185 aa) fasta scores: E(): 0.0026%2C 30.5%25 id in 118 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66699.1;transl_table=11
BX072543.1	EMBL	sequence_feature	8894	9085	.	+	.	ID=id24;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.950) with cleavage site probability 0.633 between residues 64 and 65;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	8978	9046	.	+	.	ID=id25;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 29-51 and 82-113;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	9137	9232	.	+	.	ID=id25;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 29-51 and 82-113;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	tRNA	9278	9351	.	+	.	ID=rna0;Note=tRNA Ile anticodon GAT%2C Cove score 79.47;gbkey=tRNA;product=tRNA-Ile
BX072543.1	EMBL	exon	9278	9351	.	+	.	ID=id26;Parent=rna0;Note=tRNA Ile anticodon GAT%2C Cove score 79.47;gbkey=tRNA;product=tRNA-Ile
BX072543.1	EMBL	tRNA	9365	9441	.	+	.	ID=rna1;Note=tRNA Ala anticodon TGC%2C Cove score 94.27;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	exon	9365	9441	.	+	.	ID=id27;Parent=rna1;Note=tRNA Ala anticodon TGC%2C Cove score 94.27;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	gene	9640	10332	.	-	.	ID=gene7;Name=TW008;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW008
BX072543.1	EMBL	CDS	9640	10332	.	-	0	ID=cds7;Parent=gene7;Dbxref=GOA:Q83IG2,InterPro:IPR006282,InterPro:IPR007371,InterPro:IPR007373,UniProtKB/TrEMBL:Q83IG2,NCBI_GP:CAD66700.1;Name=CAD66700.1;Note=Similar to Thermoanaerobacter tengcongensis thiamine pyrophosphokinase Thi80 or Tte1497 SWALL:Q8R9T9 (EMBL:AE013107) (211 aa) fasta scores: E(): 2.5e-09%2C 29.68%25 id in 192 aa%2C and to Bacillus subtilis YloS protein SWALL:O34664 (EMBL:Z99112) (214 aa) fasta scores: E(): 5.7e-08%2C 30%25 id in 210 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66700.1;transl_table=11
BX072543.1	EMBL	sequence_feature	9957	10299	.	-	.	ID=id28;Note=Thiamin pyrophosphokinase%2C catalytic domain Score %3D 80.0 E-value %3D 3.5e-21;gbkey=misc_feature
BX072543.1	EMBL	gene	10472	11095	.	+	.	ID=gene8;Name=TW009;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW009
BX072543.1	EMBL	CDS	10472	11095	.	+	0	ID=cds8;Parent=gene8;Dbxref=GOA:Q83NZ2,InterPro:IPR002610,InterPro:IPR022764,UniProtKB/TrEMBL:Q83NZ2,NCBI_GP:CAD66701.1;Name=CAD66701.1;Note=Similar to Streptomyces coelicolor putative membrane protein SCO3855 or SCH69.25c SWALL:Q9XA09 (EMBL:AL079308) (297 aa) fasta scores: E(): 9.4e-13%2C 40%25 id in 155 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66701.1;transl_table=11
BX072543.1	EMBL	sequence_feature	10472	10591	.	+	.	ID=id29;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.992) with cleavage site probability 0.460 between residues 40 and 41;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	10538	10606	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	10649	10717	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	10736	10804	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	10814	10882	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	10901	10969	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	11027	11086	.	+	.	ID=id30;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 60-82%2C 89-111%2C 115-137%2C 144-166 and 186-205;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	10610	11021	.	+	.	ID=id31;Note=Rhomboid family Score %3D 144.6 E-value %3D 1.3e-40;gbkey=misc_feature
BX072543.1	EMBL	gene	11133	11342	.	-	.	ID=gene9;Name=TW010;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW010
BX072543.1	EMBL	CDS	11133	11342	.	-	0	ID=cds9;Parent=gene9;Dbxref=GOA:P67379,InterPro:IPR009619,NCBI_GP:CAD66702.1;Name=CAD66702.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO3854 or SCH69.24 SWALL:Q9XA10 (EMBL:AL079308) (84 aa) fasta scores: E(): 1.4e-08%2C 40%25 id in 55 aa%2C and to Corynebacterium glutamicum hypothetical membrane protein Cgl0040 cgl0040 SWALL:BAB97433 (EMBL:AP005274) (90 aa) fasta scores: E(): 6.5e-06%2C 33.33%25 id in 63 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66702.1;transl_table=11
BX072543.1	EMBL	sequence_feature	11238	11306	.	-	.	ID=id32;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35 and 45-64;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	11151	11210	.	-	.	ID=id32;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35 and 45-64;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	11399	12037	.	+	.	ID=gene10;Name=TW011;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW011
BX072543.1	EMBL	CDS	11399	12037	.	+	0	ID=cds10;Parent=gene10;Dbxref=GOA:Q820C3,InterPro:IPR006221,InterPro:IPR017926,InterPro:IPR029062,UniProtKB/TrEMBL:Q820C3,NCBI_GP:CAD66703.1;Name=CAD66703.1;Note=Similar to Streptomyces coelicolor putative glutamine amidotransferase SCO3851 or SCH69.21c SWALL:Q9XA13 (EMBL:AL079308) (212 aa) fasta scores: E(): 1.8e-29%2C 43.68%25 id in 206 aa%2C and to Escherichia coli para-aminobenzoate synthase glutamine amidotransferase component II PabA or b3360 SWALL:PABA_ECOLI (SWALL:P00903) (187 aa) fasta scores: E(): 5e-24%2C 41.48%25 id in 188 aa;gbkey=CDS;product=putative glutamine amidotransferase;protein_id=CAD66703.1;transl_table=11
BX072543.1	EMBL	sequence_feature	11411	11966	.	+	.	ID=id33;Note=Glutamine amidotransferase class-I Score %3D 180.3 E-value %3D 2.2e-51;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	11630	11665	.	+	.	ID=id34;Note=PS00442 Glutamine amidotransferases class-I active site.;gbkey=misc_feature
BX072543.1	EMBL	gene	12143	12715	.	+	.	ID=gene11;Name=TW012;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW012
BX072543.1	EMBL	CDS	12143	12715	.	+	0	ID=cds11;Parent=gene11;Dbxref=InterPro:IPR007156,InterPro:IPR023353,UniProtKB/TrEMBL:Q83IG1,NCBI_GP:CAD66704.1;Name=CAD66704.1;Note=Similar to Rhizobium meliloti hypothetical transmembrane protein SMC00853 or R00853 SWALL:Q92RL3 (EMBL:AL591785) (182 aa) fasta scores: E(): 6.7e-26%2C 49.18%25 id in 183 aa;gbkey=CDS;product=conserved hypothetical membrane protein;protein_id=CAD66704.1;transl_table=11
BX072543.1	EMBL	sequence_feature	12143	12217	.	+	.	ID=id35;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.916) with cleavage site probability 0.503 between residues 25 and 26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	12152	12220	.	+	.	ID=id36;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 4-26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	12164	12710	.	+	.	ID=id37;Note=LemA family Score %3D 254.7 E-value %3D 9e-74;gbkey=misc_feature
BX072543.1	EMBL	gene	12752	13627	.	+	.	ID=gene12;Name=TW013;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW013
BX072543.1	EMBL	CDS	12752	13627	.	+	0	ID=cds12;Parent=gene12;Dbxref=GOA:Q83IG0,InterPro:IPR001915,InterPro:IPR022919,NCBI_GP:CAD66705.1;Name=CAD66705.1;Note=Similar to Streptococcus gordonii Challis probable protease HtpX homolog SWALL:HTPX_STRGC (SWALL:O30795) (297 aa) fasta scores: E(): 1.5e-41%2C 42.52%25 id in 301 aa%2C and to Escherichia coli probable protease HtpX or b1829 SWALL:HTPX_ECOLI (SWALL:P23894) (293 aa) fasta scores: E(): 4.9e-17%2C 32.05%25 id in 287 aa;gbkey=CDS;product=putative integral membrane heat shock protease;protein_id=CAD66705.1;transl_table=11
BX072543.1	EMBL	sequence_feature	12752	12895	.	+	.	ID=id38;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.984) with cleavage site probability 0.241 between residues 48 and 49;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	12788	12856	.	+	.	ID=id39;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61%2C 154-176 and 186-208;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	12866	12934	.	+	.	ID=id39;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61%2C 154-176 and 186-208;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	13211	13279	.	+	.	ID=id39;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61%2C 154-176 and 186-208;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	13307	13375	.	+	.	ID=id39;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61%2C 154-176 and 186-208;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	12995	13601	.	+	.	ID=id40;Note=Peptidase family M48 Score %3D 115.6 E-value %3D 6.5e-32;gbkey=misc_feature
BX072543.1	EMBL	gene	13628	13999	.	+	.	ID=gene13;Name=TW014;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW014
BX072543.1	EMBL	CDS	13628	13999	.	+	0	ID=cds13;Parent=gene13;Dbxref=UniProtKB/TrEMBL:Q83NZ1,NCBI_GP:CAD66706.1;Name=CAD66706.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO1562 or SCL11.18 SWALL:Q9L1C0 (EMBL:AL157953) (138 aa) fasta scores: E(): 1.2e-12%2C 41.02%25 id in 117 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66706.1;transl_table=11
BX072543.1	EMBL	sequence_feature	13628	13696	.	+	.	ID=id41;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.767) with cleavage site probability 0.217 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	13640	13699	.	+	.	ID=id42;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 63-85 and 95-117;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	13727	13795	.	+	.	ID=id42;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 63-85 and 95-117;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	13814	13882	.	+	.	ID=id42;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 63-85 and 95-117;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	13910	13978	.	+	.	ID=id42;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 63-85 and 95-117;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	14121	15404	.	+	.	ID=gene14;Name=TW015;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW015
BX072543.1	EMBL	CDS	14121	15404	.	+	0	ID=cds14;Parent=gene14;Dbxref=GOA:Q83NZ0,InterPro:IPR008009,InterPro:IPR015919,UniProtKB/TrEMBL:Q83NZ0,NCBI_GP:CAD66707.1;Name=CAD66707.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD66707.1;transl_table=11
BX072543.1	EMBL	sequence_feature	14181	14240	.	+	.	ID=id43;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-40;gbkey=misc_feature
BX072543.1	EMBL	gene	15432	16280	.	+	.	ID=gene15;Name=dkgA;gbkey=Gene;gene=dkgA;gene_biotype=protein_coding;locus_tag=TW016
BX072543.1	EMBL	CDS	15432	16280	.	+	0	ID=cds15;Parent=gene15;Dbxref=GOA:Q83IF9,InterPro:IPR001395,InterPro:IPR018170,InterPro:IPR020471,InterPro:IPR023210,UniProtKB/TrEMBL:Q83IF9,NCBI_GP:CAD66708.1;Name=CAD66708.1;Note=Similar to Yersinia pestis 2%2C5-diketo-D-gluconic acid reductase A DkgA or YPO0676 or y3501 SWALL:DKGA_YERPE (SWALL:Q8ZI40) (277 aa) fasta scores: E(): 5.3e-50%2C 46.71%25 id in 274 aa%2C and to Corynebacterium sp. 2%2C5-diketo-D-gluconic acid reductase A DkgA SWALL:DKGA_CORSP (SWALL:P06632) (277 aa) fasta scores: E(): 1.1e-55%2C 51.5%25 id in 266 aa;gbkey=CDS;gene=dkgA;product=2%2C5-diketo-D-gluconic acid reductase A;protein_id=CAD66708.1;transl_table=11
BX072543.1	EMBL	sequence_feature	15468	16233	.	+	.	ID=id44;Note=Aldo/keto reductase family Score %3D 357.0 E-value %3D 1.4e-104;gbkey=misc_feature;gene=dkgA
BX072543.1	EMBL	sequence_feature	15564	15617	.	+	.	ID=id45;Note=PS00798 Aldo/keto reductase family signature 1.;gbkey=misc_feature;gene=dkgA
BX072543.1	EMBL	sequence_feature	15810	15863	.	+	.	ID=id46;Note=PS00062 Aldo/keto reductase family signature 2.;gbkey=misc_feature;gene=dkgA
BX072543.1	EMBL	gene	16396	18048	.	-	.	ID=gene16;Name=TW017;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW017
BX072543.1	EMBL	CDS	16396	18048	.	-	0	ID=cds16;Parent=gene16;Dbxref=GOA:Q83NY9,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR016055,InterPro:IPR016066,UniProtKB/TrEMBL:Q83NY9,NCBI_GP:CAD66709.1;Name=CAD66709.1;Note=Similar to Streptomyces coelicolor putative phosphomannomutase SCO4916 or SCK13.08c SWALL:Q9AD82 (EMBL:AL512667) (549 aa) fasta scores: E(): 9.1e-77%2C 44.21%25 id in 536 aa%2C and to Streptococcus thermophilus phosphoglucomutase PgmA SWALL:Q9K560 (EMBL:AJ243290) (572 aa) fasta scores: E(): 1.1e-28%2C 33.27%25 id in 544 aa;gbkey=CDS;product=putative phosphomannomutase;protein_id=CAD66709.1;transl_table=11
BX072543.1	EMBL	sequence_feature	16773	17100	.	-	.	ID=id47;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain III Score %3D 14.2 E-value %3D 0.00014;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	17106	17433	.	-	.	ID=id48;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain II Score %3D 11.1 E-value %3D 3.8e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	17472	17922	.	-	.	ID=id49;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I Score %3D 147.4 E-value %3D 1.8e-41;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	17581	17625	.	-	.	ID=id50;Note=PS00710 Phosphoglucomutase and phosphomannomutase phosphoserine signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	18061	18894	.	-	.	ID=gene17;Name=punA;gbkey=Gene;gene=punA;gene_biotype=protein_coding;locus_tag=TW018
BX072543.1	EMBL	CDS	18061	18894	.	-	0	ID=cds17;Parent=gene17;Dbxref=GOA:Q83IF8,InterPro:IPR000845,InterPro:IPR001369,InterPro:IPR011268,UniProtKB/TrEMBL:Q83IF8,NCBI_GP:CAD66710.1;Name=CAD66710.1;Note=Similar to Cellulomonas sp purine nucleoside phosphorylase PunA SWALL:PUNA_CELSP (SWALL:P81989) (282 aa) fasta scores: E(): 6.6e-45%2C 48.33%25 id in 271 aa;gbkey=CDS;gene=punA;product=purine nucleoside phosphorylase;protein_id=CAD66710.1;transl_table=11
BX072543.1	EMBL	sequence_feature	18084	18816	.	-	.	ID=id51;Note=Phosphorylase family 2 Score %3D 185.7 E-value %3D 5.4e-53;gbkey=misc_feature;gene=punA
BX072543.1	EMBL	gene	18975	20372	.	+	.	ID=gene18;Name=TW019;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW019
BX072543.1	EMBL	CDS	18975	20372	.	+	0	ID=cds18;Parent=gene18;Dbxref=GOA:Q83NY8,InterPro:IPR001327,InterPro:IPR004099,InterPro:IPR013027,InterPro:IPR016156,InterPro:IPR023753,UniProtKB/TrEMBL:Q83NY8,NCBI_GP:CAD66711.1;Name=CAD66711.1;Note=Similar to Corynebacterium glutamicum dihydrolipoamide dehydrogenase/glutathione oxidoreductase and related enzymes cgl0688 SWALL:BAB98081 (EMBL:AP005276) (469 aa) fasta scores: E(): 6.5e-76%2C 48.58%25 id in 459 aa%2C and to Bacillus subtilis dihydrolipoamide dehydrogenase PdhD or AceD or CitL SWALL:DLD1_BACSU (SWALL:P21880) (470 aa) fasta scores: E(): 1.6e-35%2C 30.99%25 id in 442 aa;gbkey=CDS;product=putative oxidoreductase;protein_id=CAD66711.1;transl_table=11
BX072543.1	EMBL	sequence_feature	18975	19061	.	+	.	ID=id52;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.772) with cleavage site probability 0.272 between residues 29 and 30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	18996	19935	.	+	.	ID=id53;Note=Pyridine nucleotide-disulphide oxidoreductase Score %3D 221.0 E-value %3D 1.2e-63;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	20010	20331	.	+	.	ID=id54;Note=Pyridine nucleotide-disulphide oxidoreductase%2C dimerisation domain Score %3D 91.6 E-value %3D 1.1e-24;gbkey=misc_feature
BX072543.1	EMBL	gene	20441	22216	.	-	.	ID=gene19;Name=TW020;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW020
BX072543.1	EMBL	CDS	20441	22216	.	-	0	ID=cds19;Parent=gene19;Dbxref=GOA:Q83NY7,InterPro:IPR000089,InterPro:IPR001882,InterPro:IPR005479,InterPro:IPR005481,InterPro:IPR005482,InterPro:IPR011053,InterPro:IPR011054,InterPro:IPR011761,InterPro:IPR011764,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,UniProtKB/TrEMBL:Q83NY7,NCBI_GP:CAD66712.1;Name=CAD66712.1;Note=Similar to Streptomyces coelicolor putative acyl-CoA carboxylase complex A subunit AccA1 SWALL:Q9RGQ6 (EMBL:AF113603) (590 aa) fasta scores: E(): 2.3e-110%2C 51.67%25 id in 596 aa%2C and to Mus musculus pyruvate carboxylase%2C mitochondrial precursor SWALL:PYC_MOUSE (SWALL:Q05920) (1178 aa) fasta scores: E(): 1.6e-71%2C 42.26%25 id in 504 aa;gbkey=CDS;product=putative acyl-CoA carboxylase complex A subunit;protein_id=CAD66712.1;transl_table=11
BX072543.1	EMBL	sequence_feature	20455	20656	.	-	.	ID=id55;Note=Biotin-requiring enzyme Score %3D 73.7 E-value %3D 2.7e-19;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	20890	21208	.	-	.	ID=id56;Note=Biotin carboxylase C-terminal domain Score %3D 180.6 E-value %3D 1.8e-51;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	21229	21868	.	-	.	ID=id57;Note=Carbamoyl-phosphate synthase L chain%2C ATP binding domain Score %3D 301.7 E-value %3D 6.5e-88;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	21332	21355	.	-	.	ID=id58;Note=PS00867 Carbamoyl-phosphate synthase subdomain signature 2.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	21874	22210	.	-	.	ID=id59;Note=Carbamoyl-phosphate synthase L chain%2C N-terminal domain Score %3D 149.0 E-value %3D 6e-42;gbkey=misc_feature
BX072543.1	EMBL	gene	22333	22752	.	-	.	ID=gene20;Name=TW021;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW021
BX072543.1	EMBL	CDS	22333	22752	.	-	0	ID=cds20;Parent=gene20;Dbxref=UniProtKB/TrEMBL:Q83IF7,NCBI_GP:CAD66713.1;Name=CAD66713.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66713.1;transl_table=11
BX072543.1	EMBL	gene	22844	23152	.	+	.	ID=gene21;Name=TW022;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW022
BX072543.1	EMBL	CDS	22844	23152	.	+	0	ID=cds21;Parent=gene21;Dbxref=UniProtKB/TrEMBL:Q83IF6,NCBI_GP:CAD66714.1;Name=CAD66714.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66714.1;transl_table=11
BX072543.1	EMBL	gene	23168	23563	.	+	.	ID=gene22;Name=TW023;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW023
BX072543.1	EMBL	CDS	23168	23563	.	+	0	ID=cds22;Parent=gene22;Dbxref=UniProtKB/TrEMBL:Q83NY6,NCBI_GP:CAD66715.1;Name=CAD66715.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66715.1;transl_table=11
BX072543.1	EMBL	sequence_feature	23168	23242	.	+	.	ID=id60;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.996) with cleavage site probability 0.972 between residues 25 and 26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	23186	23254	.	+	.	ID=id61;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 68-90 and 101-123;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	23264	23332	.	+	.	ID=id61;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 68-90 and 101-123;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	23369	23437	.	+	.	ID=id61;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 68-90 and 101-123;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	23468	23536	.	+	.	ID=id61;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 68-90 and 101-123;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	23661	23798	.	+	.	ID=gene23;Name=TW024;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW024
BX072543.1	EMBL	CDS	23661	23798	.	+	0	ID=cds23;Parent=gene23;Dbxref=UniProtKB/TrEMBL:Q83NY5,NCBI_GP:CAD66716.1;Name=CAD66716.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66716.1;transl_table=11
BX072543.1	EMBL	sequence_feature	23724	23792	.	+	.	ID=id62;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 22-44;gbkey=misc_feature
BX072543.1	EMBL	gene	24099	25676	.	-	.	ID=gene24;Name=pccB;gbkey=Gene;gene=pccB;gene_biotype=protein_coding;locus_tag=TW025
BX072543.1	EMBL	CDS	24099	25676	.	-	0	ID=cds24;Parent=gene24;Dbxref=GOA:Q83IF5,InterPro:IPR000022,InterPro:IPR000438,InterPro:IPR011762,InterPro:IPR011763,InterPro:IPR029045,UniProtKB/TrEMBL:Q83IF5,NCBI_GP:CAD66717.1;Name=CAD66717.1;Note=Similar to Saccharopolyspora erythraea propionyl-CoA carboxylase beta chain PccB SWALL:PCCB_SACER (SWALL:P53003) (546 aa) fasta scores: E(): 8.9e-123%2C 62.5%25 id in 520 aa;gbkey=CDS;gene=pccB;product=propionyl-CoA carboxylase beta chain;protein_id=CAD66717.1;transl_table=11
BX072543.1	EMBL	sequence_feature	24110	25625	.	-	.	ID=id63;Note=Carboxyl transferase domain Score %3D 893.4 E-value %3D 4.8e-266;gbkey=misc_feature;gene=pccB
BX072543.1	EMBL	gene	25738	26484	.	+	.	ID=gene25;Name=TW026;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW026
BX072543.1	EMBL	CDS	25738	26484	.	+	0	ID=cds25;Parent=gene25;Dbxref=GOA:Q83IF4,InterPro:IPR003142,InterPro:IPR004143,InterPro:IPR004408,UniProtKB/TrEMBL:Q83IF4,NCBI_GP:CAD66718.1;Name=CAD66718.1;Note=Similar to Mycobacterium tuberculosis BirA or Rv3279c or mtcy71.19c or mt3379 SWALL:P96884 (EMBL:Z92771) (266 aa) fasta scores: E(): 2.8e-16%2C 36.11%25 id in 252 aa%2C and to Bacillus subtilis BirA bifunctional protein [includes: biotin operon repressor%3B biotin--[acetyl-coa-carboxylase] synthetase BirA SWALL:BIRA_BACSU (SWALL:P42975) (325 aa) fasta scores: E(): 1.6e-11%2C 30.4%25 id in 250 aa;gbkey=CDS;product=putative protein ligase;protein_id=CAD66718.1;transl_table=11
BX072543.1	EMBL	sequence_feature	25744	26155	.	+	.	ID=id64;Note=Biotin/lipoate A/B protein ligase family Score %3D 84.2 E-value %3D 1.9e-22;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	26326	26461	.	+	.	ID=id65;Note=Biotin protein ligase C terminal domain Score %3D 41.4 E-value %3D 1.4e-09;gbkey=misc_feature
BX072543.1	EMBL	gene	26537	26869	.	-	.	ID=gene26;Name=TW027;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW027
BX072543.1	EMBL	CDS	26537	26869	.	-	0	ID=cds26;Parent=gene26;Dbxref=GOA:Q83NY4,InterPro:IPR007267,UniProtKB/TrEMBL:Q83NY4,NCBI_GP:CAD66719.1;Name=CAD66719.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO4845 or SC5G8.13 SWALL:Q9KZA1 (EMBL:AL353872) (157 aa) fasta scores: E(): 2.9e-08%2C 41.3%25 id in 92 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66719.1;transl_table=11
BX072543.1	EMBL	sequence_feature	26554	26869	.	-	.	ID=id66;Note=GtrA-like protein Score %3D 36.2 E-value %3D 5.2e-08;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	26780	26842	.	-	.	ID=id67;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-30%2C 51-73 and 83-105;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	26651	26719	.	-	.	ID=id67;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-30%2C 51-73 and 83-105;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	26555	26623	.	-	.	ID=id67;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-30%2C 51-73 and 83-105;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	26979	28232	.	+	.	ID=gene27;Name=purK;gbkey=Gene;gene=purK;gene_biotype=protein_coding;locus_tag=TW028
BX072543.1	EMBL	CDS	26979	28232	.	+	0	ID=cds27;Parent=gene27;Dbxref=GOA:Q83IF3,InterPro:IPR003135,InterPro:IPR011054,InterPro:IPR011761,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,UniProtKB/TrEMBL:Q83IF3,NCBI_GP:CAD66720.1;Name=CAD66720.1;Note=Similar to Mycobacterium tuberculosis phosphoribosylaminoimidazole carboxylase ATPase subunit PurK or Rv3276c or mt3376 or mtcy71.16C SWALL:PURK_MYCTU (SWALL:P96881) (429 aa) fasta scores: E(): 1.3e-21%2C 39.43%25 id in 421 aa%2C and to Schizosaccharomyces pombe phosphoribosylaminoimidazole carboxylase Ade6 or Min1 or Spcc1322.13 SWALL:PUR6_SCHPO (SWALL:P15567) (552 aa) fasta scores: E(): 1.5e-14%2C 32.15%25 id in 395 aa;gbkey=CDS;gene=purK;product=phosphoribosylaminoimidazole carboxylase ATPase subunit PurK;protein_id=CAD66720.1;transl_table=11
BX072543.1	EMBL	sequence_feature	27135	27588	.	+	.	ID=id68;Note=ATP-grasp domain Score %3D 56.7 E-value %3D 3.6e-14;gbkey=misc_feature;gene=purK
BX072543.1	EMBL	gene	28311	28853	.	+	.	ID=gene28;Name=purE;gbkey=Gene;gene=purE;gene_biotype=protein_coding;locus_tag=TW029
BX072543.1	EMBL	CDS	28311	28853	.	+	0	ID=cds28;Parent=gene28;Dbxref=GOA:Q83IF2,InterPro:IPR000031,InterPro:IPR024694,UniProtKB/TrEMBL:Q83IF2,NCBI_GP:CAD66721.1;Name=CAD66721.1;Note=Similar to Corynebacterium ammoniagenes phosphoribosylaminoimidazole carboxylase catalytic subunit PurE SWALL:PUR6_CORAM (SWALL:Q44679) (177 aa) fasta scores: E(): 7.7e-28%2C 55.09%25 id in 167 aa%2C and to Streptomyces coelicolor phosphoribosylaminoimidazole carboxylase catalytic subunit PurE or SCO3059 or SCBAC19G2.14c SWALL:Q93J44 (EMBL:AL596138) (180 aa) fasta scores: E(): 3.7e-27%2C 54.21%25 id in 166 aa;gbkey=CDS;gene=purE;product=phosphoribosylaminoimidazole carboxylase catalytic subunit PurE;protein_id=CAD66721.1;transl_table=11
BX072543.1	EMBL	sequence_feature	28353	28824	.	+	.	ID=id69;Note=AIR carboxylase Score %3D 236.9 E-value %3D 2e-68;gbkey=misc_feature;gene=purE
BX072543.1	EMBL	gene	29078	29476	.	-	.	ID=gene29;Name=TW030;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW030
BX072543.1	EMBL	CDS	29078	29476	.	-	0	ID=cds29;Parent=gene29;Dbxref=UniProtKB/TrEMBL:Q83NY3,NCBI_GP:CAD66722.1;Name=CAD66722.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66722.1;transl_table=11
BX072543.1	EMBL	sequence_feature	29375	29443	.	-	.	ID=id70;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-122;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	29312	29365	.	-	.	ID=id70;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-122;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	29207	29275	.	-	.	ID=id70;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-122;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	29111	29179	.	-	.	ID=id70;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-122;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	29804	30667	.	-	.	ID=gene30;Name=TW032;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW032
BX072543.1	EMBL	CDS	29804	30667	.	-	0	ID=cds30;Parent=gene30;Dbxref=GOA:Q83NY2,InterPro:IPR005913,InterPro:IPR016040,UniProtKB/TrEMBL:Q83NY2,NCBI_GP:CAD66723.1;Name=CAD66723.1;Note=Similar to Streptomyces rishiriensis dTDP-4-keto-6-deoxyhexose reductase CouS SWALL:Q9F8T1 (EMBL:AF235050) (288 aa) fasta scores: E(): 4.4e-46%2C 48.52%25 id in 272 aa%2C and to Saccharopolyspora spinosa dTDP-4-dehydrorhamnose reductase Kre SWALL:Q93EJ9 (EMBL:AF355468) (305 aa) fasta scores: E(): 4.2e-36%2C 43.34%25 id in 293 aa;gbkey=CDS;product=putative polysaccharide biosynthesis protein;protein_id=CAD66723.1;transl_table=11
BX072543.1	EMBL	sequence_feature	29857	30262	.	-	.	ID=id71;Note=RmlD substrate binding domain Score %3D 183.5 E-value %3D 2.3e-52;gbkey=misc_feature
BX072543.1	EMBL	gene	30664	31647	.	-	.	ID=gene31;Name=TW033;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW033
BX072543.1	EMBL	CDS	30664	31647	.	-	0	ID=cds31;Parent=gene31;Dbxref=GOA:Q83NY1,InterPro:IPR001509,InterPro:IPR005888,InterPro:IPR016040,InterPro:IPR020904,UniProtKB/TrEMBL:Q83NY1,NCBI_GP:CAD66724.1;Name=CAD66724.1;Note=Similar to Streptomyces tenebrarius AprE SWALL:Q9F5R6 (EMBL:AF306787) (332 aa) fasta scores: E(): 8.2e-88%2C 64.83%25 id in 327 aa;gbkey=CDS;product=putative dehydratase;protein_id=CAD66724.1;transl_table=11
BX072543.1	EMBL	sequence_feature	30705	31638	.	-	.	ID=id72;Note=NAD dependent epimerase/dehydratase family Score %3D 526.7 E-value %3D 1.1e-155;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	31147	31233	.	-	.	ID=id73;Note=PS00061 Short-chain dehydrogenases/reductases family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	31892	32515	.	+	.	ID=gene32;Name=TW035;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW035
BX072543.1	EMBL	CDS	31892	32515	.	+	0	ID=cds32;Parent=gene32;Dbxref=GOA:Q83NY0,InterPro:IPR000888,InterPro:IPR011051,InterPro:IPR014710,UniProtKB/TrEMBL:Q83NY0,NCBI_GP:CAD66725.1;Name=CAD66725.1;Note=Similar to Streptomyces antibioticus dTDP-4-keto-6-deoxyglucose 3%2C5-epimerase SWALL:Q9L6C5 (EMBL:AF237894) (202 aa) fasta scores: E(): 4e-34%2C 50%25 id in 192 aa;gbkey=CDS;product=putative epimerase;protein_id=CAD66725.1;transl_table=11
BX072543.1	EMBL	sequence_feature	31898	32426	.	+	.	ID=id74;Note=dTDP-4-dehydrorhamnose 3%2C5-epimerase Score %3D 241.2 E-value %3D 1e-69;gbkey=misc_feature
BX072543.1	EMBL	gene	32571	33449	.	+	.	ID=gene33;Name=TW036;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW036
BX072543.1	EMBL	CDS	32571	33449	.	+	0	ID=cds33;Parent=gene33;Dbxref=GOA:Q83IF1,InterPro:IPR005835,InterPro:IPR005907,InterPro:IPR029044,UniProtKB/TrEMBL:Q83IF1,NCBI_GP:CAD66726.1;Name=CAD66726.1;Note=Similar to Streptomyces sphaeroides NovV SWALL:Q9L9E6 (EMBL:AF170880) (297 aa) fasta scores: E(): 6.5e-76%2C 66.78%25 id in 286 aa%2C and to Escherichia coli glucose-1-phosphate thymidylyltransferase RffH or b3789 SWALL:RFFH_ECOLI (SWALL:P27831) (293 aa) fasta scores: E(): 6.6e-69%2C 59.17%25 id in 289 aa;gbkey=CDS;product=putative nucleotidyl transferase;protein_id=CAD66726.1;transl_table=11
BX072543.1	EMBL	sequence_feature	32574	33285	.	+	.	ID=id75;Note=Nucleotidyl transferase Score %3D 311.9 E-value %3D 5.3e-91;gbkey=misc_feature
BX072543.1	EMBL	gene	33457	34305	.	-	.	ID=gene34;Name=TW037;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW037
BX072543.1	EMBL	CDS	33457	34305	.	-	0	ID=cds34;Parent=gene34;Dbxref=GOA:Q83IF0,InterPro:IPR001173,InterPro:IPR029044,UniProtKB/TrEMBL:Q83IF0,NCBI_GP:CAD66727.1;Name=CAD66727.1;Note=Similar to Mycobacterium smegmatis dTDP-rha:a-D-glcnac-diphosphoryl polyprenol%2C a-3-L-rhamnosyl transferase WbbL SWALL:Q9RN50 (EMBL:AF187550) (296 aa) fasta scores: E(): 2.3e-30%2C 36.66%25 id in 270 aa;gbkey=CDS;product=putative glycosyl transferase;protein_id=CAD66727.1;transl_table=11
BX072543.1	EMBL	sequence_feature	33732	34284	.	-	.	ID=id76;Note=Glycosyl transferase Score %3D 72.8 E-value %3D 5e-19;gbkey=misc_feature
BX072543.1	EMBL	gene	34302	35108	.	-	.	ID=gene35;Name=TW038;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW038
BX072543.1	EMBL	CDS	34302	35108	.	-	0	ID=cds35;Parent=gene35;Dbxref=GOA:Q83IE9,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IE9,NCBI_GP:CAD66728.1;Name=CAD66728.1;Note=Similar to Myxococcus xanthus O-antigen export system ATP-binding protein RfbB SWALL:RFBB_MYXXA (SWALL:Q50863) (437 aa) fasta scores: E(): 2.3e-30%2C 48.92%25 id in 233 aa;gbkey=CDS;product=putative ABC transport ATP-binding subunit;protein_id=CAD66728.1;transl_table=11
BX072543.1	EMBL	sequence_feature	34367	34877	.	-	.	ID=id77;Note=ABC transporter Score %3D 129.9 E-value %3D 3.3e-36;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	34833	34856	.	-	.	ID=id78;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	35160	36041	.	-	.	ID=gene36;Name=TW039;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW039
BX072543.1	EMBL	CDS	35160	36041	.	-	0	ID=cds36;Parent=gene36;Dbxref=GOA:Q83NX9,InterPro:IPR000412,InterPro:IPR013525,UniProtKB/TrEMBL:Q83NX9,NCBI_GP:CAD66729.1;Name=CAD66729.1;Note=Similar to Pseudomonas aeruginosa membrane-spanning domain Msd Wzm SWALL:P72162 (EMBL:U63722) (265 aa) fasta scores: E(): 8.6e-21%2C 30.68%25 id in 277 aa%2C and to Myxococcus xanthus O-antigen export system permease protein RfbA SWALL:RFBA_MYXXA (SWALL:Q50862) (260 aa) fasta scores: E(): 1.2e-15%2C 26.83%25 id in 272 aa;gbkey=CDS;product=putative ABC transport integral membrane subunit;protein_id=CAD66729.1;transl_table=11
BX072543.1	EMBL	sequence_feature	35174	35966	.	-	.	ID=id79;Note=ABC-2 type transporter Score %3D 151.4 E-value %3D 1.1e-42;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	35823	35891	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	35712	35780	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	35583	35651	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	35472	35540	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	35394	35453	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	35193	35252	.	-	.	ID=id80;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 51-73%2C 88-110%2C 131-153%2C 168-190%2C 197-216 and 264-283;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	gene	36116	37087	.	+	.	ID=gene37;Name=TW040;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW040
BX072543.1	EMBL	CDS	36116	37087	.	+	0	ID=cds37;Parent=gene37;Dbxref=GOA:Q83IE8,InterPro:IPR001173,InterPro:IPR029044,UniProtKB/TrEMBL:Q83IE8,NCBI_GP:CAD66730.1;Name=CAD66730.1;Note=Similar to Actinobacillus actinomycetemcomitans DNA for glycosyltransferase%2C lytic transglycosylase%2C dTDP-4-rhamnose reductase SWALL:O05379 (EMBL:AB002668) (289 aa) fasta scores: E(): 3.2e-17%2C 30.73%25 id in 257 aa;gbkey=CDS;product=putative glycosyl transferase;protein_id=CAD66730.1;transl_table=11
BX072543.1	EMBL	sequence_feature	36125	36602	.	+	.	ID=id81;Note=Glycosyl transferase Score %3D 115.3 E-value %3D 8.3e-32;gbkey=misc_feature
BX072543.1	EMBL	gene	37195	37551	.	-	.	ID=gene38;Name=TW041;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW041
BX072543.1	EMBL	CDS	37195	37551	.	-	0	ID=cds38;Parent=gene38;Dbxref=InterPro:IPR019277,UniProtKB/TrEMBL:Q83NX8,NCBI_GP:CAD66731.1;Name=CAD66731.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66731.1;transl_table=11
BX072543.1	EMBL	sequence_feature	37489	37542	.	-	.	ID=id82;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 33-55 and 59-81;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	37387	37455	.	-	.	ID=id82;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 33-55 and 59-81;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	37309	37377	.	-	.	ID=id82;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 33-55 and 59-81;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	37548	38276	.	-	.	ID=gene39;Name=TW042;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW042
BX072543.1	EMBL	CDS	37548	38276	.	-	0	ID=cds39;Parent=gene39;Dbxref=GOA:Q83IE7,InterPro:IPR001173,InterPro:IPR029044,UniProtKB/TrEMBL:Q83IE7,NCBI_GP:CAD66732.1;Name=CAD66732.1;Note=Similar to Actinobacillus actinomycetemcomitans putative glycosyltransferase SWALL:Q9AQB2 (EMBL:AF213680) (234 aa) fasta scores: E(): 6.3e-16%2C 28.99%25 id in 238 aa;gbkey=CDS;product=putative glycosyl transferase;protein_id=CAD66732.1;transl_table=11
BX072543.1	EMBL	sequence_feature	37772	38261	.	-	.	ID=id83;Note=Glycosyl transferase Score %3D 75.8 E-value %3D 6.5e-20;gbkey=misc_feature
BX072543.1	EMBL	gene	38634	40475	.	+	.	ID=gene40;Name=TW043;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW043
BX072543.1	EMBL	CDS	38634	40475	.	+	0	ID=cds40;Parent=gene40;Dbxref=InterPro:IPR018674,UniProtKB/TrEMBL:Q83NX7,NCBI_GP:CAD66733.1;Name=CAD66733.1;Note=No significant database matches;gbkey=CDS;product=putative large integral membrane protein;protein_id=CAD66733.1;transl_table=11
BX072543.1	EMBL	sequence_feature	38634	38813	.	+	.	ID=id84;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.978) with cleavage site probability 0.865 between residues 60 and 61;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	38742	38810	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	39135	39203	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	39222	39275	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	39288	39347	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	39381	39449	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	39507	39575	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	39609	39677	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	39720	39779	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	39792	39860	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	39888	39956	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	39975	40043	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	40215	40283	.	+	.	ID=id85;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 37-59%2C 168-190%2C 197-214%2C 219-238%2C 250-272%2C 292-314%2C 326-348%2C 363-382%2C 387-409%2C 419-441%2C 448-470 and 528-550;gbkey=misc_feature;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	repeat_region	40470	40740	.	+	.	ID=id86;Note=rep11. Degenerate repeat sequence including upstream and 5' region of CDS.;gbkey=repeat_region
BX072543.1	EMBL	gene	40712	40825	.	+	.	ID=gene41;Name=TW044;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW044
BX072543.1	EMBL	CDS	40712	40825	.	+	0	ID=cds41;Parent=gene41;Dbxref=UniProtKB/TrEMBL:Q83IE6,NCBI_GP:CAD66734.1;Name=CAD66734.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66734.1;transl_table=11
BX072543.1	EMBL	gene	40845	40934	.	+	.	ID=gene42;Name=TW045;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW045
BX072543.1	EMBL	CDS	40845	40934	.	+	0	ID=cds42;Parent=gene42;Dbxref=UniProtKB/TrEMBL:Q83NX6,NCBI_GP:CAD66735.1;Name=CAD66735.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative small membrane protein;protein_id=CAD66735.1;transl_table=11
BX072543.1	EMBL	sequence_feature	40848	40901	.	+	.	ID=id87;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 2-19;gbkey=misc_feature
BX072543.1	EMBL	gene	41326	41835	.	+	.	ID=gene43;Name=TW046;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW046
BX072543.1	EMBL	CDS	41326	41835	.	+	0	ID=cds43;Parent=gene43;Dbxref=UniProtKB/TrEMBL:Q83NX5,NCBI_GP:CAD66736.1;Name=CAD66736.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66736.1;transl_table=11
BX072543.1	EMBL	sequence_feature	41422	41490	.	+	.	ID=id88;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 59-81%2C 94-114 and 124-146;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	41500	41568	.	+	.	ID=id88;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 59-81%2C 94-114 and 124-146;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	41605	41667	.	+	.	ID=id88;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 59-81%2C 94-114 and 124-146;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	41695	41763	.	+	.	ID=id88;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 59-81%2C 94-114 and 124-146;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	repeat_region	42022	42288	.	+	.	ID=id89;Note=rep11. Degenerate repeat sequence including upstream and 5' region of CDS.;gbkey=repeat_region
BX072543.1	EMBL	gene	42189	42587	.	+	.	ID=gene44;Name=TW048;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW048
BX072543.1	EMBL	CDS	42189	42587	.	+	0	ID=cds44;Parent=gene44;Dbxref=UniProtKB/TrEMBL:Q83NX4,NCBI_GP:CAD66737.1;Name=CAD66737.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD66737.1;transl_table=11
BX072543.1	EMBL	sequence_feature	42189	42266	.	+	.	ID=id90;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.996 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	gene	42584	42982	.	+	.	ID=gene45;Name=TW049;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW049
BX072543.1	EMBL	CDS	42584	42982	.	+	0	ID=cds45;Parent=gene45;Dbxref=UniProtKB/TrEMBL:Q83NX3,NCBI_GP:CAD66738.1;Name=CAD66738.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66738.1;transl_table=11
BX072543.1	EMBL	sequence_feature	42584	42730	.	+	.	ID=id91;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.992) with cleavage site probability 0.533 between residues 49 and 50;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	42626	42682	.	+	.	ID=id92;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-33%2C 38-60%2C 75-97 and 104-126;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	42695	42763	.	+	.	ID=id92;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-33%2C 38-60%2C 75-97 and 104-126;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	42806	42874	.	+	.	ID=id92;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-33%2C 38-60%2C 75-97 and 104-126;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	42893	42961	.	+	.	ID=id92;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-33%2C 38-60%2C 75-97 and 104-126;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	43109	43420	.	+	.	ID=gene46;Name=TW051;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW051
BX072543.1	EMBL	CDS	43109	43420	.	+	0	ID=cds46;Parent=gene46;Dbxref=UniProtKB/TrEMBL:Q83NX2,NCBI_GP:CAD66739.1;Name=CAD66739.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66739.1;transl_table=11
BX072543.1	EMBL	sequence_feature	43109	43213	.	+	.	ID=id93;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.706) with cleavage site probability 0.437 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	43145	43213	.	+	.	ID=id94;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 40-59 and 72-94;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	43226	43285	.	+	.	ID=id94;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 40-59 and 72-94;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	43322	43390	.	+	.	ID=id94;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 40-59 and 72-94;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	repeat_region	43618	43884	.	+	.	ID=id95;Note=rep11. Degenerate repeat sequence including upstream and 5' region of CDS.;gbkey=repeat_region
BX072543.1	EMBL	gene	43784	44215	.	+	.	ID=gene47;Name=TW052;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW052
BX072543.1	EMBL	CDS	43784	44215	.	+	0	ID=cds47;Parent=gene47;Dbxref=UniProtKB/TrEMBL:Q83NX1,NCBI_GP:CAD66740.1;Name=CAD66740.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD66740.1;transl_table=11
BX072543.1	EMBL	sequence_feature	43784	43861	.	+	.	ID=id96;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.947 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	43802	43861	.	+	.	ID=id97;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-26;gbkey=misc_feature
BX072543.1	EMBL	gene	44219	44608	.	+	.	ID=gene48;Name=TW053;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW053
BX072543.1	EMBL	CDS	44219	44608	.	+	0	ID=cds48;Parent=gene48;Dbxref=UniProtKB/TrEMBL:Q83NX0,NCBI_GP:CAD66741.1;Name=CAD66741.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66741.1;transl_table=11
BX072543.1	EMBL	sequence_feature	44219	44320	.	+	.	ID=id98;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.997) with cleavage site probability 0.402 between residues 34 and 35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	44252	44320	.	+	.	ID=id99;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-119;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	44330	44383	.	+	.	ID=id99;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-119;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	44420	44488	.	+	.	ID=id99;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-119;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	44516	44575	.	+	.	ID=id99;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 38-55%2C 68-90 and 100-119;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	repeat_region	44676	44810	.	+	.	ID=id100;Note=(tcgaatcgtgctgta)9;gbkey=repeat_region
BX072543.1	EMBL	gene	44860	46251	.	-	.	ID=gene49;Name=TW054;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW054
BX072543.1	EMBL	CDS	44860	46251	.	-	0	ID=cds49;Parent=gene49;Dbxref=GOA:Q83IE5,InterPro:IPR003594,InterPro:IPR003660,InterPro:IPR003661,InterPro:IPR004358,InterPro:IPR005467,InterPro:IPR009082,UniProtKB/TrEMBL:Q83IE5,NCBI_GP:CAD66742.1;Name=CAD66742.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv0758 or mt0783 or mtcy369.03 SWALL:P71815 (EMBL:Z80226) (485 aa) fasta scores: E(): 8.9e-37%2C 31.11%25 id in 466 aa%2C and to Streptomyces coelicolor putative two component system histidine kinase SCO4021 or 2SC10A7.25 SWALL:Q9ADN6 (EMBL:AL583945) (524 aa) fasta scores: E(): 5.5e-27%2C 37.73%25 id in 265 aa;gbkey=CDS;product=putative two component system sensor kinase;protein_id=CAD66742.1;transl_table=11
BX072543.1	EMBL	sequence_feature	44910	45243	.	-	.	ID=id101;Note=Histidine kinase-%2C DNA gyrase B-%2C and HSP90-like ATPase Score %3D 132.6 E-value %3D 5.2e-37;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	45369	45570	.	-	.	ID=id102;Note=His Kinase A (phosphoacceptor) domain Score %3D 68.2 E-value %3D 1.2e-17;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	45603	45813	.	-	.	ID=id103;Note=HAMP domain Score %3D 46.4 E-value %3D 4.5e-11;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	46180	46239	.	-	.	ID=id104;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24 and 148-170;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	45742	45810	.	-	.	ID=id104;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24 and 148-170;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	46177	46251	.	-	.	ID=id105;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.702) with cleavage site probability 0.385 between residues 25 and 26;gbkey=misc_feature
BX072543.1	EMBL	gene	46318	47001	.	-	.	ID=gene50;Name=TW055;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW055
BX072543.1	EMBL	CDS	46318	47001	.	-	0	ID=cds50;Parent=gene50;Dbxref=GOA:Q83NW9,InterPro:IPR001789,InterPro:IPR001867,InterPro:IPR011006,InterPro:IPR011991,UniProtKB/TrEMBL:Q83NW9,NCBI_GP:CAD66743.1;Name=CAD66743.1;Note=Similar to Streptomyces coelicolor putative two component system response regulator SCO4020 or 2SC10A7.24 SWALL:Q9ADN7 (EMBL:AL583945) (271 aa) fasta scores: E(): 1.2e-40%2C 50.44%25 id in 226 aa;gbkey=CDS;product=putative two component system response regulator;protein_id=CAD66743.1;transl_table=11
BX072543.1	EMBL	sequence_feature	46332	46557	.	-	.	ID=id106;Note=Transcriptional regulatory protein%2C C terminal Score %3D 88.7 E-value %3D 8.6e-24;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	46635	46992	.	-	.	ID=id107;Note=Response regulator receiver domain Score %3D 141.1 E-value %3D 1.4e-39;gbkey=misc_feature
BX072543.1	EMBL	gene	47266	47643	.	+	.	ID=gene51;Name=TW057;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW057
BX072543.1	EMBL	CDS	47266	47643	.	+	0	ID=cds51;Parent=gene51;Dbxref=GOA:Q83NW8,InterPro:IPR002059,InterPro:IPR011129,InterPro:IPR012340,UniProtKB/TrEMBL:Q83NW8,NCBI_GP:CAD66744.1;Name=CAD66744.1;Note=Similar to Streptomyces coelicolor cold shock protein B CspB or SCO4325 or SCD12A.08 SWALL:Q9KXN2 (EMBL:AL357524) (127 aa) fasta scores: E(): 8.1e-16%2C 42.06%25 id in 126 aa%2C and to Pseudomonas fragi cold shock protein CapB SWALL:CAPB_PSEFR (SWALL:P80415) (69 aa) fasta scores: E(): 0.0014%2C 38.09%25 id in 63 aa;gbkey=CDS;product=cold shock protein B;protein_id=CAD66744.1;transl_table=11
BX072543.1	EMBL	sequence_feature	47266	47458	.	+	.	ID=id108;Note='Cold-shock' DNA-binding domain Score %3D 23.9 E-value %3D 1.1e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	47741	47968	.	+	.	ID=gene52;Name=TW058;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW058
BX072543.1	EMBL	CDS	47741	47968	.	+	0	ID=cds52;Parent=gene52;Dbxref=UniProtKB/TrEMBL:Q83IE4,NCBI_GP:CAD66745.1;Name=CAD66745.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66745.1;transl_table=11
BX072543.1	EMBL	gene	47971	48753	.	+	.	ID=gene53;Name=TW059;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW059
BX072543.1	EMBL	CDS	47971	48753	.	+	0	ID=cds53;Parent=gene53;Dbxref=InterPro:IPR002586,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NW7,NCBI_GP:CAD66746.1;Name=CAD66746.1;Note=Similar to Streptomyces coelicolor putative partitioning or sporulation protein SCO1772 or SCI51.12c SWALL:Q9S228 (EMBL:AL109848) (340 aa) fasta scores: E(): 9.9e-52%2C 57.14%25 id in 252 aa%2C and to Bacillus subtilis sporulation initiation inhibitor protein Soj SWALL:SOJ_BACSU (SWALL:P37522) (253 aa) fasta scores: E(): 2.6e-38%2C 46.21%25 id in 251 aa;gbkey=CDS;product=putative sporulation/chromosome partition protein;protein_id=CAD66746.1;transl_table=11
BX072543.1	EMBL	sequence_feature	48223	48556	.	+	.	ID=id109;Note=ParA family ATPase Score %3D 119.9 E-value %3D 3.4e-33;gbkey=misc_feature
BX072543.1	EMBL	gene	48827	49963	.	+	.	ID=gene54;Name=TW060;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW060
BX072543.1	EMBL	CDS	48827	49963	.	+	0	ID=cds54;Parent=gene54;Dbxref=GOA:Q83NW6,InterPro:IPR002912,InterPro:IPR003099,InterPro:IPR008927,InterPro:IPR016040,UniProtKB/TrEMBL:Q83NW6,NCBI_GP:CAD66747.1;Name=CAD66747.1;Note=Similar to Staphylococcus aureus prephenate dehydrogenase TyrA or Mw1252 SWALL:BAB95117 (EMBL:AP004826) (363 aa) fasta scores: E(): 8.9e-10%2C 27.5%25 id in 389 aa;gbkey=CDS;product=putative oxidoreductase;protein_id=CAD66747.1;transl_table=11
BX072543.1	EMBL	sequence_feature	48839	49721	.	+	.	ID=id110;Note=Prephenate dehydrogenase Score %3D 124.4 E-value %3D 1.5e-34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	49763	49856	.	+	.	ID=id111;Note=ACT domain Score %3D 19.1 E-value %3D 4.5e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	49945	52005	.	+	.	ID=gene55;Name=TW061;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW061
BX072543.1	EMBL	CDS	49945	52005	.	+	0	ID=cds55;Parent=gene55;Dbxref=GOA:Q83NW5,InterPro:IPR003136,InterPro:IPR005225,InterPro:IPR006073,InterPro:IPR011994,InterPro:IPR015946,InterPro:IPR016484,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NW5,NCBI_GP:CAD66748.1;Name=CAD66748.1;Note=Similar to many eg. Streptomyces coelicolor putative GTP binding protein SCO1758 or 2SCI34.11c SWALL:Q9EWW8 (EMBL:AL445403) (492 aa) fasta scores: E(): 8.6e-84%2C 49.49%25 id in 493 aa. N-terminal region contains match to Pfam PF02224 Cytidylate kinase.;gbkey=CDS;product=putative GTP-binding protein;protein_id=CAD66748.1;transl_table=11
BX072543.1	EMBL	sequence_feature	49975	49998	.	+	.	ID=id112;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	50152	50617	.	+	.	ID=id113;Note=Cytidylate kinase Score %3D 66.2 E-value %3D 4.8e-17;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	50725	50748	.	+	.	ID=id114;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	50911	51682	.	+	.	ID=id115;Note=GTPase of unknown function Score %3D 158.0 E-value %3D 1.2e-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	51238	51261	.	+	.	ID=id116;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	52002	53279	.	-	.	ID=gene56;Name=TW062;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW062
BX072543.1	EMBL	CDS	52002	53279	.	-	0	ID=cds56;Parent=gene56;Dbxref=GOA:Q83NW4,InterPro:IPR004561,InterPro:IPR005801,InterPro:IPR015890,UniProtKB/TrEMBL:Q83NW4,NCBI_GP:CAD66749.1;Name=CAD66749.1;Note=Similar to Pseudomonas putida anthranilate synthase component I TrpE SWALL:TRPE_PSEPU (SWALL:P20579) (493 aa) fasta scores: E(): 5e-16%2C 29.18%25 id in 281 aa;gbkey=CDS;product=putative chorismate binding enzyme;protein_id=CAD66749.1;transl_table=11
BX072543.1	EMBL	sequence_feature	52010	52829	.	-	.	ID=id117;Note=chorismate binding enzyme Score %3D 42.5 E-value %3D 1.2e-18;gbkey=misc_feature
BX072543.1	EMBL	gene	53375	54094	.	+	.	ID=gene57;Name=TW063;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW063
BX072543.1	EMBL	CDS	53375	54094	.	+	0	ID=cds57;Parent=gene57;Dbxref=GOA:P67065,InterPro:IPR004033,InterPro:IPR023576,InterPro:IPR029063,NCBI_GP:CAD66750.1;Name=CAD66750.1;Note=Similar to Streptomyces coelicolor putative ubiquinone/menaquinone methyltransferase SCO4556 or SCD16a.27c SWALL:Q9XAP8 (EMBL:AL078618) (231 aa) fasta scores: E(): 1.6e-29%2C 42.17%25 id in 230 aa%2C and to Escherichia coli%2C and Escherichia coli O157:H7 ubiquinone/menaquinone biosynthesis methyltransferase UbiE or b3833 or z5355 or ecs4763 SWALL:UBIE_ECOLI (SWALL:P27851) (251 aa) fasta scores: E(): 6.5e-23%2C 36.32%25 id in 245 aa;gbkey=CDS;product=putative ubiquinone/menaquinone methyltransferase;protein_id=CAD66750.1;transl_table=11
BX072543.1	EMBL	sequence_feature	53396	54080	.	+	.	ID=id118;Note=ubiE/COQ5 methyltransferase family Score %3D 136.3 E-value %3D 3.8e-38;gbkey=misc_feature
BX072543.1	EMBL	gene	54106	55122	.	+	.	ID=gene58;Name=TW064;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW064
BX072543.1	EMBL	CDS	54106	55122	.	+	0	ID=cds58;Parent=gene58;Dbxref=GOA:Q83NW3,InterPro:IPR000092,InterPro:IPR008949,InterPro:IPR017446,UniProtKB/TrEMBL:Q83NW3,NCBI_GP:CAD66751.1;Name=CAD66751.1;Note=Similar to Streptomyces coelicolor putative transferase SCO4583 or SCD20.01 SWALL:Q9F2X8 (EMBL:AL392148) (336 aa) fasta scores: E(): 3.3e-37%2C 38.19%25 id in 343 aa%2C and to Gluconobacter oxydans decaprenyl diphosphate synthase DdsA SWALL:O82832 (EMBL:AB006850) (315 aa) fasta scores: E(): 2.4e-23%2C 32.55%25 id in 301 aa;gbkey=CDS;product=putative polyprenyl diphosphate synthase;protein_id=CAD66751.1;transl_table=11
BX072543.1	EMBL	sequence_feature	54223	54985	.	+	.	ID=id119;Note=Polyprenyl synthetase Score %3D 137.2 E-value %3D 2.2e-38;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	54424	54447	.	+	.	ID=id120;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	54733	54771	.	+	.	ID=id121;Note=PS00444 Polyprenyl synthetases signature 2.;gbkey=misc_feature
BX072543.1	EMBL	gene	55141	56484	.	+	.	ID=gene59;Name=TW065;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW065
BX072543.1	EMBL	CDS	55141	56484	.	+	0	ID=cds59;Parent=gene59;Dbxref=GOA:Q83NW2,InterPro:IPR016040,InterPro:IPR021163,UniProtKB/TrEMBL:Q83NW2,NCBI_GP:CAD66752.1;Name=CAD66752.1;Note=Similar to Streptomyces coelicolor putative ferredoxin/ferredoxin-NADP reductase SCO0681 or SCF15.02 SWALL:Q9RK35 (EMBL:AL132856) (454 aa) fasta scores: E(): 1.3e-71%2C 43.55%25 id in 450 aa%2C and to Rattus norvegicus NADPH:adrenodoxin oxidoreductase%2C mitochondrial precursor FdxR SWALL:ADRO_RAT (SWALL:P56522) (494 aa) fasta scores: E(): 7.4e-33%2C 35.16%25 id in 455 aa;gbkey=CDS;product=putative ferredoxin/ferredoxin-NADP reductase;protein_id=CAD66752.1;transl_table=11
BX072543.1	EMBL	gene	56824	57795	.	-	.	ID=gene60;Name=TW066;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW066
BX072543.1	EMBL	CDS	56824	57795	.	-	0	ID=cds60;Parent=gene60;Dbxref=InterPro:IPR002491,UniProtKB/TrEMBL:Q83IE3,NCBI_GP:CAD66753.1;Name=CAD66753.1;Note=Similar to Streptomyces coelicolor putative iron-siderophore binding lipoprotein SCO0494 or SCF34.13c SWALL:Q9RK12 (EMBL:AL109974) (350 aa) fasta scores: E(): 7.7e-19%2C 30.97%25 id in 339 aa%2C and to Corynebacterium diphtheriae DtxR/iron regulated lipoprotein precursor Irp1 SWALL:Q46023 (EMBL:U02617) (355 aa) fasta scores: E(): 1e-12%2C 31.02%25 id in 303 aa;gbkey=CDS;product=putative iron-siderophore binding lipoprotein;protein_id=CAD66753.1;transl_table=11
BX072543.1	EMBL	sequence_feature	56928	57651	.	-	.	ID=id122;Note=Periplasmic binding protein Score %3D 83.8 E-value %3D 2.5e-22;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	57718	57795	.	-	.	ID=id123;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.630 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	57739	57771	.	-	.	ID=id124;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	57921	58916	.	-	.	ID=gene61;Name=TW067;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW067
BX072543.1	EMBL	CDS	57921	58916	.	-	0	ID=cds61;Parent=gene61;Dbxref=InterPro:IPR002491,UniProtKB/TrEMBL:Q83IE2,NCBI_GP:CAD66754.1;Name=CAD66754.1;Note=Similar to Streptomyces coelicolor putative iron-siderophore binding lipoprotein SCO0494 or SCF34.13c SWALL:Q9RK12 (EMBL:AL109974) (350 aa) fasta scores: E(): 4.2e-19%2C 29.82%25 id in 342 aa%2C and to Mycobacterium smegmatis FxtD SWALL:O87315 (EMBL:AF027770) (420 aa) fasta scores: E(): 2.7e-12%2C 31.09%25 id in 238 aa;gbkey=CDS;product=putative iron-siderophore binding lipoprotein;protein_id=CAD66754.1;transl_table=11
BX072543.1	EMBL	sequence_feature	58025	58772	.	-	.	ID=id125;Note=Periplasmic binding protein Score %3D 81.2 E-value %3D 1.5e-21;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	58839	58916	.	-	.	ID=id126;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.630 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	58860	58892	.	-	.	ID=id127;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	59134	59919	.	-	.	ID=gene62;Name=TW068;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW068
BX072543.1	EMBL	CDS	59134	59919	.	-	0	ID=cds62;Parent=gene62;Dbxref=GOA:Q83IE1,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IE1,NCBI_GP:CAD66755.1;Name=CAD66755.1;Note=Similar to Escherichia coli ferric enterobactin transport ATP-binding protein FepC or b0588 SWALL:FEPC_ECOLI (SWALL:P23878) (271 aa) fasta scores: E(): 8.6e-42%2C 50%25 id in 250 aa;gbkey=CDS;product=putative iron-siderophore uptake system ATP-binding component;protein_id=CAD66755.1;transl_table=11
BX072543.1	EMBL	sequence_feature	59286	59841	.	-	.	ID=id128;Note=ABC transporter Score %3D 172.0 E-value %3D 6.8e-49;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	59467	59511	.	-	.	ID=id129;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	59797	59820	.	-	.	ID=id130;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	59903	60937	.	-	.	ID=gene63;Name=TW069;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW069
BX072543.1	EMBL	CDS	59903	60937	.	-	0	ID=cds63;Parent=gene63;Dbxref=GOA:Q83NW1,InterPro:IPR000522,InterPro:IPR029022,UniProtKB/TrEMBL:Q83NW1,NCBI_GP:CAD66756.1;Name=CAD66756.1;Note=Similar to Escherichia coli ferric enterobactin transport system permease protein FepG or b0589 SWALL:FEPG_ECOLI (SWALL:P23877) (330 aa) fasta scores: E(): 1.2e-43%2C 39.93%25 id in 323 aa;gbkey=CDS;product=putative iron-siderophore uptake system integral membrane component;protein_id=CAD66756.1;transl_table=11
BX072543.1	EMBL	sequence_feature	59929	60814	.	-	.	ID=id131;Note=FecCD transport family Score %3D 267.8 E-value %3D 9.9e-78;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	60809	60877	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	60662	60730	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	60566	60625	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	60488	60556	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	60269	60322	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	60119	60187	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	60032	60100	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	59936	60004	.	-	.	ID=id132;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 70-92%2C 105-124%2C 128-150%2C 206-223%2C 251-273%2C 280-302 and 312-334;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	60806	60937	.	-	.	ID=id133;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.829) with cleavage site probability 0.374 between residues 44 and 45;gbkey=misc_feature
BX072543.1	EMBL	gene	60943	61908	.	-	.	ID=gene64;Name=TW070;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW070
BX072543.1	EMBL	CDS	60943	61908	.	-	0	ID=cds64;Parent=gene64;Dbxref=GOA:Q83NW0,InterPro:IPR000522,InterPro:IPR029022,UniProtKB/TrEMBL:Q83NW0,NCBI_GP:CAD66757.1;Name=CAD66757.1;Note=Similar to Escherichia coli ferric enterobactin transport system permease protein FepD or b0590 SWALL:FEPD_ECOLI (SWALL:P23876) (334 aa) fasta scores: E(): 5.2e-33%2C 40%25 id in 305 aa;gbkey=CDS;product=putative iron-siderophore uptake system integral membrane component;protein_id=CAD66757.1;transl_table=11
BX072543.1	EMBL	sequence_feature	60960	61824	.	-	.	ID=id134;Note=FecCD transport family Score %3D 223.4 E-value %3D 2.3e-64;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	61828	61896	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	61675	61743	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	61579	61647	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	61498	61566	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	61417	61485	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	61276	61344	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	61150	61218	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	61054	61113	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	60967	61026	.	-	.	ID=id135;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 56-78%2C 88-110%2C 115-137%2C 142-164%2C 189-211%2C 231-253%2C 266-285 and 295-314;gbkey=misc_feature;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	61786	61908	.	-	.	ID=id136;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.836) with cleavage site probability 0.222 between residues 41 and 42;gbkey=misc_feature
BX072543.1	EMBL	tRNA	62075	62151	.	-	.	ID=rna2;Note=tRNA Met anticodon CAT%2C Cove score 95.55;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	exon	62075	62151	.	-	.	ID=id137;Parent=rna2;Note=tRNA Met anticodon CAT%2C Cove score 95.55;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	tRNA	62170	62241	.	-	.	ID=rna3;Note=tRNA Thr anticodon GGT%2C Cove score 73.84;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	exon	62170	62241	.	-	.	ID=id138;Parent=rna3;Note=tRNA Thr anticodon GGT%2C Cove score 73.84;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	gene	62354	62647	.	+	.	ID=gene65;Name=TW071;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW071
BX072543.1	EMBL	CDS	62354	62647	.	+	0	ID=cds65;Parent=gene65;Dbxref=GOA:Q83NV9,InterPro:IPR001845,InterPro:IPR011991,UniProtKB/TrEMBL:Q83NV9,NCBI_GP:CAD66758.1;Name=CAD66758.1;Note=Similar to Staphylococcus aureus cadmium efflux system accessory protein homolog cadC SWALL:CADF_STAAU (SWALL:P37374) (121 aa) fasta scores: E(): 3e-07%2C 37.89%25 id in 95 aa;gbkey=CDS;product=putative regulator;protein_id=CAD66758.1;transl_table=11
BX072543.1	EMBL	sequence_feature	62396	62627	.	+	.	ID=id139;Note=Bacterial regulatory protein%2C arsR family Score %3D 84.2 E-value %3D 1.9e-22;gbkey=misc_feature
BX072543.1	EMBL	tRNA	62810	62892	.	-	.	ID=rna4;Note=tRNA Tyr anticodon GTA%2C Cove score 64.70;gbkey=tRNA;product=tRNA-Tyr
BX072543.1	EMBL	exon	62810	62892	.	-	.	ID=id140;Parent=rna4;Note=tRNA Tyr anticodon GTA%2C Cove score 64.70;gbkey=tRNA;product=tRNA-Tyr
BX072543.1	EMBL	gene	62943	64580	.	-	.	ID=gene66;Name=lysS;gbkey=Gene;gene=lysS;gene_biotype=protein_coding;locus_tag=TW072
BX072543.1	EMBL	CDS	62943	64580	.	-	0	ID=cds66;Parent=gene66;Dbxref=GOA:Q83IE0,InterPro:IPR001412,InterPro:IPR002904,InterPro:IPR008925,InterPro:IPR014729,InterPro:IPR020751,InterPro:IPR023386,UniProtKB/TrEMBL:Q83IE0,NCBI_GP:CAD66759.1;Name=CAD66759.1;Note=Similar to Pyrococcus horikoshii lysyl-tRNA synthetase LysS or ph0224 SWALL:SYK_PYRHO (SWALL:O57963) (523 aa) fasta scores: E(): 2e-56%2C 33.2%25 id in 530 aa;gbkey=CDS;gene=lysS;product=lysyl-tRNA synthetase;protein_id=CAD66759.1;transl_table=11
BX072543.1	EMBL	sequence_feature	62966	64532	.	-	.	ID=id141;Note=tRNA synthetases class I (K) Score %3D 364.7 E-value %3D 7e-107;gbkey=misc_feature;gene=lysS
BX072543.1	EMBL	sequence_feature	64419	64448	.	-	.	ID=id142;Note=PS00178 Aminoacyl-transfer RNA synthetases class-I signature.;gbkey=misc_feature;gene=lysS
BX072543.1	EMBL	gene	64669	65535	.	+	.	ID=gene67;Name=panC;gbkey=Gene;gene=panC;gene_biotype=protein_coding;locus_tag=TW073
BX072543.1	EMBL	CDS	64669	65535	.	+	0	ID=cds67;Parent=gene67;Dbxref=GOA:Q83ID9,InterPro:IPR003721,InterPro:IPR014729,NCBI_GP:CAD66760.1;Name=CAD66760.1;Note=Similar to Corynebacterium glutamicum pantoate--beta-alanine ligase PanC or cgl0113 SWALL:PANC_CORGL (SWALL:Q9X713) (279 aa) fasta scores: E(): 1.5e-27%2C 39.59%25 id in 293 aa;gbkey=CDS;gene=panC;product=pantoate--beta-alanine ligase;protein_id=CAD66760.1;transl_table=11
BX072543.1	EMBL	sequence_feature	64675	65521	.	+	.	ID=id143;Note=Pantoate-beta-alanine ligase Score %3D 171.0 E-value %3D 1.4e-48;gbkey=misc_feature;gene=panC
BX072543.1	EMBL	gene	65832	67328	.	+	.	ID=gene68;Name=TW074;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW074
BX072543.1	EMBL	CDS	65832	67328	.	+	0	ID=cds68;Parent=gene68;Dbxref=GOA:Q83NV8,InterPro:IPR001736,InterPro:IPR022924,InterPro:IPR025202,UniProtKB/TrEMBL:Q83NV8,NCBI_GP:CAD66761.1;Name=CAD66761.1;Note=Similar to Escherichia coli cardiolipin synthetase Cls or Nov or b1249 SWALL:CLS_ECOLI (SWALL:P31071) (486 aa) fasta scores: E(): 4.9e-21%2C 30.64%25 id in 496 aa;gbkey=CDS;product=putative phospholipase;protein_id=CAD66761.1;transl_table=11
BX072543.1	EMBL	sequence_feature	65844	65912	.	+	.	ID=id144;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27 and 34-56;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	65931	65999	.	+	.	ID=id144;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27 and 34-56;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	66471	66552	.	+	.	ID=id145;Note=Phospholipase D. Active site motif Score %3D 27.9 E-value %3D 1.7e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	67062	67143	.	+	.	ID=id146;Note=Phospholipase D. Active site motif Score %3D 28.7 E-value %3D 9.3e-06;gbkey=misc_feature
BX072543.1	EMBL	gene	67380	69902	.	+	.	ID=gene69;Name=TW075;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW075
BX072543.1	EMBL	CDS	67380	69902	.	+	0	ID=cds69;Parent=gene69;Dbxref=GOA:Q83ID8,InterPro:IPR001270,InterPro:IPR003593,InterPro:IPR003959,InterPro:IPR004176,InterPro:IPR019489,InterPro:IPR023150,InterPro:IPR027417,UniProtKB/TrEMBL:Q83ID8,NCBI_GP:CAD66762.1;Name=CAD66762.1;Note=Similar to Bacillus subtilis negative regulator of genetic competence ClpC/MecB SWALL:CLPC_BACSU (SWALL:P37571) (810 aa) fasta scores: E(): 3e-152%2C 56.66%25 id in 810 aa%2C and to Streptomyces coelicolor putative Vlp-family ATP-binding protease SCO3373 or SCE94.24c SWALL:Q9S6T8 (EMBL:AL049628) (841 aa) fasta scores: E(): 7.6e-189%2C 65.87%25 id in 838 aa;gbkey=CDS;product=putative Clp-family ATP-binding protease/regulator;protein_id=CAD66762.1;transl_table=11
BX072543.1	EMBL	sequence_feature	67437	67593	.	+	.	ID=id147;Note=Clp amino terminal domain Score %3D 69.5 E-value %3D 5e-18;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	67662	67818	.	+	.	ID=id148;Note=Clp amino terminal domain Score %3D 74.2 E-value %3D 1.9e-19;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	68010	68589	.	+	.	ID=id149;Note=ATPase family associated with various cellular activities (AAA) Score %3D 44.1 E-value %3D 2.3e-10;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	68025	68048	.	+	.	ID=id150;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	69021	69681	.	+	.	ID=id151;Note=ATPase family associated with various cellular activities (AAA) Score %3D 15.1 E-value %3D 5.8e-06;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	69036	69059	.	+	.	ID=id152;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	70637	72220	.	+	.	ID=gene70;Name=menD;gbkey=Gene;gene=menD;gene_biotype=protein_coding;locus_tag=TW078
BX072543.1	EMBL	CDS	70637	72220	.	+	0	ID=cds70;Parent=gene70;Dbxref=GOA:Q83ID7,InterPro:IPR004433,InterPro:IPR012001,InterPro:IPR029061,UniProtKB/TrEMBL:Q83ID7,NCBI_GP:CAD66763.1;Name=CAD66763.1;Note=Similar to Bacillus subtilis menaquinone biosynthesis protein MenD [includes: 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase MenD SWALL:MEND_BACSU (SWALL:P23970) (580 aa) fasta scores: E(): 3.6e-17%2C 28.57%25 id in 525 aa%2C and to Mycobacterium leprae putative 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase / 2-oxoglutarate decarboxylase MenD or ML2270 SWALL:Q9CBB0 (EMBL:AL583925) (556 aa) fasta scores: E(): 1.4e-25%2C 32.95%25 id in 531 aa;gbkey=CDS;gene=menD;product=putative menaquinone biosynthesis protein MenD;protein_id=CAD66763.1;transl_table=11
BX072543.1	EMBL	sequence_feature	70640	71186	.	+	.	ID=id153;Note=Thiamine pyrophosphate enzyme%2C N-terminal TPP binding domain Score %3D -42.9 E-value %3D 5.4e-05;gbkey=misc_feature;gene=menD
BX072543.1	EMBL	gene	72230	72775	.	+	.	ID=gene71;Name=TW079;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW079
BX072543.1	EMBL	CDS	72230	72775	.	+	0	ID=cds71;Parent=gene71;Dbxref=UniProtKB/TrEMBL:Q83NV7,NCBI_GP:CAD66764.1;Name=CAD66764.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD66764.1;transl_table=11
BX072543.1	EMBL	sequence_feature	72230	72367	.	+	.	ID=id154;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.820 between residues 46 and 47;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	72263	72316	.	+	.	ID=id155;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 12-29;gbkey=misc_feature
BX072543.1	EMBL	gene	72796	73707	.	+	.	ID=gene72;Name=menA;gbkey=Gene;gene=menA;gene_biotype=protein_coding;locus_tag=TW080
BX072543.1	EMBL	CDS	72796	73707	.	+	0	ID=cds72;Parent=gene72;Dbxref=GOA:Q83ID6,InterPro:IPR000537,InterPro:IPR004657,InterPro:IPR026046,UniProtKB/TrEMBL:Q83ID6,NCBI_GP:CAD66765.1;Name=CAD66765.1;Note=Similar to Escherichia coli 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase MenA or b3930 SWALL:MENA_ECOLI (SWALL:P32166) (308 aa) fasta scores: E(): 8.9e-17%2C 33.45%25 id in 275 aa%2C and to Mycobacterium tuberculosis probable 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase MenA or Rv0534c or mt0558 or mtcy25d10.13C SWALL:MENA_MYCTU (SWALL:O06400) (292 aa) fasta scores: E(): 2.8e-24%2C 40.63%25 id in 251 aa;gbkey=CDS;gene=menA;product=1%2C4-dihydroxy-2-naphthoate octaprenyltransferase;protein_id=CAD66765.1;transl_table=11
BX072543.1	EMBL	sequence_feature	72796	72942	.	+	.	ID=id156;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.204 between residues 49 and 50;gbkey=misc_feature;gene=menA
BX072543.1	EMBL	sequence_feature	72832	72900	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	72943	73011	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	73072	73140	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	73183	73251	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	73270	73338	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	73351	73410	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	73468	73536	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	73546	73614	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	73633	73701	.	+	.	ID=id157;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 50-72%2C 93-115%2C 130-152%2C 159-181%2C 186-205%2C 225-247%2C 251-273 and 280-302;gbkey=misc_feature;gene=menA;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	72880	73696	.	+	.	ID=id158;Note=UbiA prenyltransferase family Score %3D 64.0 E-value %3D 2.3e-16;gbkey=misc_feature;gene=menA
BX072543.1	EMBL	gene	73945	77412	.	+	.	ID=gene73;Name=rpoB;gbkey=Gene;gene=rpoB;gene_biotype=protein_coding;locus_tag=TW081
BX072543.1	EMBL	CDS	73945	77412	.	+	0	ID=cds73;Parent=gene73;Dbxref=GOA:P59642,InterPro:IPR007120,InterPro:IPR007121,InterPro:IPR007641,InterPro:IPR007642,InterPro:IPR007644,InterPro:IPR007645,InterPro:IPR010243,InterPro:IPR014724,InterPro:IPR015712,InterPro:IPR019462,NCBI_GP:CAD66766.1;Name=CAD66766.1;Note=Previously sequenced as Tropheryma whipplei DNA-directed RNA polymerase beta chain RpoB SWALL:RPOB_TROWH (SWALL:Q93GF2) (1216 aa) fasta scores: E(): 0%2C 99.56%25 id in 1155 aa. Similar to Mycobacterium tuberculosis DNA-directed RNA polymerase beta chain RpoB or Rv0667 or mt0695 or mtci376.08C SWALL:RPOB_MYCTU (SWALL:P47766) (1178 aa) fasta scores: E(): 0%2C 65.56%25 id in 1150 aa;gbkey=CDS;gene=rpoB;product=DNA-directed RNA polymerase beta chain;protein_id=CAD66766.1;transl_table=11
BX072543.1	EMBL	sequence_feature	74044	75205	.	+	.	ID=id159;Note=RNA polymerase beta subunit Score %3D 78.2 E-value %3D 1.2e-20;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	sequence_feature	74449	75001	.	+	.	ID=id160;Note=RNA polymerase Rpb2%2C domain 2 Score %3D 48.6 E-value %3D 1e-11;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	sequence_feature	75208	75424	.	+	.	ID=id161;Note=RNA polymerase Rpb2%2C domain 3 Score %3D 145.8 E-value %3D 5.4e-41;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	sequence_feature	75826	77077	.	+	.	ID=id162;Note=RNA polymerase Rpb2%2C domain 6 Score %3D 688.8 E-value %3D 1.9e-204;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	sequence_feature	76552	76590	.	+	.	ID=id163;Note=PS01166 RNA polymerases beta chain signature.;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	sequence_feature	77083	77311	.	+	.	ID=id164;Note=RNA polymerase Rpb2%2C domain 7 Score %3D 170.3 E-value %3D 2.2e-48;gbkey=misc_feature;gene=rpoB
BX072543.1	EMBL	gene	77472	81299	.	+	.	ID=gene74;Name=rpoC;gbkey=Gene;gene=rpoC;gene_biotype=protein_coding;locus_tag=TW082
BX072543.1	EMBL	CDS	77472	81299	.	+	0	ID=cds74;Parent=gene74;Dbxref=GOA:Q820D9,InterPro:IPR000722,InterPro:IPR006592,InterPro:IPR007066,InterPro:IPR007080,InterPro:IPR007081,InterPro:IPR007083,InterPro:IPR012754,NCBI_GP:CAD66767.1;Name=CAD66767.1;Note=Similar to Aquifex pyrophilus DNA-directed RNA polymerase beta' chain RpoC SWALL:RPOC_AQUPY (SWALL:Q9X6Y2) (1576 aa) fasta scores: E(): 3.4e-124%2C 40.11%25 id in 1573 aa;gbkey=CDS;gene=rpoC;product=DNA-directed RNA polymerase beta' chain;protein_id=CAD66767.1;transl_table=11
BX072543.1	EMBL	sequence_feature	78687	79113	.	+	.	ID=id165;Note=RNA polymerase Rpb1%2C domain 2 Score %3D 282.9 E-value %3D 2.9e-82;gbkey=misc_feature;gene=rpoC
BX072543.1	EMBL	gene	81523	82884	.	-	.	ID=gene75;Name=TW083;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW083
BX072543.1	EMBL	CDS	81523	82884	.	-	0	ID=cds75;Parent=gene75;Dbxref=GOA:Q83ID5,InterPro:IPR003140,InterPro:IPR029058,UniProtKB/TrEMBL:Q83ID5,NCBI_GP:CAD66768.1;Name=CAD66768.1;Note=Similar to Synechocystis sp. serine esterase sll1284 SWALL:P73192 (EMBL:D90904) (204 aa) fasta scores: E(): 0.0001%2C 29.01%25 id in 193 aa;gbkey=CDS;product=putative hydrolase;protein_id=CAD66768.1;transl_table=11
BX072543.1	EMBL	sequence_feature	81528	82152	.	-	.	ID=id166;Note=Phospholipase/Carboxylesterase Score %3D 19.9 E-value %3D 6.7e-10;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	82173	82329	.	-	.	ID=id167;Note=Phospholipase/Carboxylesterase Score %3D 26.2 E-value %3D 2.4e-07;gbkey=misc_feature
BX072543.1	EMBL	gene	82958	83341	.	+	.	ID=gene76;Name=groS;gbkey=Gene;gene=groS;gene_biotype=protein_coding;locus_tag=TW084
BX072543.1	EMBL	CDS	82958	83341	.	+	0	ID=cds76;Parent=gene76;Dbxref=GOA:Q83NV6,InterPro:IPR011032,InterPro:IPR018369,InterPro:IPR020818,UniProtKB/TrEMBL:Q83NV6,NCBI_GP:CAD66769.1;Name=CAD66769.1;Note=Similar to Streptomyces coelicolor and Streptomyces lividans 10 kDa chaperonin GroS or SCO4761 or SC6G4.39 SWALL:CH10_STRCO (SWALL:P40172) (102 aa) fasta scores: E(): 3.9e-21%2C 68.42%25 id in 95 aa;gbkey=CDS;gene=groS;product=10 kDa chaperonin;protein_id=CAD66769.1;transl_table=11
BX072543.1	EMBL	sequence_feature	83051	83333	.	+	.	ID=id168;Note=Chaperonin 10 Kd subunit Score %3D 189.8 E-value %3D 3e-54;gbkey=misc_feature;gene=groS
BX072543.1	EMBL	sequence_feature	83057	83131	.	+	.	ID=id169;Note=PS00681 Chaperonins cpn10 signature.;gbkey=misc_feature;gene=groS
BX072543.1	EMBL	gene	83392	84867	.	+	.	ID=gene77;Name=guaB1;gbkey=Gene;gene=guaB1;gene_biotype=protein_coding;locus_tag=TW085
BX072543.1	EMBL	CDS	83392	84867	.	+	0	ID=cds77;Parent=gene77;Dbxref=GOA:Q83ID4,InterPro:IPR000644,InterPro:IPR001093,InterPro:IPR005990,InterPro:IPR013785,InterPro:IPR015875,UniProtKB/TrEMBL:Q83ID4,NCBI_GP:CAD66770.1;Name=CAD66770.1;Note=Similar to Bacillus subtilis inosine-5'-monophosphate dehydrogenase GuaB or GnaB SWALL:IMDH_BACSU (SWALL:P21879) (513 aa) fasta scores: E(): 2.1e-87%2C 50.92%25 id in 489 aa;gbkey=CDS;gene=guaB1;product=inosine-5'-monophosphate dehydrogenase;protein_id=CAD66770.1;transl_table=11
BX072543.1	EMBL	sequence_feature	83392	84856	.	+	.	ID=id170;Note=IMP dehydrogenase / GMP reductase Score %3D 647.7 E-value %3D 4.4e-192;gbkey=misc_feature;gene=guaB1
BX072543.1	EMBL	sequence_feature	83668	83827	.	+	.	ID=id171;Note=CBS domain Score %3D 55.5 E-value %3D 8.2e-14;gbkey=misc_feature;gene=guaB1
BX072543.1	EMBL	sequence_feature	83860	84019	.	+	.	ID=id172;Note=CBS domain Score %3D 45.7 E-value %3D 7.6e-11;gbkey=misc_feature;gene=guaB1
BX072543.1	EMBL	sequence_feature	84292	84330	.	+	.	ID=id173;Note=PS00487 IMP dehydrogenase / GMP reductase signature.;gbkey=misc_feature;gene=guaB1
BX072543.1	EMBL	gene	84872	85993	.	+	.	ID=gene78;Name=guaB2;gbkey=Gene;gene=guaB2;gene_biotype=protein_coding;locus_tag=TW086
BX072543.1	EMBL	CDS	84872	85993	.	+	0	ID=cds78;Parent=gene78;Dbxref=GOA:Q83NV5,InterPro:IPR001093,InterPro:IPR005992,InterPro:IPR013785,UniProtKB/TrEMBL:Q83NV5,NCBI_GP:CAD66771.1;Name=CAD66771.1;Note=Similar to Streptomyces coelicolor putative inosine-5'-monophosphate dehydrogenase SCO4771 or SCD63.03 SWALL:Q9L0I6 (EMBL:AL161755) (374 aa) fasta scores: E(): 7.1e-82%2C 58.64%25 id in 370 aa%2C and to Escherichia coli and Escherichia coli O157:H7 inosine-5'-monophosphate dehydrogenase GuaB or b2508 or z3772 or ecs3370 SWALL:IMDH_ECOLI (SWALL:P06981) (488 aa) fasta scores: E(): 7.5e-05%2C 32.94%25 id in 170 aa;gbkey=CDS;gene=guaB2;product=putative inosine-5'-monophosphate dehydrogenase;protein_id=CAD66771.1;transl_table=11
BX072543.1	EMBL	sequence_feature	85421	85748	.	+	.	ID=id174;Note=IMP dehydrogenase / GMP reductase Score %3D 39.4 E-value %3D 1.7e-11;gbkey=misc_feature;gene=guaB2
BX072543.1	EMBL	gene	85986	86699	.	+	.	ID=gene79;Name=TW087;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW087
BX072543.1	EMBL	CDS	85986	86699	.	+	0	ID=cds79;Parent=gene79;Dbxref=GOA:Q83NV4,InterPro:IPR002994,UniProtKB/TrEMBL:Q83NV4,NCBI_GP:CAD66772.1;Name=CAD66772.1;Note=Similar to Streptomyces coelicolor putative membrane protein SCO1829 or SCI8.14 SWALL:Q9RJ39 (EMBL:AL132644) (290 aa) fasta scores: E(): 0.37%2C 25.79%25 id in 252 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66772.1;transl_table=11
BX072543.1	EMBL	sequence_feature	85986	86096	.	+	.	ID=id175;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.976) with cleavage site probability 0.587 between residues 37 and 38;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	86013	86072	.	+	.	ID=id176;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29 and 201-223;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	86586	86654	.	+	.	ID=id176;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29 and 201-223;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	86765	87202	.	+	.	ID=gene80;Name=TW088;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW088
BX072543.1	EMBL	CDS	86765	87202	.	+	0	ID=cds80;Parent=gene80;Dbxref=InterPro:IPR023845,UniProtKB/TrEMBL:Q83NV3,NCBI_GP:CAD66773.1;Name=CAD66773.1;Note=Similar to Corynebacterium glutamicum hypothetical membrane protein Cgl2499 SWALL:BAB99892 (EMBL:AP005281) (118 aa) fasta scores: E(): 0.0015%2C 31.53%25 id in 130 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66773.1;transl_table=11
BX072543.1	EMBL	sequence_feature	86861	86929	.	+	.	ID=id177;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 76-98 and 108-130;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	86990	87058	.	+	.	ID=id177;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 76-98 and 108-130;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	87086	87154	.	+	.	ID=id177;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 76-98 and 108-130;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	87199	88710	.	+	.	ID=gene81;Name=guaA;gbkey=Gene;gene=guaA;gene_biotype=protein_coding;locus_tag=TW089
BX072543.1	EMBL	CDS	87199	88710	.	+	0	ID=cds81;Parent=gene81;Dbxref=GOA:Q83ID3,InterPro:IPR001674,InterPro:IPR004739,InterPro:IPR014729,InterPro:IPR017926,InterPro:IPR022310,InterPro:IPR022955,InterPro:IPR025777,InterPro:IPR029062,NCBI_GP:CAD66774.1;Name=CAD66774.1;Note=Similar to Bacillus subtilis GMP synthase [glutamine-hydrolyzing] GuaA SWALL:GUAA_BACSU (SWALL:P29727) (513 aa) fasta scores: E(): 2.2e-94%2C 50.49%25 id in 509 aa;gbkey=CDS;gene=guaA;product=GMP synthase [glutamine-hydrolyzing];protein_id=CAD66774.1;transl_table=11
BX072543.1	EMBL	sequence_feature	87211	87748	.	+	.	ID=id178;Note=Glutamine amidotransferase class-I Score %3D 137.2 E-value %3D 2.1e-38;gbkey=misc_feature;gene=guaA
BX072543.1	EMBL	sequence_feature	87421	87456	.	+	.	ID=id179;Note=PS00442 Glutamine amidotransferases class-I active site.;gbkey=misc_feature;gene=guaA
BX072543.1	EMBL	sequence_feature	88351	88702	.	+	.	ID=id180;Note=GMP synthase C terminal domain Score %3D 195.4 E-value %3D 6.1e-56;gbkey=misc_feature;gene=guaA
BX072543.1	EMBL	gene	88815	91046	.	+	.	ID=gene82;Name=TW090;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW090
BX072543.1	EMBL	CDS	88815	91046	.	+	0	ID=cds82;Parent=gene82;Dbxref=GOA:Q83ID2,InterPro:IPR000212,InterPro:IPR014016,InterPro:IPR014017,InterPro:IPR027417,UniProtKB/TrEMBL:Q83ID2,NCBI_GP:CAD66775.1;Name=CAD66775.1;Note=Similar to Bacillus subtilis ATP-dependent DNA helicase PcrA SWALL:PCRA_BACSU (SWALL:O34580) (739 aa) fasta scores: E(): 1.1e-72%2C 41.42%25 id in 758 aa;gbkey=CDS;product=ATP-dependent DNA helicase;protein_id=CAD66775.1;transl_table=11
BX072543.1	EMBL	sequence_feature	88845	90321	.	+	.	ID=id181;Note=UvrD/REP helicase Score %3D 607.9 E-value %3D 4.2e-180;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	88902	88925	.	+	.	ID=id182;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	91313	92797	.	+	.	ID=gene83;Name=TW092;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW092
BX072543.1	EMBL	CDS	91313	92797	.	+	0	ID=cds83;Parent=gene83;Dbxref=GOA:Q83NV2,InterPro:IPR009056,UniProtKB/TrEMBL:Q83NV2,NCBI_GP:CAD66776.1;Name=CAD66776.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66776.1;transl_table=11
BX072543.1	EMBL	sequence_feature	91349	91417	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=1/10;partial=true
BX072543.1	EMBL	sequence_feature	91514	91582	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=2/10;partial=true
BX072543.1	EMBL	sequence_feature	91616	91684	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=3/10;partial=true
BX072543.1	EMBL	sequence_feature	91712	91771	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=4/10;partial=true
BX072543.1	EMBL	sequence_feature	91868	91936	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=5/10;partial=true
BX072543.1	EMBL	sequence_feature	91964	92032	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=6/10;partial=true
BX072543.1	EMBL	sequence_feature	92036	92104	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=7/10;partial=true
BX072543.1	EMBL	sequence_feature	92162	92230	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=8/10;partial=true
BX072543.1	EMBL	sequence_feature	92267	92335	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=9/10;partial=true
BX072543.1	EMBL	sequence_feature	92378	92446	.	+	.	ID=id183;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 68-90%2C 102-124%2C 134-153%2C 186-208%2C 218-240%2C 242-264%2C 284-306%2C 319-341 and 356-378;gbkey=misc_feature;is_ordered=true;part=10/10;partial=true
BX072543.1	EMBL	gene	92799	93437	.	+	.	ID=gene84;Name=purN;gbkey=Gene;gene=purN;gene_biotype=protein_coding;locus_tag=TW093
BX072543.1	EMBL	CDS	92799	93437	.	+	0	ID=cds84;Parent=gene84;Dbxref=GOA:Q83ID1,InterPro:IPR002376,InterPro:IPR004607,UniProtKB/TrEMBL:Q83ID1,NCBI_GP:CAD66777.1;Name=CAD66777.1;Note=Similar to Mycobacterium paratuberculosis PurN SWALL:Q9RAJ6 (EMBL:AF191543) (209 aa) fasta scores: E(): 1.5e-21%2C 42.39%25 id in 184 aa and to Escherichia coli phosphoribosylglycinamide formyltransferase PurN or b2500 SWALL:PUR3_ECOLI (SWALL:P08179) (212 aa) fasta scores: E(): 2.1e-17%2C 36.2%25 id in 174 aa;gbkey=CDS;gene=purN;product=phosphoribosylglycinamide formyltransferase;protein_id=CAD66777.1;transl_table=11
BX072543.1	EMBL	sequence_feature	92811	93348	.	+	.	ID=id184;Note=Formyl transferase Score %3D 147.5 E-value %3D 1.7e-41;gbkey=misc_feature;gene=purN
BX072543.1	EMBL	gene	93477	95105	.	+	.	ID=gene85;Name=purH;gbkey=Gene;gene=purH;gene_biotype=protein_coding;locus_tag=TW094
BX072543.1	EMBL	CDS	93477	95105	.	+	0	ID=cds85;Parent=gene85;Dbxref=GOA:Q83ID0,InterPro:IPR002695,InterPro:IPR011607,InterPro:IPR016193,InterPro:IPR024051,UniProtKB/TrEMBL:Q83ID0,NCBI_GP:CAD66778.1;Name=CAD66778.1;Note=Similar to Mycobacterium paratuberculosis PurH SWALL:Q9RAJ5 (EMBL:AF191543) (527 aa) fasta scores: E(): 8.2e-59%2C 50.46%25 id in 543 aa%2C and to Escherichia coli bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase purh or b4006 SWALL:PUR9_ECOLI (SWALL:P15639) (529 aa) fasta scores: E(): 2.6e-27%2C 39.48%25 id in 547 aa;gbkey=CDS;gene=purH;product=bifunctional purine biosynthesis protein PurH;protein_id=CAD66778.1;transl_table=11
BX072543.1	EMBL	sequence_feature	93504	93876	.	+	.	ID=id185;Note=MGS-like domain Score %3D 106.3 E-value %3D 4.1e-29;gbkey=misc_feature;gene=purH
BX072543.1	EMBL	sequence_feature	93891	94905	.	+	.	ID=id186;Note=AICARFT/IMPCHase bienzyme Score %3D 360.0 E-value %3D 1.8e-105;gbkey=misc_feature;gene=purH
BX072543.1	EMBL	gene	95180	95521	.	-	.	ID=gene86;Name=TW095;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW095
BX072543.1	EMBL	CDS	95180	95521	.	-	0	ID=cds86;Parent=gene86;Dbxref=UniProtKB/TrEMBL:Q83NV1,NCBI_GP:CAD66779.1;Name=CAD66779.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66779.1;transl_table=11
BX072543.1	EMBL	sequence_feature	95429	95497	.	-	.	ID=id187;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 36-58%2C 65-87 and 92-111;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	95348	95416	.	-	.	ID=id187;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 36-58%2C 65-87 and 92-111;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	95261	95329	.	-	.	ID=id187;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 36-58%2C 65-87 and 92-111;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	95189	95248	.	-	.	ID=id187;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 36-58%2C 65-87 and 92-111;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	95393	95521	.	-	.	ID=id188;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.620) with cleavage site probability 0.196 between residues 43 and 44;gbkey=misc_feature
BX072543.1	EMBL	gene	95602	96681	.	+	.	ID=gene87;Name=TW096;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW096
BX072543.1	EMBL	CDS	95602	96681	.	+	0	ID=cds87;Parent=gene87;Dbxref=GOA:Q83NV0,InterPro:IPR011701,InterPro:IPR016196,InterPro:IPR020846,UniProtKB/TrEMBL:Q83NV0,NCBI_GP:CAD66780.1;Name=CAD66780.1;Note=Weakly similar to Streptomyces coelicolor putative integral membrane transport protein SCO0079 or SCJ11.08c SWALL:Q9RI96 (EMBL:AL109949) (407 aa) fasta scores: E(): 2.3e-19%2C 26.37%25 id in 364 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66780.1;transl_table=11
BX072543.1	EMBL	sequence_feature	95659	95727	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=1/11;partial=true
BX072543.1	EMBL	sequence_feature	95764	95817	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=2/11;partial=true
BX072543.1	EMBL	sequence_feature	95827	95895	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=3/11;partial=true
BX072543.1	EMBL	sequence_feature	95932	96000	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=4/11;partial=true
BX072543.1	EMBL	sequence_feature	96010	96078	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=5/11;partial=true
BX072543.1	EMBL	sequence_feature	96139	96198	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=6/11;partial=true
BX072543.1	EMBL	sequence_feature	96241	96309	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=7/11;partial=true
BX072543.1	EMBL	sequence_feature	96328	96381	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=8/11;partial=true
BX072543.1	EMBL	sequence_feature	96391	96459	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=9/11;partial=true
BX072543.1	EMBL	sequence_feature	96493	96561	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=10/11;partial=true
BX072543.1	EMBL	sequence_feature	96571	96639	.	+	.	ID=id189;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 55-72%2C 76-98%2C 111-133%2C 137-159%2C 180-199%2C 214-236%2C 243-260%2C 264-286%2C 298-320 and 324-346;gbkey=misc_feature;is_ordered=true;part=11/11;partial=true
BX072543.1	EMBL	gene	96582	97733	.	-	.	ID=gene88;Name=truB;gbkey=Gene;gene=truB;gene_biotype=protein_coding;locus_tag=TW097
BX072543.1	EMBL	CDS	96582	97733	.	-	0	ID=cds88;Parent=gene88;Dbxref=GOA:Q820Z5,InterPro:IPR002501,InterPro:IPR014780,InterPro:IPR020103,NCBI_GP:CAD66781.1;Name=CAD66781.1;Note=Similar to Escherichia coli and Escherichia coli O157:H7 tRNA pseudouridine synthase B TruB or p35 or b3166 or z4527 or ecs4047 SWALL:TRUB_ECOLI (SWALL:P09171) (314 aa) fasta scores: E(): 2.2e-23%2C 35.24%25 id in 227 aa;gbkey=CDS;gene=truB;product=tRNA pseudouridine synthase B;protein_id=CAD66781.1;transl_table=11
BX072543.1	EMBL	sequence_feature	97169	97631	.	-	.	ID=id190;Note=TruB family pseudouridylate synthase (N terminal domain) Score %3D 155.3 E-value %3D 7.4e-44;gbkey=misc_feature;gene=truB
BX072543.1	EMBL	gene	97781	98905	.	+	.	ID=gene89;Name=TW098;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW098
BX072543.1	EMBL	CDS	97781	98905	.	+	0	ID=cds89;Parent=gene89;Dbxref=GOA:Q83IC9,InterPro:IPR001478,InterPro:IPR008915,UniProtKB/TrEMBL:Q83IC9,NCBI_GP:CAD66782.1;Name=CAD66782.1;Note=Similar to Mycobacterium tuberculosis hypothetical zinc metalloprotease Rv2869c or mt2937 or mtv003.15C SWALL:YS69_MYCTU (SWALL:O33351) (404 aa) fasta scores: E(): 8.7e-11%2C 34.51%25 id in 423 aa;gbkey=CDS;product=putative metalloprotease;protein_id=CAD66782.1;transl_table=11
BX072543.1	EMBL	sequence_feature	97784	97852	.	+	.	ID=id191;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 2-24%2C 107-129%2C 288-310 and 343-365;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	98099	98167	.	+	.	ID=id191;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 2-24%2C 107-129%2C 288-310 and 343-365;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	98642	98710	.	+	.	ID=id191;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 2-24%2C 107-129%2C 288-310 and 343-365;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	98807	98875	.	+	.	ID=id191;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 2-24%2C 107-129%2C 288-310 and 343-365;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	97802	98876	.	+	.	ID=id192;Note=Peptidase family M50 Score %3D 122.5 E-value %3D 5.6e-34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	97829	97858	.	+	.	ID=id193;Note=PS00142 Neutral zinc metallopeptidases%2C zinc-binding region signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	98096	98354	.	+	.	ID=id194;Note=PDZ domain (Also known as DHR or GLGF) Score %3D 11.3 E-value %3D 0.0056;gbkey=misc_feature
BX072543.1	EMBL	gene	98907	100013	.	-	.	ID=gene90;Name=dxr;gbkey=Gene;gene=dxr;gene_biotype=protein_coding;locus_tag=TW099
BX072543.1	EMBL	CDS	98907	100013	.	-	0	ID=cds90;Parent=gene90;Dbxref=GOA:Q83IC8,InterPro:IPR003821,InterPro:IPR013512,InterPro:IPR013644,InterPro:IPR016040,InterPro:IPR026877,NCBI_GP:CAD66783.1;Name=CAD66783.1;Note=Similar to Pseudomonas aeruginosa 1-deoxy-D-xylulose 5-phosphate reductoisomerase Dxr or pa3650 SWALL:DXR_PSEAE (SWALL:Q9KGU6) (396 aa) fasta scores: E(): 6.2e-42%2C 40.92%25 id in 391 aa;gbkey=CDS;gene=dxr;product=1-deoxy-D-xylulose 5-phosphate reductoisomerase;protein_id=CAD66783.1;transl_table=11
BX072543.1	EMBL	sequence_feature	98942	100004	.	-	.	ID=id195;Note=1-deoxy-D-xylulose 5-phosphate reductoisomerase Score %3D 517.2 E-value %3D 8.4e-153;gbkey=misc_feature;gene=dxr
BX072543.1	EMBL	gene	100065	100817	.	+	.	ID=gene91;Name=TW100;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW100
BX072543.1	EMBL	CDS	100065	100817	.	+	0	ID=cds91;Parent=gene91;Dbxref=GOA:Q83IC7,InterPro:IPR001932,InterPro:IPR015655,UniProtKB/TrEMBL:Q83IC7,NCBI_GP:CAD66784.1;Name=CAD66784.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO3845 or SCH69.15 SWALL:Q9XA19 (EMBL:AL079308) (515 aa) fasta scores: E(): 5.4e-22%2C 35.98%25 id in 239 aa%2C and to Rhizobium loti probable phosphoprotein phosphatase mlr2361 SWALL:Q98IK3 (EMBL:AP002999) (280 aa) fasta scores: E(): 1.4e-20%2C 36.08%25 id in 230 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66784.1;transl_table=11
BX072543.1	EMBL	sequence_feature	100122	100782	.	+	.	ID=id196;Note=Protein phosphatase 2C Score %3D -16.8 E-value %3D 2.9e-06;gbkey=misc_feature
BX072543.1	EMBL	gene	100840	102411	.	-	.	ID=gene92;Name=TW101;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW101
BX072543.1	EMBL	CDS	100840	102411	.	-	0	ID=cds92;Parent=gene92;Dbxref=GOA:Q820Z4,InterPro:IPR003959,InterPro:IPR027417,UniProtKB/TrEMBL:Q820Z4,NCBI_GP:CAD66785.1;Name=CAD66785.1;Note=Weakly similar to Methanosarcina acetivorans hypothetical protein Ma1866 SWALL:Q8TPP0 (EMBL:AE010868) (613 aa) fasta scores: E(): 0.0012%2C 22.1%25 id in 579 aa;gbkey=CDS;product=conserved hypothetical protein (putative ATP-binding);protein_id=CAD66785.1;transl_table=11
BX072543.1	EMBL	sequence_feature	102304	102327	.	-	.	ID=id197;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	102673	102936	.	+	.	ID=gene93;Name=TW103;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW103
BX072543.1	EMBL	CDS	102673	102936	.	+	0	ID=cds93;Parent=gene93;Dbxref=UniProtKB/TrEMBL:Q83NU9,NCBI_GP:CAD66786.1;Name=CAD66786.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD66786.1;transl_table=11
BX072543.1	EMBL	sequence_feature	102685	102738	.	+	.	ID=id198;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-22 and 32-54;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	102766	102834	.	+	.	ID=id198;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-22 and 32-54;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	102921	103964	.	+	.	ID=gene94;Name=TW104;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW104
BX072543.1	EMBL	CDS	102921	103964	.	+	0	ID=cds94;Parent=gene94;Dbxref=UniProtKB/TrEMBL:Q83NU8,NCBI_GP:CAD66787.1;Name=CAD66787.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66787.1;transl_table=11
BX072543.1	EMBL	sequence_feature	103011	103079	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	103122	103190	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	103251	103310	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	103353	103421	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	103458	103526	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	103644	103712	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	103749	103817	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	103860	103928	.	+	.	ID=id199;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 68-90%2C 111-130%2C 145-167%2C 180-202%2C 242-264%2C 277-299 and 314-336;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	gene	103993	104355	.	+	.	ID=gene95;Name=TW105;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW105
BX072543.1	EMBL	CDS	103993	104355	.	+	0	ID=cds95;Parent=gene95;Dbxref=UniProtKB/TrEMBL:Q83NU7,NCBI_GP:CAD66788.1;Name=CAD66788.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66788.1;transl_table=11
BX072543.1	EMBL	sequence_feature	104095	104163	.	+	.	ID=id200;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 22-44%2C 51-73 and 77-99;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	104182	104250	.	+	.	ID=id200;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 22-44%2C 51-73 and 77-99;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	104260	104328	.	+	.	ID=id200;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 22-44%2C 51-73 and 77-99;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	104352	105071	.	+	.	ID=gene96;Name=TW106;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW106
BX072543.1	EMBL	CDS	104352	105071	.	+	0	ID=cds96;Parent=gene96;Dbxref=GOA:Q83IC6,InterPro:IPR003439,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IC6,NCBI_GP:CAD66789.1;Name=CAD66789.1;Note=Similar to Myxococcus xanthus PilH SWALL:O30385 (EMBL:AF003632) (326 aa) fasta scores: E(): 1.1e-12%2C 33.49%25 id in 206 aa%2C and to Streptomyces coelicolor putative ABC transporter ATP-binding protein SCO3633 or SCH10.11 SWALL:Q9X8Q0 (EMBL:AL049754) (311 aa) fasta scores: E(): 2.3e-11%2C 29.61%25 id in 233 aa;gbkey=CDS;product=putative ABC transport ATP-binding subunit;protein_id=CAD66789.1;transl_table=11
BX072543.1	EMBL	sequence_feature	104439	104970	.	+	.	ID=id201;Note=ABC transporter Score %3D 87.8 E-value %3D 1.5e-23;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	104460	104483	.	+	.	ID=id202;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	104745	104789	.	+	.	ID=id203;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	105068	105424	.	+	.	ID=gene97;Name=TW107;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW107
BX072543.1	EMBL	CDS	105068	105424	.	+	0	ID=cds97;Parent=gene97;Dbxref=UniProtKB/TrEMBL:Q83NU6,NCBI_GP:CAD66790.1;Name=CAD66790.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66790.1;transl_table=11
BX072543.1	EMBL	sequence_feature	105068	105211	.	+	.	ID=id204;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.305 between residues 48 and 49;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	105125	105193	.	+	.	ID=id205;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42 and 77-99;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	105296	105364	.	+	.	ID=id205;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42 and 77-99;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	repeat_region	105691	107456	.	-	.	ID=id206;Note=Non-coding degenerately repetitive sequence related to non-coding repeats at complement(108625..110025)%2C complement(110760..111635)%2C complement(113459..115135) and coding repeats at 117585..118355;gbkey=repeat_region
BX072543.1	EMBL	tRNA	106618	106694	.	-	.	ID=rna5;Note=tRNA Pro anticodon GGG%2C Cove score 78.34;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	exon	106618	106694	.	-	.	ID=id207;Parent=rna5;Note=tRNA Pro anticodon GGG%2C Cove score 78.34;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	gene	107600	108649	.	-	.	ID=gene98;Name=TW108;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW108
BX072543.1	EMBL	CDS	107600	108649	.	-	0	ID=cds98;Parent=gene98;Dbxref=GOA:Q83NU5,InterPro:IPR002104,InterPro:IPR004107,InterPro:IPR011010,InterPro:IPR013762,InterPro:IPR023009,InterPro:IPR023109,UniProtKB/TrEMBL:Q83NU5,NCBI_GP:CAD66791.1;Name=CAD66791.1;Note=Similar to Corynebacterium glutamicum integrase Cgl1419 SWALL:BAB98812 (EMBL:AP005278) (304 aa) fasta scores: E(): 6.6e-16%2C 38.73%25 id in 333 aa%2C and to Pseudomonas aeruginosa integrase Inti1 SWALL:Q9AIL0 (EMBL:AF263519) (337 aa) fasta scores: E(): 4.4e-12%2C 28.75%25 id in 306 aa;gbkey=CDS;product=putative DNA recombinase;protein_id=CAD66791.1;transl_table=11
BX072543.1	EMBL	sequence_feature	107635	108271	.	-	.	ID=id208;Note=Phage integrase family Score %3D 163.2 E-value %3D 3e-46;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	108337	108592	.	-	.	ID=id209;Note=Phage integrase%2C N-terminal SAM-like domain Score %3D 23.4 E-value %3D 0.00024;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	108625	110025	.	-	.	ID=id210;Note=Non-coding degenerately repetitive sequence related to non-coding repeats at complement(105691..107456)%2C complement(110760..111635)%2C complement(113459..115135) and coding repeats at 117585..118355;gbkey=repeat_region
BX072543.1	EMBL	gene	110016	110624	.	-	.	ID=gene99;Name=TW109;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW109
BX072543.1	EMBL	CDS	110016	110624	.	-	0	ID=cds99;Parent=gene99;Dbxref=GOA:Q83IC5,InterPro:IPR000086,InterPro:IPR015797,UniProtKB/TrEMBL:Q83IC5,NCBI_GP:CAD66792.1;Name=CAD66792.1;Note=Similar to Streptomyces coelicolor hypothetical protein sco1775 sco1775 or sci51.15C SWALL:Q9S225 (EMBL:AL109848) (211 aa) fasta scores: E(): 6e-27%2C 46.74%25 id in 169 aa%2C and to Bacillus subtilis adp-ribose pyrophosphatase nudF SWALL:ADPP_BACSU (SWALL:P54570) (185 aa) fasta scores: E(): 1.1e-13%2C 33.15%25 id in 184 aa;gbkey=CDS;product=putative NUDIX hydrolase;protein_id=CAD66792.1;transl_table=11
BX072543.1	EMBL	sequence_feature	110114	110513	.	-	.	ID=id211;Note=NUDIX domain Score %3D 83.9 E-value %3D 2.3e-22;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	110760	111635	.	-	.	ID=id212;Note=Non-coding degenerately repetitive sequence related to non-coding repeats at complement(108625..110025)%2C complement(105691..107456)%2C complement(113459..115135) and coding repeats at 117585..118355;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	111536	111619	.	+	.	ID=id213;Note=(taaccaaaataaacagttggg)4;gbkey=repeat_region
BX072543.1	EMBL	gene	111707	113344	.	-	.	ID=gene100;Name=pyrG;gbkey=Gene;gene=pyrG;gene_biotype=protein_coding;locus_tag=TW110
BX072543.1	EMBL	CDS	111707	113344	.	-	0	ID=cds100;Parent=gene100;Dbxref=GOA:Q83IC4,InterPro:IPR004468,InterPro:IPR017456,InterPro:IPR017926,InterPro:IPR027417,InterPro:IPR029062,NCBI_GP:CAD66793.1;Name=CAD66793.1;Note=Similar to Chlamydia trachomatis CTP synthetase PyrG or Ct183 SWALL:PYRG_CHLTR (SWALL:Q59321) (539 aa) fasta scores: E(): 4.8e-90%2C 48.3%25 id in 532 aa%2C and to Streptomyces coelicolor putative CTP synthetase PyrG or SCO1776 or SCI51.16c SWALL:Q9S224 (EMBL:AL109848) (549 aa) fasta scores: E(): 1.2e-104%2C 58.92%25 id in 538 aa;gbkey=CDS;gene=pyrG;product=CTP synthetase;protein_id=CAD66793.1;transl_table=11
BX072543.1	EMBL	sequence_feature	111719	111742	.	-	.	ID=id214;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=pyrG
BX072543.1	EMBL	sequence_feature	111766	112450	.	-	.	ID=id215;Note=Glutamine amidotransferase class-I Score %3D 193.3 E-value %3D 2.7e-55;gbkey=misc_feature;gene=pyrG
BX072543.1	EMBL	sequence_feature	112199	112234	.	-	.	ID=id216;Note=PS00442 Glutamine amidotransferases class-I active site.;gbkey=misc_feature;gene=pyrG
BX072543.1	EMBL	sequence_feature	113258	113326	.	-	.	ID=id217;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature;gene=pyrG
BX072543.1	EMBL	repeat_region	113459	115135	.	-	.	ID=id218;Note=Non-coding degenerately repetitive sequence related to non-coding repeats at complement(108625..110025)%2C complement(110760..111635)%2C complement(105691..107456) and coding repeats at 117585..118355;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	115120	115176	.	+	.	ID=id219;Note=(acgtgcggccctgcatttc)3;gbkey=repeat_region
BX072543.1	EMBL	gene	115156	116793	.	-	.	ID=gene101;Name=recN;gbkey=Gene;gene=recN;gene_biotype=protein_coding;locus_tag=TW111
BX072543.1	EMBL	CDS	115156	116793	.	-	0	ID=cds101;Parent=gene101;Dbxref=GOA:Q83NU4,InterPro:IPR003395,InterPro:IPR003593,InterPro:IPR004604,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NU4,NCBI_GP:CAD66794.1;Name=CAD66794.1;Note=Similar to Escherichia coli DNA repair protein RecN or RadB or b2616 SWALL:RECN_ECOLI (SWALL:P05824) (553 aa) fasta scores: E(): 2.9e-30%2C 30.23%25 id in 559 aa;gbkey=CDS;gene=recN;product=DNA repair protein RecN;protein_id=CAD66794.1;transl_table=11
BX072543.1	EMBL	gene	116812	117729	.	-	.	ID=gene102;Name=TW112;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW112
BX072543.1	EMBL	CDS	116812	117729	.	-	0	ID=cds102;Parent=gene102;Dbxref=GOA:Q83IC3,InterPro:IPR002504,InterPro:IPR016064,InterPro:IPR017437,InterPro:IPR017438,NCBI_GP:CAD66795.1;Name=CAD66795.1;Note=Similar to Streptomyces coelicolor probable inorganic polyphosphate/ATP-NAD kinase PpnK or SCO1781 or SCI51.21c SWALL:PPNK_STRCO (SWALL:Q9S219) (301 aa) fasta scores: E(): 1.2e-29%2C 39.09%25 id in 220 aa;gbkey=CDS;product=putative ATP-NAD kinase;protein_id=CAD66795.1;transl_table=11
BX072543.1	EMBL	sequence_feature	116847	117597	.	-	.	ID=id220;Note=ATP-NAD kinase Score %3D 192.6 E-value %3D 4.5e-55;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	117585	118355	.	+	.	ID=id221;Note=Coding degenerately repetitive sequence inversely related to non-coding repeats at complement(105691..107456)%2C complement(108625..110025)%2C complement(110760..111635)%2C complement(113459..115135);gbkey=repeat_region
BX072543.1	EMBL	gene	117757	124683	.	-	.	ID=gene103;Name=TW113;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW113
BX072543.1	EMBL	CDS	117757	124683	.	-	0	ID=cds103;Parent=gene103;Dbxref=GOA:Q83NU3,InterPro:IPR008009,InterPro:IPR012421,InterPro:IPR013783,InterPro:IPR015919,UniProtKB/TrEMBL:Q83NU3,NCBI_GP:CAD66796.1;Name=CAD66796.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD66796.1;transl_table=11
BX072543.1	EMBL	sequence_feature	124573	124683	.	-	.	ID=id222;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.994) with cleavage site probability 0.943 between residues 43 and 44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	124597	124665	.	-	.	ID=id223;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-35;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	121274	121738	.	+	.	ID=id224;Note=rep11 inverted/repeated at 874563..875027;gbkey=repeat_region
BX072543.1	EMBL	gene	124733	125194	.	-	.	ID=gene104;Name=rplI;gbkey=Gene;gene=rplI;gene_biotype=protein_coding;locus_tag=TW114
BX072543.1	EMBL	CDS	124733	125194	.	-	0	ID=cds104;Parent=gene104;Dbxref=GOA:Q83IC2,InterPro:IPR000244,InterPro:IPR009027,InterPro:IPR020069,InterPro:IPR020070,InterPro:IPR020594,NCBI_GP:CAD66797.1;Name=CAD66797.1;Note=Similar to Streptomyces coelicolor 50s ribosomal protein L9 RplI or SCO3909 or SCH24.31 SWALL:RL9_STRCO (SWALL:Q9X8U5) (148 aa) fasta scores: E(): 3.6e-21%2C 44.66%25 id in 150 aa%2C and to Escherichia coli and Escherichia coli O157:H7 50s ribosomal protein l9 RplI or b4203 or z5812 or ecs5179 SWALL:RL9_ECOLI (SWALL:P02418) (149 aa) fasta scores: E(): 1.6e-11%2C 39.73%25 id in 151 aa;gbkey=CDS;gene=rplI;product=50s ribosomal protein L9;protein_id=CAD66797.1;transl_table=11
BX072543.1	EMBL	sequence_feature	124738	125008	.	-	.	ID=id225;Note=Ribosomal protein L9%2C C-terminal domain Score %3D 72.5 E-value %3D 6.2e-19;gbkey=misc_feature;gene=rplI
BX072543.1	EMBL	sequence_feature	125026	125191	.	-	.	ID=id226;Note=Ribosomal protein L9%2C N-terminal domain Score %3D 74.5 E-value %3D 1.5e-19;gbkey=misc_feature;gene=rplI
BX072543.1	EMBL	sequence_feature	125072	125155	.	-	.	ID=id227;Note=PS00651 Ribosomal protein L9 signature.;gbkey=misc_feature;gene=rplI
BX072543.1	EMBL	gene	125191	125442	.	-	.	ID=gene105;Name=rpsR;gbkey=Gene;gene=rpsR;gene_biotype=protein_coding;locus_tag=TW115
BX072543.1	EMBL	CDS	125191	125442	.	-	0	ID=cds105;Parent=gene105;Dbxref=GOA:Q83IC1,InterPro:IPR001648,InterPro:IPR018275,NCBI_GP:CAD66798.1;Name=CAD66798.1;Note=Similar to Streptomyces coelicolor 30s ribosomal protein S18-2 RpsR2 or SCO3425 or SCE9.32c SWALL:R18B_STRCO (SWALL:Q9X8K4) (79 aa) fasta scores: E(): 2.5e-09%2C 52.77%25 id in 72 aa%2C and to Escherichia coli%2C Escherichia coli O157:H7 and Salmonella typhi 30s ribosomal protein S18 RpsR or b4202 or z5811 or ecs5178 or sty4749 SWALL:RS18_ECOLI (SWALL:P02374) (74 aa) fasta scores: E(): 2.1e-05%2C 43.39%25 id in 53 aa;gbkey=CDS;gene=rpsR;product=30s ribosomal protein S18;protein_id=CAD66798.1;transl_table=11
BX072543.1	EMBL	sequence_feature	125220	125379	.	-	.	ID=id228;Note=Ribosomal protein S18 Score %3D 79.2 E-value %3D 5.8e-21;gbkey=misc_feature;gene=rpsR
BX072543.1	EMBL	gene	125457	126017	.	-	.	ID=gene106;Name=ssb1;gbkey=Gene;gene=ssb1;gene_biotype=protein_coding;locus_tag=TW116
BX072543.1	EMBL	CDS	125457	126017	.	-	0	ID=cds106;Parent=gene106;Dbxref=GOA:Q83NU2,InterPro:IPR000424,InterPro:IPR011344,InterPro:IPR012340,NCBI_GP:CAD66799.1;Name=CAD66799.1;Note=Similar to Escherichia coli and Escherichia coli O157:H7 single-strand binding protein Ssb or ExrB or LexC or b4059 or z5658 or ecs5041 SWALL:SSB_ECOLI (SWALL:P02339) (177 aa) fasta scores: E(): 8.8e-08%2C 27.95%25 id in 186 aa%2C and to Mycobacterium smegmatis single-stranded DNA-binding protein SWALL:Q9AFI5 (EMBL:AF349434) (165 aa) fasta scores: E(): 6.6e-32%2C 68.29%25 id in 123 aa;gbkey=CDS;gene=ssb1;product=single-strand binding protein;protein_id=CAD66799.1;transl_table=11
BX072543.1	EMBL	sequence_feature	125696	126014	.	-	.	ID=id229;Note=Single-strand binding protein family Score %3D 117.9 E-value %3D 1.3e-32;gbkey=misc_feature;gene=ssb1
BX072543.1	EMBL	gene	126021	126323	.	-	.	ID=gene107;Name=rpsF;gbkey=Gene;gene=rpsF;gene_biotype=protein_coding;locus_tag=TW117
BX072543.1	EMBL	CDS	126021	126323	.	-	0	ID=cds107;Parent=gene107;Dbxref=GOA:Q83IC0,InterPro:IPR000529,InterPro:IPR014717,InterPro:IPR020814,NCBI_GP:CAD66800.1;Name=CAD66800.1;Note=Similar to Streptomyces coelicolor 30s ribosomal protein S6 RpsF or SCO3906 or SCH24.28 SWALL:RS6_STRCO (SWALL:Q9X8U2) (96 aa) fasta scores: E(): 9.4e-07%2C 35.86%25 id in 92 aa;gbkey=CDS;gene=rpsF;product=30s ribosomal protein S6;protein_id=CAD66800.1;transl_table=11
BX072543.1	EMBL	sequence_feature	126035	126194	.	-	.	ID=id230;Note=Ribosomal protein S6 Score %3D 26.7 E-value %3D 7.9e-08;gbkey=misc_feature;gene=rpsF
BX072543.1	EMBL	gene	126672	127589	.	-	.	ID=gene108;Name=purC;gbkey=Gene;gene=purC;gene_biotype=protein_coding;locus_tag=TW119
BX072543.1	EMBL	CDS	126672	127589	.	-	0	ID=cds108;Parent=gene108;Dbxref=GOA:Q83IB9,InterPro:IPR001636,InterPro:IPR013816,InterPro:IPR018236,InterPro:IPR028923,NCBI_GP:CAD66801.1;Name=CAD66801.1;Note=Similar to Streptomyces coelicolor phosphoribosylaminoimidazole-succinocarboxamide synthase PurC or SCO4071 or SCD25.07 SWALL:Q9RKL1 (EMBL:AL118514) (299 aa) fasta scores: E(): 1e-38%2C 40.64%25 id in 310 aa%2C and to Mycobacterium tuberculosis phosphoribosylaminoimidazole-succinocarboxamide synthase PurC or Rv0780 or mt0804 or mtcy369.24 SWALL:PUR7_MYCTU (SWALL:Q59566) (297 aa) fasta scores: E(): 1.6e-28%2C 38.19%25 id in 288 aa;gbkey=CDS;gene=purC;product=phosphoribosylaminoimidazole-succinocarboxamide synthase;protein_id=CAD66801.1;transl_table=11
BX072543.1	EMBL	sequence_feature	126728	127547	.	-	.	ID=id231;Note=SAICAR synthetase Score %3D 194.1 E-value %3D 1.5e-55;gbkey=misc_feature;gene=purC
BX072543.1	EMBL	sequence_feature	126939	126965	.	-	.	ID=id232;Note=PS01058 SAICAR synthetase signature 2.;gbkey=misc_feature;gene=purC
BX072543.1	EMBL	gene	128106	129023	.	+	.	ID=gene109;Name=menB;gbkey=Gene;gene=menB;gene_biotype=protein_coding;locus_tag=TW120
BX072543.1	EMBL	CDS	128106	129023	.	+	0	ID=cds109;Parent=gene109;Dbxref=GOA:Q83IB8,InterPro:IPR001753,InterPro:IPR010198,InterPro:IPR014748,InterPro:IPR018376,InterPro:IPR029045,UniProtKB/TrEMBL:Q83IB8,NCBI_GP:CAD66802.1;Name=CAD66802.1;Note=Similar to Escherichia coli naphthoate synthase MenB or b2262 SWALL:MENB_ECOLI (SWALL:P27290) (285 aa) fasta scores: E(): 1.3e-46%2C 48.76%25 id in 283 aa%2C and to Mycobacterium tuberculosis MenB or Rv0548c or mtcy25d10.27c or mt0573 SWALL:O06414 (EMBL:Z95558) (314 aa) fasta scores: E(): 4.5e-71%2C 63.39%25 id in 295 aa;gbkey=CDS;gene=menB;product=naphthoate synthase;protein_id=CAD66802.1;transl_table=11
BX072543.1	EMBL	sequence_feature	128244	128781	.	+	.	ID=id233;Note=Enoyl-CoA hydratase/isomerase family Score %3D 125.3 E-value %3D 7.9e-35;gbkey=misc_feature;gene=menB
BX072543.1	EMBL	sequence_feature	128529	128591	.	+	.	ID=id234;Note=PS00166 Enoyl-CoA hydratase/isomerase signature.;gbkey=misc_feature;gene=menB
BX072543.1	EMBL	gene	129025	130161	.	+	.	ID=gene110;Name=menE;gbkey=Gene;gene=menE;gene_biotype=protein_coding;locus_tag=TW121
BX072543.1	EMBL	CDS	129025	130161	.	+	0	ID=cds110;Parent=gene110;Dbxref=GOA:Q83IB7,InterPro:IPR000873,UniProtKB/TrEMBL:Q83IB7,NCBI_GP:CAD66803.1;Name=CAD66803.1;Note=Similar to Escherichia coli O-succinylbenzoic acid--CoA ligase MenE or b2260 SWALL:MENE_ECOLI (SWALL:P37353) (451 aa) fasta scores: E(): 2.5e-10%2C 28.11%25 id in 345 aa%2C and to Mycobacterium tuberculosis MenE or Rv0542c or mtcy25d10.21c or mt0567 SWALL:O06408 (EMBL:Z95558) (362 aa) fasta scores: E(): 2.5e-29%2C 32.84%25 id in 338 aa;gbkey=CDS;gene=menE;product=O-succinylbenzoic acid--CoA ligase;protein_id=CAD66803.1;transl_table=11
BX072543.1	EMBL	sequence_feature	129151	129649	.	+	.	ID=id235;Note=AMP-binding enzyme Score %3D 30.4 E-value %3D 1.5e-08;gbkey=misc_feature;gene=menE
BX072543.1	EMBL	sequence_feature	129688	129928	.	+	.	ID=id236;Note=AMP-binding enzyme Score %3D 44.7 E-value %3D 1.7e-12;gbkey=misc_feature;gene=menE
BX072543.1	EMBL	tRNA	130466	130552	.	+	.	ID=rna6;Note=tRNA Ser anticodon CGA%2C Cove score 52.75;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	exon	130466	130552	.	+	.	ID=id237;Parent=rna6;Note=tRNA Ser anticodon CGA%2C Cove score 52.75;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	gene	130688	131341	.	+	.	ID=gene111;Name=ideR;gbkey=Gene;gene=ideR;gene_biotype=protein_coding;locus_tag=TW124
BX072543.1	EMBL	CDS	130688	131341	.	+	0	ID=cds111;Parent=gene111;Dbxref=GOA:Q83NU1,InterPro:IPR001367,InterPro:IPR008988,InterPro:IPR011991,InterPro:IPR022687,InterPro:IPR022689,UniProtKB/TrEMBL:Q83NU1,NCBI_GP:CAD66804.1;Name=CAD66804.1;Note=Similar to Mycobacterium tuberculosis iron-dependent repressor IdeR or DtxR or Rv2711 or mt2784 or mtcy05a6.32 SWALL:IDER_MYCTU (SWALL:Q50495) (230 aa) fasta scores: E(): 6.4e-29%2C 42.98%25 id in 221 aa%2C and to Streptomyces lividans and Streptomyces coelicolor iron repressor DesR or DmdR1 or SCO4394 or SCD10.26 SWALL:Q54343 (EMBL:Z50049) (230 aa) fasta scores: E(): 3.8e-32%2C 47.23%25 id in 199 aa;gbkey=CDS;gene=ideR;product=iron-dependent repressor;protein_id=CAD66804.1;transl_table=11
BX072543.1	EMBL	sequence_feature	130688	130850	.	+	.	ID=id238;Note=Iron dependent repressor%2C N-terminal DNA binding domain Score %3D 32.7 E-value %3D 5.9e-07;gbkey=misc_feature;gene=ideR
BX072543.1	EMBL	sequence_feature	130856	131066	.	+	.	ID=id239;Note=Iron dependent repressor%2C metal binding and dimerisation domain Score %3D 104.2 E-value %3D 1.8e-28;gbkey=misc_feature;gene=ideR
BX072543.1	EMBL	gene	131520	131756	.	+	.	ID=gene112;Name=rpmB;gbkey=Gene;gene=rpmB;gene_biotype=protein_coding;locus_tag=TW125
BX072543.1	EMBL	CDS	131520	131756	.	+	0	ID=cds112;Parent=gene112;Dbxref=GOA:Q83IB6,InterPro:IPR001383,InterPro:IPR026569,NCBI_GP:CAD66805.1;Name=CAD66805.1;Note=Similar to Escherichia coli 50s ribosomal protein l28 RpmB or b3637 or z5061 or ecs4512 SWALL:RL28_ECOLI (SWALL:P02428) (77 aa) fasta scores: E(): 2.9e-10%2C 51.31%25 id in 76 aa;gbkey=CDS;gene=rpmB;product=50s ribosomal protein L28;protein_id=CAD66805.1;transl_table=11
BX072543.1	EMBL	sequence_feature	131526	131706	.	+	.	ID=id240;Note=Ribosomal L28 family Score %3D 75.1 E-value %3D 1e-19;gbkey=misc_feature;gene=rpmB
BX072543.1	EMBL	gene	131756	131926	.	+	.	ID=gene113;Name=rpmG;gbkey=Gene;gene=rpmG;gene_biotype=protein_coding;locus_tag=TW126
BX072543.1	EMBL	CDS	131756	131926	.	+	0	ID=cds113;Parent=gene113;Dbxref=GOA:Q83IB5,InterPro:IPR001705,InterPro:IPR011332,InterPro:IPR018264,NCBI_GP:CAD66806.1;Name=CAD66806.1;Note=Similar to Escherichia coli 50s ribosomal protein l33 RpmG or b3636 SWALL:RL33_ECOLI (SWALL:P02436) (54 aa) fasta scores: E(): 3.6e-07%2C 43.13%25 id in 51 aa%2C and to Mycobacterium tuberculosis 50s ribosomal protein l33 type 1 RpmG or Rv2057c or mt2117.1 or mtcy63a.03 SWALL:R331_MYCTU (SWALL:O86356) (54 aa) fasta scores: E(): 3.1e-17%2C 78.84%25 id in 52 aa;gbkey=CDS;gene=rpmG;product=50s ribosomal protein L33;protein_id=CAD66806.1;transl_table=11
BX072543.1	EMBL	sequence_feature	131780	131921	.	+	.	ID=id241;Note=Ribosomal protein L33 Score %3D 42.9 E-value %3D 5.2e-10;gbkey=misc_feature;gene=rpmG
BX072543.1	EMBL	gene	131927	132232	.	+	.	ID=gene114;Name=rpsN;gbkey=Gene;gene=rpsN;gene_biotype=protein_coding;locus_tag=TW127
BX072543.1	EMBL	CDS	131927	132232	.	+	0	ID=cds114;Parent=gene114;Dbxref=GOA:Q83IB4,InterPro:IPR001209,InterPro:IPR023036,NCBI_GP:CAD66807.1;Name=CAD66807.1;Note=Similar to Escherichia coli 30s ribosomal protein S14 RpsN or b3307 or z4677 or ecs4172 SWALL:RS14_ECOLI (SWALL:P02370) (100 aa) fasta scores: E(): 5.8e-12%2C 47%25 id in 100 aa%2C and to Mycobacterium tuberculosis 30s ribosomal protein S14-2 RpsN2 or Rv2056c or mt2117 or mtcy63a.04 SWALL:R14B_MYCTU (SWALL:O86355) (101 aa) fasta scores: E(): 1.2e-21%2C 61.38%25 id in 101 aa;gbkey=CDS;gene=rpsN;product=30s ribosomal protein S14;protein_id=CAD66807.1;transl_table=11
BX072543.1	EMBL	sequence_feature	131927	132227	.	+	.	ID=id242;Note=Ribosomal protein S14p/S29e Score %3D 114.0 E-value %3D 2e-31;gbkey=misc_feature;gene=rpsN
BX072543.1	EMBL	gene	132298	132579	.	+	.	ID=gene115;Name=hup;gbkey=Gene;gene=hup;gene_biotype=protein_coding;locus_tag=TW128
BX072543.1	EMBL	CDS	132298	132579	.	+	0	ID=cds115;Parent=gene115;Dbxref=GOA:Q83IB3,InterPro:IPR000119,InterPro:IPR010992,UniProtKB/TrEMBL:Q83IB3,NCBI_GP:CAD66808.1;Name=CAD66808.1;Note=Similar to Escherichia coli DNA-binding protein HU-alpha HupA or b4000 or z5576 or ecs4923 SWALL:DBHA_ECOLI (SWALL:P02342) (90 aa) fasta scores: E(): 7.7e-08%2C 37.77%25 id in 90 aa%2C and to Streptomyces coelicolor%2C and Streptomyces lividans DNA-binding protein HU 1 Hup1 or Hup or SCO2950 or SCE59.09 SWALL:DBH1_STRCO (SWALL:O06447) (93 aa) fasta scores: E(): 5.1e-13%2C 50.54%25 id in 91 aa;gbkey=CDS;gene=hup;product=DNA-binding protein HU-alpha;protein_id=CAD66808.1;transl_table=11
BX072543.1	EMBL	sequence_feature	132307	132574	.	+	.	ID=id243;Note=Bacterial DNA-binding protein Score %3D 97.6 E-value %3D 1.8e-26;gbkey=misc_feature;gene=hup
BX072543.1	EMBL	sequence_feature	132319	132384	.	+	.	ID=id244;Note=Predicted helix-turn-helix motif with score 1013.000%2C SD 2.64 at aa 8-29%2C sequence ELVAKVAETSGVSRATVNSVIE;gbkey=misc_feature;gene=hup
BX072543.1	EMBL	gene	132629	134734	.	+	.	ID=gene116;Name=TW129;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW129
BX072543.1	EMBL	CDS	132629	134734	.	+	0	ID=cds116;Parent=gene116;Dbxref=InterPro:IPR019108,UniProtKB/TrEMBL:Q83NU0,NCBI_GP:CAD66809.1;Name=CAD66809.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv0102 or mt0111 or mtcy251.21 SWALL:Y102_MYCTU (SWALL:Q10897) (661 aa) fasta scores: E(): 8.5e-38%2C 31.79%25 id in 478 aa%2C and to Streptomyces coelicolor putative integral membrane protein SCO1215 or 2SCG58.15 SWALL:Q9FC98 (EMBL:AL391017) (316 aa) fasta scores: E(): 3.3e-37%2C 40.13%25 id in 304 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66809.1;transl_table=11
BX072543.1	EMBL	sequence_feature	132629	132730	.	+	.	ID=id245;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.974) with cleavage site probability 0.443 between residues 34 and 35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	132647	132715	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=1/16;partial=true
BX072543.1	EMBL	sequence_feature	132758	132826	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=2/16;partial=true
BX072543.1	EMBL	sequence_feature	132863	132931	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=3/16;partial=true
BX072543.1	EMBL	sequence_feature	132974	133042	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=4/16;partial=true
BX072543.1	EMBL	sequence_feature	133061	133114	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=5/16;partial=true
BX072543.1	EMBL	sequence_feature	133340	133408	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=6/16;partial=true
BX072543.1	EMBL	sequence_feature	133487	133555	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=7/16;partial=true
BX072543.1	EMBL	sequence_feature	133598	133657	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=8/16;partial=true
BX072543.1	EMBL	sequence_feature	133676	133744	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=9/16;partial=true
BX072543.1	EMBL	sequence_feature	133847	133915	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=10/16;partial=true
BX072543.1	EMBL	sequence_feature	133973	134041	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=11/16;partial=true
BX072543.1	EMBL	sequence_feature	134069	134137	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=12/16;partial=true
BX072543.1	EMBL	sequence_feature	134198	134266	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=13/16;partial=true
BX072543.1	EMBL	sequence_feature	134309	134377	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=14/16;partial=true
BX072543.1	EMBL	sequence_feature	134414	134482	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=15/16;partial=true
BX072543.1	EMBL	sequence_feature	134561	134629	.	+	.	ID=id246;Note=16 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 116-138%2C 145-162%2C 238-260%2C 287-309%2C 324-343%2C 350-372%2C 407-429%2C 449-471%2C 481-503%2C 524-546%2C 561-583%2C 596-618 and 645-667;gbkey=misc_feature;is_ordered=true;part=16/16;partial=true
BX072543.1	EMBL	gene	134760	136832	.	+	.	ID=gene117;Name=TW130;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW130
BX072543.1	EMBL	CDS	134760	136832	.	+	0	ID=cds117;Parent=gene117;Dbxref=GOA:Q83IB2,InterPro:IPR000330,InterPro:IPR001650,InterPro:IPR014001,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IB2,NCBI_GP:CAD66810.1;Name=CAD66810.1;Note=Similar to Anabaena sp. hypothetical protein Alr4398 SWALL:Q8YP09 (EMBL:AP003596) (1075 aa) fasta scores: E(): 9.6e-17%2C 26.54%25 id in 584 aa%2C and to Drosophila melanogaster IswI protein or cg8625 SWALL:ISWI_DROME (SWALL:Q24368) (1027 aa) fasta scores: E(): 2.3e-15%2C 26.16%25 id in 474 aa;gbkey=CDS;product=putative helicase regulator;protein_id=CAD66810.1;transl_table=11
BX072543.1	EMBL	sequence_feature	135399	136293	.	+	.	ID=id247;Note=SNF2 family N-terminal domain Score %3D -26.6 E-value %3D 2.3e-08;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	136401	136620	.	+	.	ID=id248;Note=Helicase conserved C-terminal domain Score %3D 52.2 E-value %3D 8.2e-13;gbkey=misc_feature
BX072543.1	EMBL	gene	136972	138165	.	+	.	ID=gene118;Name=tufA;gbkey=Gene;gene=tufA;gene_biotype=protein_coding;locus_tag=TW131
BX072543.1	EMBL	CDS	136972	138165	.	+	0	ID=cds118;Parent=gene118;Dbxref=GOA:Q83NT9,InterPro:IPR000795,InterPro:IPR004160,InterPro:IPR004161,InterPro:IPR004541,InterPro:IPR005225,InterPro:IPR009000,InterPro:IPR009001,InterPro:IPR027417,NCBI_GP:CAD66811.1;Name=CAD66811.1;Note=Similar to Escherichia coli elongation factor TU (TufA or b3339) and (TufB or b3980) SWALL:EFTU_ECOLI (SWALL:P02990) (393 aa) fasta scores: E(): 1.1e-103%2C 70.38%25 id in 395 aa%2C and to Micrococcus luteus elongation factor TU Tuf or TufA SWALL:EFTU_MICLU (SWALL:P09953) (396 aa) fasta scores: E(): 6.3e-119%2C 82.02%25 id in 395 aa;gbkey=CDS;gene=tufA;product=elongation factor TU-1;protein_id=CAD66811.1;transl_table=11
BX072543.1	EMBL	sequence_feature	136999	137590	.	+	.	ID=id249;Note=Elongation factor Tu GTP binding domain Score %3D 317.3 E-value %3D 1.2e-92;gbkey=misc_feature;gene=tufA
BX072543.1	EMBL	sequence_feature	137026	137049	.	+	.	ID=id250;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=tufA
BX072543.1	EMBL	sequence_feature	137131	137178	.	+	.	ID=id251;Note=PS00301 GTP-binding elongation factors signature.;gbkey=misc_feature;gene=tufA
BX072543.1	EMBL	sequence_feature	137626	137860	.	+	.	ID=id252;Note=Elongation factor Tu domain 2 Score %3D 105.9 E-value %3D 5.4e-29;gbkey=misc_feature;gene=tufA
BX072543.1	EMBL	sequence_feature	137872	138157	.	+	.	ID=id253;Note=Elongation factor Tu C-terminal domain Score %3D 190.4 E-value %3D 2e-54;gbkey=misc_feature;gene=tufA
BX072543.1	EMBL	gene	138453	140111	.	-	.	ID=gene119;Name=TW132;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW132
BX072543.1	EMBL	CDS	138453	140111	.	-	0	ID=cds119;Parent=gene119;Dbxref=GOA:Q83NT8,InterPro:IPR003342,InterPro:IPR027005,UniProtKB/TrEMBL:Q83NT8,NCBI_GP:CAD66812.1;Name=CAD66812.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66812.1;transl_table=11
BX072543.1	EMBL	sequence_feature	140043	140102	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=1/10;partial=true
BX072543.1	EMBL	sequence_feature	139737	139805	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=2/10;partial=true
BX072543.1	EMBL	sequence_feature	139665	139724	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=3/10;partial=true
BX072543.1	EMBL	sequence_feature	139593	139652	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=4/10;partial=true
BX072543.1	EMBL	sequence_feature	139386	139454	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=5/10;partial=true
BX072543.1	EMBL	sequence_feature	139257	139325	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=6/10;partial=true
BX072543.1	EMBL	sequence_feature	138933	138992	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=7/10;partial=true
BX072543.1	EMBL	sequence_feature	138855	138914	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=8/10;partial=true
BX072543.1	EMBL	sequence_feature	138777	138845	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=9/10;partial=true
BX072543.1	EMBL	sequence_feature	138507	138575	.	-	.	ID=id254;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-23%2C 103-125%2C 130-149%2C 154-173%2C 220-242%2C 263-285%2C 374-393%2C 400-419%2C 423-445 and 513-535;gbkey=misc_feature;is_ordered=true;part=10/10;partial=true
BX072543.1	EMBL	sequence_feature	139244	140093	.	-	.	ID=id255;Note=Dolichyl-phosphate-mannose-protein mannosyltransferase Score %3D 3.2 E-value %3D 0.00012;gbkey=misc_feature
BX072543.1	EMBL	gene	140623	141990	.	+	.	ID=gene120;Name=manA;gbkey=Gene;gene=manA;gene_biotype=protein_coding;locus_tag=TW133
BX072543.1	EMBL	CDS	140623	141990	.	+	0	ID=cds120;Parent=gene120;Dbxref=GOA:Q83IB1,InterPro:IPR001250,InterPro:IPR011051,InterPro:IPR014710,InterPro:IPR016305,UniProtKB/TrEMBL:Q83IB1,NCBI_GP:CAD66813.1;Name=CAD66813.1;Note=Similar to Escherichia coli mannose-6-phosphate isomerase ManA or Pmi or b1613 SWALL:MANA_ECOLI (SWALL:P00946) (391 aa) fasta scores: E(): 2.9e-15%2C 30.23%25 id in 387 aa%2C and to Streptomyces coelicolor mannose-6-phosphate isomerase ManA or SCO3025 or SCE34.06c SWALL:Q9KZL9 (EMBL:AL353862) (383 aa) fasta scores: E(): 1.5e-22%2C 34.36%25 id in 323 aa;gbkey=CDS;gene=manA;product=mannose-6-phosphate isomerase;protein_id=CAD66813.1;transl_table=11
BX072543.1	EMBL	sequence_feature	140638	141607	.	+	.	ID=id256;Note=Phosphomannose isomerase type I Score %3D 64.2 E-value %3D 2e-16;gbkey=misc_feature;gene=manA
BX072543.1	EMBL	gene	142042	142350	.	+	.	ID=gene121;Name=TW134;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW134
BX072543.1	EMBL	CDS	142042	142350	.	+	0	ID=cds121;Parent=gene121;Dbxref=GOA:Q83NT7,InterPro:IPR003482,UniProtKB/TrEMBL:Q83NT7,NCBI_GP:CAD66814.1;Name=CAD66814.1;Note=Similar to Streptomyces griseocarneus WhiB-STV protein SWALL:Q06387 (EMBL:X68708) (87 aa) fasta scores: E(): 1.6e-20%2C 80%25 id in 70 aa%2C and to Streptomyces coelicolor regulatory protein WhiB or SCO3034 or SCE34.15C SWALL:Q53963 (EMBL:X62287) (87 aa) fasta scores: E(): 1.6e-20%2C 80%25 id in 70 aa;gbkey=CDS;product=WhiB-like regulatory protein;protein_id=CAD66814.1;transl_table=11
BX072543.1	EMBL	sequence_feature	142126	142315	.	+	.	ID=id257;Note=Transcription factor WhiB Score %3D 125.1 E-value %3D 8.9e-35;gbkey=misc_feature
BX072543.1	EMBL	gene	142512	144908	.	+	.	ID=gene122;Name=TW135;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW135
BX072543.1	EMBL	CDS	142512	144908	.	+	0	ID=cds122;Parent=gene122;Dbxref=InterPro:IPR029044,UniProtKB/TrEMBL:Q83NT6,NCBI_GP:CAD66815.1;Name=CAD66815.1;Note=Similar to Streptomyces aureofaciens transmembrane protein WhiB2 SWALL:Q53785 (EMBL:L22864) (1219 aa) fasta scores: E(): 1.5e-06%2C 21.76%25 id in 896 aa%2C and to Streptomyces coelicolor putative integral membrane protein SCO3033 or SCE34.14c SWALL:Q9KZL1 (EMBL:AL353862) (1268 aa) fasta scores: E(): 2e-06%2C 24.06%25 id in 939 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66815.1;transl_table=11
BX072543.1	EMBL	sequence_feature	143049	143117	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=1/13;partial=true
BX072543.1	EMBL	sequence_feature	143304	143372	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=2/13;partial=true
BX072543.1	EMBL	sequence_feature	143457	143525	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=3/13;partial=true
BX072543.1	EMBL	sequence_feature	143544	143603	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=4/13;partial=true
BX072543.1	EMBL	sequence_feature	143631	143690	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=5/13;partial=true
BX072543.1	EMBL	sequence_feature	143709	143762	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=6/13;partial=true
BX072543.1	EMBL	sequence_feature	143805	143873	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=7/13;partial=true
BX072543.1	EMBL	sequence_feature	143892	143951	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=8/13;partial=true
BX072543.1	EMBL	sequence_feature	144027	144095	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=9/13;partial=true
BX072543.1	EMBL	sequence_feature	144108	144176	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=10/13;partial=true
BX072543.1	EMBL	sequence_feature	144189	144245	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=11/13;partial=true
BX072543.1	EMBL	sequence_feature	144264	144332	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=12/13;partial=true
BX072543.1	EMBL	sequence_feature	144759	144827	.	+	.	ID=id258;Note=13 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 235-257%2C 320-342%2C 371-393%2C 400-419%2C 429-448%2C 455-472%2C 487-509%2C 516-535%2C 561-583%2C 588-610%2C 615-633%2C 640-662 and 805-827;gbkey=misc_feature;is_ordered=true;part=13/13;partial=true
BX072543.1	EMBL	gene	144961	146340	.	+	.	ID=gene123;Name=TW136;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW136
BX072543.1	EMBL	CDS	144961	146340	.	+	0	ID=cds123;Parent=gene123;Dbxref=UniProtKB/TrEMBL:Q83NT5,NCBI_GP:CAD66816.1;Name=CAD66816.1;Note=Similar to Streptomyces coelicolor putative secreted protein SCO3032 or SCE34.13c SWALL:Q9KZL2 (EMBL:AL353862) (506 aa) fasta scores: E(): 0.01%2C 24.83%25 id in 294 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD66816.1;transl_table=11
BX072543.1	EMBL	sequence_feature	144961	145062	.	+	.	ID=id259;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.606 between residues 34 and 35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	144979	145047	.	+	.	ID=id260;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature
BX072543.1	EMBL	gene	146782	148212	.	+	.	ID=gene124;Name=manB;gbkey=Gene;gene=manB;gene_biotype=protein_coding;locus_tag=TW137
BX072543.1	EMBL	CDS	146782	148212	.	+	0	ID=cds124;Parent=gene124;Dbxref=GOA:Q83IB0,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR016055,UniProtKB/TrEMBL:Q83IB0,NCBI_GP:CAD66817.1;Name=CAD66817.1;Note=Similar to Escherichia coli phosphomannomutase ManB or RfbK or RfbK2 SWALL:RFK9_ECOLI (SWALL:P37755) (456 aa) fasta scores: E(): 4.3e-48%2C 34.44%25 id in 450 aa%2C and to Streptomyces coelicolor phosphomannomutase ManB or SCO3028 or SCE34.09c SWALL:Q9KZL6 (EMBL:AL353862) (454 aa) fasta scores: E(): 6.8e-88%2C 51.96%25 id in 458 aa;gbkey=CDS;gene=manB;product=phosphomannomutase;protein_id=CAD66817.1;transl_table=11
BX072543.1	EMBL	sequence_feature	146827	147244	.	+	.	ID=id261;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I Score %3D 132.2 E-value %3D 6.9e-37;gbkey=misc_feature;gene=manB
BX072543.1	EMBL	sequence_feature	147292	147592	.	+	.	ID=id262;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain II Score %3D 101.0 E-value %3D 1.7e-27;gbkey=misc_feature;gene=manB
BX072543.1	EMBL	sequence_feature	147598	147940	.	+	.	ID=id263;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain III Score %3D 67.0 E-value %3D 2.8e-17;gbkey=misc_feature;gene=manB
BX072543.1	EMBL	sequence_feature	147985	148207	.	+	.	ID=id264;Note=Phosphoglucomutase/phosphomannomutase%2C C-terminal domain Score %3D 15.5 E-value %3D 0.0008;gbkey=misc_feature;gene=manB
BX072543.1	EMBL	gene	148563	149258	.	+	.	ID=gene125;Name=TW138;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW138
BX072543.1	EMBL	CDS	148563	149258	.	+	0	ID=cds125;Parent=gene125;Dbxref=InterPro:IPR029057,UniProtKB/TrEMBL:Q820Z3,NCBI_GP:CAD66818.1;Name=CAD66818.1;Note=Similar to Corynebacterium glutamicum predicted amidophosphoribosyltransferases Cgl0757 SWALL:BAB98150 (EMBL:AP005276) (196 aa) fasta scores: E(): 4.4e-06%2C 23.98%25 id in 196 aa%2C and to Deinococcus radiodurans competence protein ComF%2C putative dr1389 SWALL:Q9RUJ7 (EMBL:AE001984) (219 aa) fasta scores: E(): 2.2e-05%2C 27.17%25 id in 195 aa;gbkey=CDS;product=conserved hypothetical protein (possible ATP-binding);protein_id=CAD66818.1;transl_table=11
BX072543.1	EMBL	sequence_feature	149100	149123	.	+	.	ID=id265;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	149502	152045	.	+	.	ID=gene126;Name=secA;gbkey=Gene;gene=secA;gene_biotype=protein_coding;locus_tag=TW139
BX072543.1	EMBL	CDS	149502	152045	.	+	0	ID=cds126;Parent=gene126;Dbxref=GOA:Q83NT4,InterPro:IPR000185,InterPro:IPR011115,InterPro:IPR011116,InterPro:IPR011130,InterPro:IPR014018,InterPro:IPR020937,InterPro:IPR027417,NCBI_GP:CAD66819.1;Name=CAD66819.1;Note=Similar to Streptomyces griseus preprotein translocase SecA subunit secA SWALL:SECA_STRGR (SWALL:P95759) (940 aa) fasta scores: E(): 5.6e-138%2C 60.32%25 id in 862 aa;gbkey=CDS;gene=secA;product=preprotein translocase SecA subunit;protein_id=CAD66819.1;transl_table=11
BX072543.1	EMBL	sequence_feature	149517	150762	.	+	.	ID=id266;Note=SecA protein%2C amino terminal region Score %3D 855.6 E-value %3D 1.1e-254;gbkey=misc_feature;gene=secA
BX072543.1	EMBL	sequence_feature	150948	150995	.	+	.	ID=id267;Note=PS01312 Protein secA signatures.;gbkey=misc_feature;gene=secA
BX072543.1	EMBL	gene	152632	152805	.	+	.	ID=gene127;Name=TW140;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW140
BX072543.1	EMBL	CDS	152632	152805	.	+	0	ID=cds127;Parent=gene127;Dbxref=UniProtKB/TrEMBL:Q83IA9,NCBI_GP:CAD66820.1;Name=CAD66820.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66820.1;transl_table=11
BX072543.1	EMBL	gene	152950	153696	.	+	.	ID=gene128;Name=TW141;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW141
BX072543.1	EMBL	CDS	152950	153696	.	+	0	ID=cds128;Parent=gene128;Dbxref=InterPro:IPR013974,UniProtKB/TrEMBL:Q83NT3,NCBI_GP:CAD66821.1;Name=CAD66821.1;Note=No significant database matches;gbkey=CDS;product=putative membrane/secreted protein;protein_id=CAD66821.1;transl_table=11
BX072543.1	EMBL	sequence_feature	152950	153063	.	+	.	ID=id268;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.996) with cleavage site probability 0.480 between residues 38 and 39;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	152986	153042	.	+	.	ID=id269;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-31;gbkey=misc_feature
BX072543.1	EMBL	gene	153705	154487	.	+	.	ID=gene129;Name=TW142;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW142
BX072543.1	EMBL	CDS	153705	154487	.	+	0	ID=cds129;Parent=gene129;Dbxref=InterPro:IPR025669,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NT2,NCBI_GP:CAD66822.1;Name=CAD66822.1;Note=Similar to Bacillus subtilis sporulation initiation inhibitor protein SoJ SWALL:SOJ_BACSU (SWALL:P37522) (253 aa) fasta scores: E(): 0.00051%2C 30.88%25 id in 136 aa;gbkey=CDS;product=putative regulator;protein_id=CAD66822.1;transl_table=11
BX072543.1	EMBL	sequence_feature	154395	154418	.	+	.	ID=id270;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	154524	154733	.	+	.	ID=gene130;Name=TW143;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW143;part=1/2
BX072543.1	EMBL	gene	154735	155181	.	+	.	ID=gene130;Name=TW143;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW143;part=2/2
BX072543.1	EMBL	CDS	154524	154733	.	+	0	ID=cds130;Parent=gene130;Dbxref=UniProtKB/TrEMBL:Q83IA8,NCBI_GP:CAD66823.1;Name=CAD66823.1;Note=No significant database matches. Frameshift at potentially variable G(11) tract after aa 70;gbkey=CDS;product=hypothetical phase-variable integral membrane protein;protein_id=CAD66823.1;transl_table=11
BX072543.1	EMBL	CDS	154735	155181	.	+	0	ID=cds130;Parent=gene130;Dbxref=UniProtKB/TrEMBL:Q83IA8,NCBI_GP:CAD66823.1;Name=CAD66823.1;Note=No significant database matches. Frameshift at potentially variable G(11) tract after aa 70;gbkey=CDS;product=hypothetical phase-variable integral membrane protein;protein_id=CAD66823.1;transl_table=11
BX072543.1	EMBL	sequence_feature	154611	154679	.	+	.	ID=id271;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 30-52 and aa 131-153;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	155098	155166	.	+	.	ID=id271;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 30-52 and aa 131-153;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	155098	155166	.	+	.	ID=id272;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 131-153;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	154731	154741	.	+	.	ID=id273;Note=(g)11;gbkey=repeat_region
BX072543.1	EMBL	gene	155275	158181	.	+	.	ID=gene131;Name=gcvP;gbkey=Gene;gene=gcvP;gene_biotype=protein_coding;locus_tag=TW144
BX072543.1	EMBL	CDS	155275	158181	.	+	0	ID=cds131;Parent=gene131;Dbxref=GOA:Q83IA7,InterPro:IPR000192,InterPro:IPR003437,InterPro:IPR015421,InterPro:IPR015424,InterPro:IPR020580,InterPro:IPR020581,NCBI_GP:CAD66824.1;Name=CAD66824.1;Note=Similar to Escherichia coli glycine dehydrogenase [decarboxylating] GcvP or b2903 SWALL:GCSP_ECOLI (SWALL:P33195) (956 aa) fasta scores: E(): 4.4e-106%2C 48.71%25 id in 973 aa%2C and to Mycobacterium tuberculosis probable glycine dehydrogenase [decarboxylating] GcvP or GcvB or Rv1832 or mt1880 or mtcy1a11.11C SWALL:GCSP_MYCTU (SWALL:Q50601) (941 aa) fasta scores: E(): 2e-114%2C 51.27%25 id in 981 aa;gbkey=CDS;gene=gcvP;product=glycine dehydrogenase [decarboxylating];protein_id=CAD66824.1;transl_table=11
BX072543.1	EMBL	sequence_feature	155281	156550	.	+	.	ID=id274;Note=Glycine cleavage system P-protein Score %3D 572.6 E-value %3D 1.8e-169;gbkey=misc_feature;gene=gcvP
BX072543.1	EMBL	gene	158391	159971	.	+	.	ID=gene132;Name=TW145;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW145
BX072543.1	EMBL	CDS	158391	159971	.	+	0	ID=cds132;Parent=gene132;Dbxref=GOA:Q83NT1,InterPro:IPR000914,UniProtKB/TrEMBL:Q83NT1,NCBI_GP:CAD66825.1;Name=CAD66825.1;Note=Similar to Streptomyces coelicolor putative peptide transport system secreted peptide-binding protein SCO5117 or SC9E12.02 SWALL:Q9F353 (EMBL:AL391751) (544 aa) fasta scores: E(): 1.2e-51%2C 33.57%25 id in 551 aa;gbkey=CDS;product=putative ABC transporter substrate-binding protein;protein_id=CAD66825.1;transl_table=11
BX072543.1	EMBL	sequence_feature	158391	158489	.	+	.	ID=id275;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.577 between residues 33 and 34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	158409	159963	.	+	.	ID=id276;Note=Bacterial extracellular solute-binding proteins%2C family 5 Score %3D 96.8 E-value %3D 3e-26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	158427	158459	.	+	.	ID=id277;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	159968	161569	.	+	.	ID=gene133;Name=TW146;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW146
BX072543.1	EMBL	CDS	159968	161569	.	+	0	ID=cds133;Parent=gene133;Dbxref=GOA:Q83NT0,InterPro:IPR000914,UniProtKB/TrEMBL:Q83NT0,NCBI_GP:CAD66826.1;Name=CAD66826.1;Note=Similar to Streptomyces coelicolor putative peptide transport system secreted peptide-binding protein SCO5117 or SC9E12.02 SWALL:Q9F353 (EMBL:AL391751) (544 aa) fasta scores: E(): 3.3e-48%2C 33.39%25 id in 512 aa;gbkey=CDS;product=putative ABC transporter substrate-binding protein;protein_id=CAD66826.1;transl_table=11
BX072543.1	EMBL	sequence_feature	159968	160066	.	+	.	ID=id278;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.787 between residues 33 and 34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	159986	160054	.	+	.	ID=id279;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	160004	161561	.	+	.	ID=id280;Note=Bacterial extracellular solute-binding proteins%2C family 5 Score %3D 94.3 E-value %3D 1.7e-25;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	160007	160039	.	+	.	ID=id281;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	161570	162175	.	-	.	ID=gene134;Name=TW147;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW147
BX072543.1	EMBL	CDS	161570	162175	.	-	0	ID=cds134;Parent=gene134;Dbxref=InterPro:IPR003339,UniProtKB/TrEMBL:Q83NS9,NCBI_GP:CAD66827.1;Name=CAD66827.1;Note=Similar to Rhizobium meliloti hypothetical transmembrane protein smc00963 r00889 or smc00963 SWALL:Q92RI2 (EMBL:AL591785) (201 aa) fasta scores: E(): 2.3e-12%2C 34.23%25 id in 184 aa;gbkey=CDS;product=putative ABC transporter integral membrane subunit;protein_id=CAD66827.1;transl_table=11
BX072543.1	EMBL	sequence_feature	161993	162061	.	-	.	ID=id282;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-61%2C 71-93 and 114-133;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	161897	161965	.	-	.	ID=id282;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-61%2C 71-93 and 114-133;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	161777	161836	.	-	.	ID=id282;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-61%2C 71-93 and 114-133;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	162302	162985	.	-	.	ID=gene135;Name=TW148;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW148
BX072543.1	EMBL	CDS	162302	162985	.	-	0	ID=cds135;Parent=gene135;Dbxref=GOA:Q83IA6,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IA6,NCBI_GP:CAD66828.1;Name=CAD66828.1;Note=Similar to Deinococcus radiodurans ABC transporter%2C ATP-binding protein dr2469 SWALL:Q9RRL9 (EMBL:AE002076) (226 aa) fasta scores: E(): 3.2e-27%2C 42.98%25 id in 221 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD66828.1;transl_table=11
BX072543.1	EMBL	sequence_feature	162373	162904	.	-	.	ID=id283;Note=ABC transporter Score %3D 169.5 E-value %3D 3.9e-48;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	162542	162586	.	-	.	ID=id284;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	162860	162883	.	-	.	ID=id285;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	163138	164073	.	+	.	ID=gene136;Name=TW149;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW149
BX072543.1	EMBL	CDS	163138	164073	.	+	0	ID=cds136;Parent=gene136;Dbxref=GOA:Q83NS8,InterPro:IPR000515,UniProtKB/TrEMBL:Q83NS8,NCBI_GP:CAD66829.1;Name=CAD66829.1;Note=Similar to Streptomyces coelicolor putative peptide transport system integral membrane protein SCO5118 or SC9E12.03 SWALL:Q9F352 (EMBL:AL391751) (307 aa) fasta scores: E(): 6.3e-45%2C 42.15%25 id in 306 aa%2C and to Bacillus subtilis oligopeptide transport system permease protein OppB SWALL:OPPB_BACSU (SWALL:P24138) (311 aa) fasta scores: E(): 2.4e-28%2C 34.07%25 id in 314 aa;gbkey=CDS;product=putative ABC transporter integral membrane subunit;protein_id=CAD66829.1;transl_table=11
BX072543.1	EMBL	sequence_feature	163138	163251	.	+	.	ID=id286;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.824) with cleavage site probability 0.215 between residues 38 and 39;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	163165	163233	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=1/7;partial=true
BX072543.1	EMBL	sequence_feature	163324	163392	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=2/7;partial=true
BX072543.1	EMBL	sequence_feature	163435	163503	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=3/7;partial=true
BX072543.1	EMBL	sequence_feature	163540	163608	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=4/7;partial=true
BX072543.1	EMBL	sequence_feature	163651	163719	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=5/7;partial=true
BX072543.1	EMBL	sequence_feature	163822	163890	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=6/7;partial=true
BX072543.1	EMBL	sequence_feature	163972	164040	.	+	.	ID=id287;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 63-85%2C 100-122%2C 135-157%2C 172-194%2C 229-251 and 279-301;gbkey=misc_feature;is_ordered=true;part=7/7;partial=true
BX072543.1	EMBL	sequence_feature	163729	163942	.	+	.	ID=id288;Note=Binding-protein-dependent transport systems inner membrane component Score %3D 40.2 E-value %3D 3.3e-09;gbkey=misc_feature
BX072543.1	EMBL	gene	164075	165040	.	+	.	ID=gene137;Name=TW150;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW150
BX072543.1	EMBL	CDS	164075	165040	.	+	0	ID=cds137;Parent=gene137;Dbxref=GOA:Q83NS7,InterPro:IPR000515,UniProtKB/TrEMBL:Q83NS7,NCBI_GP:CAD66830.1;Name=CAD66830.1;Note=Similar to Corynebacterium glutamicum ABC-type transporter%2C permease components cgl1992 SWALL:BAB99385 (EMBL:AP005280) (333 aa) fasta scores: E(): 2.3e-50%2C 45.77%25 id in 308 aa%2C and to Bacillus subtilis oligopeptide transport system permease protein OppC or Spo0KC SWALL:OPPC_BACSU (SWALL:P24139) (305 aa) fasta scores: E(): 6.1e-29%2C 31.77%25 id in 299 aa;gbkey=CDS;product=putative ABC transporter system integral membrane subunit;protein_id=CAD66830.1;transl_table=11
BX072543.1	EMBL	sequence_feature	164228	164296	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	164435	164503	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	164522	164590	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	164603	164671	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	164762	164830	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	164933	165001	.	+	.	ID=id289;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 121-143%2C 150-172%2C 177-199%2C 230-252 and 287-309;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	164681	164909	.	+	.	ID=id290;Note=Binding-protein-dependent transport systems inner membrane component Score %3D 20.6 E-value %3D 0.00061;gbkey=misc_feature
BX072543.1	EMBL	gene	165037	166665	.	+	.	ID=gene138;Name=TW151;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW151
BX072543.1	EMBL	CDS	165037	166665	.	+	0	ID=cds138;Parent=gene138;Dbxref=GOA:Q83IA5,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR013563,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IA5,NCBI_GP:CAD66831.1;Name=CAD66831.1;Note=Similar to Mycobacterium tuberculosis putative peptide ABC transporter ATP-binding protein Rv3663c or mtv025.011c or mt3764 SWALL:O69631 (EMBL:AL022121) (548 aa) fasta scores: E(): 2e-88%2C 52.67%25 id in 543 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD66831.1;transl_table=11
BX072543.1	EMBL	sequence_feature	165148	165742	.	+	.	ID=id291;Note=ABC transporter Score %3D 178.0 E-value %3D 1.1e-50;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	165169	165192	.	+	.	ID=id292;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	165514	165558	.	+	.	ID=id293;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	165985	166555	.	+	.	ID=id294;Note=ABC transporter Score %3D 191.4 E-value %3D 1e-54;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	166006	166029	.	+	.	ID=id295;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	166327	166371	.	+	.	ID=id296;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	166803	171844	.	+	.	ID=id297;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	171897	172667	.	-	.	ID=gene139;Name=TW152;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW152
BX072543.1	EMBL	CDS	171897	172667	.	-	0	ID=cds139;Parent=gene139;Dbxref=UniProtKB/TrEMBL:Q83NS6,NCBI_GP:CAD66832.1;Name=CAD66832.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD66832.1;transl_table=11
BX072543.1	EMBL	sequence_feature	172563	172631	.	-	.	ID=id298;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61 and 233-255;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	172485	172553	.	-	.	ID=id298;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61 and 233-255;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	171903	171971	.	-	.	ID=id298;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 39-61 and 233-255;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	172560	172667	.	-	.	ID=id299;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.707 between residues 36 and 37;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	172696	178092	.	+	.	ID=id300;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	173678	173741	.	+	.	ID=id301;Note=(ggcgagaaatatgtat)4;gbkey=repeat_region
BX072543.1	EMBL	gene	178288	178713	.	+	.	ID=gene140;Name=rplM;gbkey=Gene;gene=rplM;gene_biotype=protein_coding;locus_tag=TW153
BX072543.1	EMBL	CDS	178288	178713	.	+	0	ID=cds140;Parent=gene140;Dbxref=GOA:Q83IA4,InterPro:IPR005822,InterPro:IPR005823,InterPro:IPR023563,InterPro:IPR023564,UniProtKB/TrEMBL:Q83IA4,NCBI_GP:CAD66833.1;Name=CAD66833.1;Note=Similar to Escherichia coli 50s ribosomal protein L13 RplM or b3231 or z4589 or ecs4104 or stm3345 or sty3525 SWALL:RL13_ECOLI (SWALL:P02410) (142 aa) fasta scores: E(): 3.8e-25%2C 54.33%25 id in 127 aa%2C and to Streptomyces coelicolor 50s ribosomal protein L13 RplM or SCO4734 or SC6G4.12 SWALL:RL13_STRCO (SWALL:Q53874) (147 aa) fasta scores: E(): 3e-29%2C 52.94%25 id in 136 aa. N-terminus truncated relative to homologues.;gbkey=CDS;gene=rplM;product=50S ribosomal protein L13;protein_id=CAD66833.1;transl_table=11
BX072543.1	EMBL	sequence_feature	178303	178684	.	+	.	ID=id302;Note=Ribosomal protein L13 Score %3D 225.7 E-value %3D 4.9e-65;gbkey=misc_feature;gene=rplM
BX072543.1	EMBL	sequence_feature	178573	178641	.	+	.	ID=id303;Note=PS00783 Ribosomal protein L13 signature.;gbkey=misc_feature;gene=rplM
BX072543.1	EMBL	gene	178713	179177	.	+	.	ID=gene141;Name=rpsI;gbkey=Gene;gene=rpsI;gene_biotype=protein_coding;locus_tag=TW154
BX072543.1	EMBL	CDS	178713	179177	.	+	0	ID=cds141;Parent=gene141;Dbxref=GOA:Q83IA3,InterPro:IPR000754,InterPro:IPR014721,InterPro:IPR020568,InterPro:IPR020574,InterPro:IPR023035,NCBI_GP:CAD66834.1;Name=CAD66834.1;Note=Similar to Escherichia coli 30s ribosomal protein S9 RpsI or b3230 or z4588 or ecs4103 SWALL:RS9_ECOLI (SWALL:P02363) (129 aa) fasta scores: E(): 2.6e-20%2C 51.61%25 id in 124 aa%2C and to Streptomyces coelicolor 30s ribosomal protein S9 RpsI or SCO4735 or SC6G4.13 SWALL:RS9_STRCO (SWALL:Q53875) (170 aa) fasta scores: E(): 2.4e-25%2C 61.6%25 id in 125 aa;gbkey=CDS;gene=rpsI;product=30s ribosomal protein S9;protein_id=CAD66834.1;transl_table=11
BX072543.1	EMBL	sequence_feature	178809	179172	.	+	.	ID=id304;Note=Ribosomal protein S9/S16 Score %3D 192.8 E-value %3D 3.7e-55;gbkey=misc_feature;gene=rpsI
BX072543.1	EMBL	sequence_feature	178986	179042	.	+	.	ID=id305;Note=PS00360 Ribosomal protein S9 signature.;gbkey=misc_feature;gene=rpsI
BX072543.1	EMBL	gene	179181	180542	.	+	.	ID=gene142;Name=TW155;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW155
BX072543.1	EMBL	CDS	179181	180542	.	+	0	ID=cds142;Parent=gene142;Dbxref=GOA:Q83NS5,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR006352,InterPro:IPR016055,InterPro:IPR016066,NCBI_GP:CAD66835.1;Name=CAD66835.1;Note=Similar to Streptomyces coelicolor putative phospho-sugar mutase SCO4736 or sc6g4.14 SWALL:Q53876 (EMBL:AL031317) (452 aa) fasta scores: E(): 3.6e-76%2C 50%25 id in 458 aa;gbkey=CDS;product=putative phospho-sugar mutase;protein_id=CAD66835.1;transl_table=11
BX072543.1	EMBL	sequence_feature	179181	179634	.	+	.	ID=id306;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I Score %3D 155.2 E-value %3D 7.9e-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	179670	179964	.	+	.	ID=id307;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain II Score %3D 80.7 E-value %3D 2.2e-21;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	179970	180306	.	+	.	ID=id308;Note=Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain III Score %3D 86.9 E-value %3D 3e-23;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	180330	180522	.	+	.	ID=id309;Note=Phosphoglucomutase/phosphomannomutase%2C C-terminal domain Score %3D 17.6 E-value %3D 0.00048;gbkey=misc_feature
BX072543.1	EMBL	gene	180517	181272	.	-	.	ID=gene143;Name=coaA;gbkey=Gene;gene=coaA;gene_biotype=protein_coding;locus_tag=TW156
BX072543.1	EMBL	CDS	180517	181272	.	-	0	ID=cds143;Parent=gene143;Dbxref=GOA:Q83IA2,InterPro:IPR004566,InterPro:IPR006083,InterPro:IPR027417,UniProtKB/TrEMBL:Q83IA2,NCBI_GP:CAD66836.1;Name=CAD66836.1;Note=Similar to Escherichia coli pantothenate kinase CoaA or Rts or PanK or b3974 or z5545 or ecs4901 SWALL:COAA_ECOLI (SWALL:P15044) (316 aa) fasta scores: E(): 4.5e-12%2C 39.66%25 id in 242 aa;gbkey=CDS;gene=coaA;product=pantothenate kinase;protein_id=CAD66836.1;transl_table=11
BX072543.1	EMBL	sequence_feature	181129	181152	.	-	.	ID=id310;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=coaA
BX072543.1	EMBL	sequence_feature	181825	181959	.	+	.	ID=id311;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.891 between residues 45 and 46;gbkey=misc_feature
BX072543.1	EMBL	gene	181855	183954	.	+	.	ID=gene144;Name=TW157;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW157
BX072543.1	EMBL	CDS	181855	183954	.	+	0	ID=cds144;Parent=gene144;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NS4,NCBI_GP:CAD66837.1;Name=CAD66837.1;Note=No significant database matches. Has possible N-terminal secretion signal sequence and 3 possible membrane spanning regions in the C-terminal portion. Similar to CDS TW161 - TW157 residues 8-275 identical to TW161 residues 7-274%2C though not similar at sequence level TW161 C-terminal portion also contains 3 possible membrane spanning regions. Region following identity with TW161 is an array of small repeats.;gbkey=CDS;product=WiSP family protein;protein_id=CAD66837.1;transl_table=11
BX072543.1	EMBL	sequence_feature	181885	181953	.	+	.	ID=id312;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 504-526%2C 562-584 and 635-657;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	183334	183402	.	+	.	ID=id312;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 504-526%2C 562-584 and 635-657;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	183508	183576	.	+	.	ID=id312;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 504-526%2C 562-584 and 635-657;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	183727	183795	.	+	.	ID=id312;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 504-526%2C 562-584 and 635-657;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	repeat_region	181874	182680	.	+	.	ID=id313;Note=Repeated directly at 193785..194591. Codes for the sub-N-terminus of a possible surface protein;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	182423	183559	.	+	.	ID=id314;Note=Coding degenerate repeat region in Repeat Cluster 1 (RC1). Related to local non-coding repeat regions.;gbkey=repeat_region
BX072543.1	EMBL	sequence_alteration	182819	182819	.	+	.	ID=id315;Note=polymorphic base C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	182821	182821	.	+	.	ID=id316;Note=polymorphic base: A or G;gbkey=variation
BX072543.1	EMBL	sequence_alteration	182823	182823	.	+	.	ID=id317;Note=polymorphic base: T or C;gbkey=variation
BX072543.1	EMBL	gene	184178	186028	.	+	.	ID=gene145;Name=glmS;gbkey=Gene;gene=glmS;gene_biotype=protein_coding;locus_tag=TW158
BX072543.1	EMBL	CDS	184178	186028	.	+	0	ID=cds145;Parent=gene145;Dbxref=GOA:Q83IA1,InterPro:IPR000583,InterPro:IPR001347,InterPro:IPR005855,InterPro:IPR017932,InterPro:IPR029055,NCBI_GP:CAD66838.1;Name=CAD66838.1;Note=Similar to Escherichia coli glucosamine--fructose-6-phosphate aminotransferase [isomerizing] GlmS or b3729 SWALL:GLMS_ECOLI (SWALL:P17169) (608 aa) fasta scores: E(): 9.8e-90%2C 42.23%25 id in 618 aa%2C and to Streptomyces coelicolor glucosamine--fructose-6-phosphate aminotransferase [isomerizing] GlmS or SCO4740 or SC6G4.18 SWALL:GLMS_STRCO (SWALL:O86781) (614 aa) fasta scores: E(): 1.5e-125%2C 53.73%25 id in 616 aa;gbkey=CDS;gene=glmS;product=glucosamine--fructose-6-phosphate aminotransferase [isomerizing];protein_id=CAD66838.1;transl_table=11
BX072543.1	EMBL	sequence_feature	184178	184195	.	+	.	ID=id318;Note=PS00443 Glutamine amidotransferases class-II active site.;gbkey=misc_feature;gene=glmS
BX072543.1	EMBL	sequence_feature	184181	184733	.	+	.	ID=id319;Note=Glutamine amidotransferases class-II Score %3D 221.0 E-value %3D 1.2e-63;gbkey=misc_feature;gene=glmS
BX072543.1	EMBL	sequence_feature	185045	185447	.	+	.	ID=id320;Note=SIS domain Score %3D 136.8 E-value %3D 2.7e-38;gbkey=misc_feature;gene=glmS
BX072543.1	EMBL	sequence_feature	185054	185083	.	+	.	ID=id321;Note=PS00339 Aminoacyl-transfer RNA synthetases class-II signature 2.;gbkey=misc_feature;gene=glmS
BX072543.1	EMBL	sequence_feature	185561	185981	.	+	.	ID=id322;Note=SIS domain Score %3D 119.4 E-value %3D 4.6e-33;gbkey=misc_feature;gene=glmS
BX072543.1	EMBL	repeat_region	185973	187677	.	+	.	ID=id323;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	tRNA	187804	187874	.	-	.	ID=rna7;Note=tRNA Gln anticodon TTG%2C Cove score 59.16;gbkey=tRNA;product=tRNA-Gln
BX072543.1	EMBL	exon	187804	187874	.	-	.	ID=id324;Parent=rna7;Note=tRNA Gln anticodon TTG%2C Cove score 59.16;gbkey=tRNA;product=tRNA-Gln
BX072543.1	EMBL	gene	187878	189107	.	-	.	ID=gene146;Name=ispE;gbkey=Gene;gene=ispE;gene_biotype=protein_coding;locus_tag=TW159
BX072543.1	EMBL	CDS	187878	189107	.	-	0	ID=cds146;Parent=gene146;Dbxref=GOA:Q83IA0,InterPro:IPR004424,InterPro:IPR006204,InterPro:IPR013750,InterPro:IPR014721,InterPro:IPR020568,NCBI_GP:CAD66839.1;Name=CAD66839.1;Note=Similar to Escherichia coli 4-diphosphocytidyl-2-c-methyl-D-erythritol kinase IspE or Ipk or b1208 or z1979 or ecs1713 SWALL:ISPE_ECOLI (SWALL:P24209) (283 aa) fasta scores: E(): 7.7e-07%2C 28.95%25 id in 221 aa%2C and to Streptomyces coelicolor 4-diphosphocytidyl-2-c-methyl-D-erythritol kinase IspE or SCO3148 or SCE66.27c SWALL:ISPE_STRCO (SWALL:Q9K3R6) (299 aa) fasta scores: E(): 5.9e-21%2C 39.07%25 id in 238 aa. Note possible alternative translational start sites.;gbkey=CDS;gene=ispE;product=4-diphosphocytidyl-2-c-methyl-D-erythritol kinase;protein_id=CAD66839.1;transl_table=11
BX072543.1	EMBL	sequence_feature	187898	189266	.	-	.	ID=id325;Note=GHMP kinases putative ATP-binding protein Score %3D 49.3 E-value %3D 6e-12;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	189310	191014	.	+	.	ID=id326;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	191188	192282	.	+	.	ID=gene147;Name=TW160;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW160
BX072543.1	EMBL	CDS	191188	192282	.	+	0	ID=cds147;Parent=gene147;Dbxref=GOA:Q83NS3,InterPro:IPR003251,InterPro:IPR008217,InterPro:IPR009078,InterPro:IPR012347,UniProtKB/TrEMBL:Q83NS3,NCBI_GP:CAD66840.1;Name=CAD66840.1;Note=Similar to Corynebacterium glutamicum uncharacterized membrane proteins cgl2282 SWALL:BAB99675 (EMBL:AP005281) (264 aa) fasta scores: E(): 2.1e-24%2C 43.16%25 id in 278 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66840.1;transl_table=11
BX072543.1	EMBL	sequence_feature	191584	191652	.	+	.	ID=id327;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 133-155%2C 160-182%2C 282-304%2C 309-331 and 344-363;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	191665	191733	.	+	.	ID=id327;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 133-155%2C 160-182%2C 282-304%2C 309-331 and 344-363;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	192031	192099	.	+	.	ID=id327;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 133-155%2C 160-182%2C 282-304%2C 309-331 and 344-363;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	192112	192180	.	+	.	ID=id327;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 133-155%2C 160-182%2C 282-304%2C 309-331 and 344-363;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	192217	192276	.	+	.	ID=id327;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 133-155%2C 160-182%2C 282-304%2C 309-331 and 344-363;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	repeat_region	192292	192718	.	+	.	ID=id328;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	tRNA	193050	193125	.	-	.	ID=rna8;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	exon	193050	193125	.	-	.	ID=id329;Parent=rna8;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	tRNA	193131	193204	.	-	.	ID=rna9;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	exon	193131	193204	.	-	.	ID=id330;Parent=rna9;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	tRNA	193214	193289	.	-	.	ID=rna10;Note=tRNA Glu anticodon TTC%2C Cove score 54.89;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	exon	193214	193289	.	-	.	ID=id331;Parent=rna10;Note=tRNA Glu anticodon TTC%2C Cove score 54.89;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	repeat_region	193286	193640	.	+	.	ID=id332;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	sequence_feature	193745	193870	.	+	.	ID=id333;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.819 between residues 42 and 43;gbkey=misc_feature
BX072543.1	EMBL	gene	193769	196159	.	+	.	ID=gene148;Name=TW161;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW161
BX072543.1	EMBL	CDS	193769	196159	.	+	0	ID=cds148;Parent=gene148;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NS2,NCBI_GP:CAD66841.1;Name=CAD66841.1;Note=No significant database matches. Has possible N-terminal secretion signal sequence and 3 possible membrane spanning regions in the C-terminal portion. Similar to CDS TW157 - TW161 residues 7-274 identical to TW157 residues 8-275%2C though not similar at sequence level TW157 C-terminal portion also contains 3 possible membrane spanning regions.;gbkey=CDS;product=WiSP family protein;protein_id=CAD66841.1;transl_table=11
BX072543.1	EMBL	sequence_feature	195506	195574	.	+	.	ID=id334;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 588-610%2C 629-651 and 683-705;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	195629	195697	.	+	.	ID=id334;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 588-610%2C 629-651 and 683-705;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	195791	195859	.	+	.	ID=id334;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 588-610%2C 629-651 and 683-705;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	repeat_region	193785	194591	.	+	.	ID=id335;Note=Repeated directly at 181874..182680. Codes for the sub-N-terminus of a possible surface protein;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	196197	197688	.	+	.	ID=id336;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	197697	199415	.	-	.	ID=gene149;Name=TW162;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW162
BX072543.1	EMBL	CDS	197697	199415	.	-	0	ID=cds149;Parent=gene149;Dbxref=GOA:Q83I99,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR011527,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I99,NCBI_GP:CAD66842.1;Name=CAD66842.1;Note=Similar to Escherichia coli transport ATP-binding protein CydC or MdrA or MdrH or SurB or b0886 SWALL:CYDC_ECOLI (SWALL:P23886) (573 aa) fasta scores: E(): 4.8e-32%2C 27.92%25 id in 573 aa;gbkey=CDS;product=putative ABC transporter (ATP-binding and integral membrane);protein_id=CAD66842.1;transl_table=11
BX072543.1	EMBL	sequence_feature	197783	198332	.	-	.	ID=id337;Note=ABC transporter Score %3D 201.4 E-value %3D 9.6e-58;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	197958	198002	.	-	.	ID=id338;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	198288	198311	.	-	.	ID=id339;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	199287	199355	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	199176	199244	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	198951	199019	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	198879	198938	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	198630	198698	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	198537	198602	.	-	.	ID=id340;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 133-155%2C 160-179%2C 240-262 and 272-293;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	198551	199361	.	-	.	ID=id341;Note=ABC transporter transmembrane region Score %3D -19.6 E-value %3D 0.0025;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	199269	199415	.	-	.	ID=id342;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.981) with cleavage site probability 0.595 between residues 49 and 50;gbkey=misc_feature
BX072543.1	EMBL	gene	199447	201318	.	-	.	ID=gene150;Name=TW163;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW163
BX072543.1	EMBL	CDS	199447	201318	.	-	0	ID=cds150;Parent=gene150;Dbxref=GOA:Q83I98,InterPro:IPR001140,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR011527,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I98,NCBI_GP:CAD66843.1;Name=CAD66843.1;Note=Similar to Clostridium perfringens probable ABC transporter cpe0226 SWALL:Q8XNV6 (EMBL:AP003185) (576 aa) fasta scores: E(): 2.7e-35%2C 26.56%25 id in 576 aa;gbkey=CDS;product=putative ABC transporter (ATP-binding and integral membrane);protein_id=CAD66843.1;transl_table=11
BX072543.1	EMBL	sequence_feature	199560	200115	.	-	.	ID=id343;Note=ABC transporter Score %3D 156.8 E-value %3D 2.6e-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	199735	199779	.	-	.	ID=id344;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	200071	200094	.	-	.	ID=id345;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	201085	201153	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	200959	201027	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	200746	200814	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	200668	200736	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	200401	200469	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	200275	200343	.	-	.	ID=id346;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 56-78%2C 98-120%2C 169-191%2C 195-217%2C 284-306 and 326-348;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	200331	201147	.	-	.	ID=id347;Note=ABC transporter transmembrane region Score %3D 37.9 E-value %3D 1.7e-08;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	201593	202308	.	+	.	ID=id348;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	202542	203240	.	-	.	ID=gene151;Name=TW164;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW164
BX072543.1	EMBL	CDS	202542	203240	.	-	0	ID=cds151;Parent=gene151;Dbxref=InterPro:IPR025445,UniProtKB/TrEMBL:Q83NS1,NCBI_GP:CAD66844.1;Name=CAD66844.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO2196 or SC5F7.05 or SC3H12.04 SWALL:Q9S2P0 (EMBL:AL096872) (234 aa) fasta scores: E(): 5.7e-15%2C 31.89%25 id in 232 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66844.1;transl_table=11
BX072543.1	EMBL	sequence_feature	203088	203156	.	-	.	ID=id349;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 29-51 and 56-78;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	203007	203075	.	-	.	ID=id349;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 29-51 and 56-78;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	203085	203240	.	-	.	ID=id350;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.866) with cleavage site probability 0.502 between residues 52 and 53;gbkey=misc_feature
BX072543.1	EMBL	gene	203335	204531	.	+	.	ID=gene152;Name=TW165;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW165
BX072543.1	EMBL	CDS	203335	204531	.	+	0	ID=cds152;Parent=gene152;Dbxref=GOA:Q820C1,InterPro:IPR000719,InterPro:IPR011009,UniProtKB/TrEMBL:Q820C1,NCBI_GP:CAD66845.1;Name=CAD66845.1;Note=Similar to Streptomyces coelicolor putative serine/threonine protein kinase SCO1724 or SCI11.13 SWALL:Q9S2A6 (EMBL:AL096849) (550 aa) fasta scores: E(): 0.0015%2C 30.3%25 id in 165 aa%2C and to Amycolatopsis mediterranei serine/threonine kinase PkmA SWALL:Q9KK90 (EMBL:AF135382) (589 aa) fasta scores: E(): 0.0043%2C 25.59%25 id in 168 aa;gbkey=CDS;product=putative serine/threonine protein kinase;protein_id=CAD66845.1;transl_table=11
BX072543.1	EMBL	sequence_feature	204247	204315	.	+	.	ID=id351;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 305-327;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	204575	205214	.	+	.	ID=id352;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	205328	207172	.	+	.	ID=gene153;Name=TW166;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW166
BX072543.1	EMBL	CDS	205328	207172	.	+	0	ID=cds153;Parent=gene153;Dbxref=GOA:Q83NS0,InterPro:IPR000640,InterPro:IPR000795,InterPro:IPR004161,InterPro:IPR005225,InterPro:IPR006298,InterPro:IPR009000,InterPro:IPR009022,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NS0,NCBI_GP:CAD66846.1;Name=CAD66846.1;Note=Similar to Caulobacter crescentus elongation factor TU family protein cc0741 SWALL:Q9AA65 (EMBL:AE005749) (610 aa) fasta scores: E(): 4e-83%2C 43.18%25 id in 616 aa%2C and to Streptomyces coelicolor putative GTP-binding protein SCO5111 or SCBAC31E11.07 SWALL:Q93IU4 (EMBL:AL596043) (635 aa) fasta scores: E(): 8.9e-80%2C 56.85%25 id in 635 aa;gbkey=CDS;product=putative transcription factor;protein_id=CAD66846.1;transl_table=11
BX072543.1	EMBL	sequence_feature	205337	205958	.	+	.	ID=id353;Note=Elongation factor Tu GTP binding domain Score %3D 223.5 E-value %3D 2.2e-64;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	205364	205387	.	+	.	ID=id354;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	205451	205498	.	+	.	ID=id355;Note=PS00301 GTP-binding elongation factors signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	205985	206234	.	+	.	ID=id356;Note=Elongation factor Tu domain 2 Score %3D 48.2 E-value %3D 1.3e-11;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	206555	206816	.	+	.	ID=id357;Note=Elongation factor G C-terminus Score %3D 75.4 E-value %3D 8.5e-20;gbkey=misc_feature
BX072543.1	EMBL	gene	207488	208330	.	+	.	ID=gene154;Name=TW167;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW167
BX072543.1	EMBL	CDS	207488	208330	.	+	0	ID=cds154;Parent=gene154;Dbxref=GOA:Q83I97,InterPro:IPR003442,InterPro:IPR004568,InterPro:IPR008278,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I97,NCBI_GP:CAD66847.1;Name=CAD66847.1;Note=Has C-terminal similarity to proteins of undefined function. Similar to Streptococcus pyogenes hypothetical protein Spym18_1743 SWALL:AAL98271 (EMBL:AE010084) (153 aa) fasta scores: E(): 1.6e-10%2C 40%25 id in 140 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66847.1;transl_table=11
BX072543.1	EMBL	sequence_feature	207491	207815	.	+	.	ID=id358;Note=4'-phosphopantetheinyl transferase superfamily Score %3D 48.8 E-value %3D 8.6e-12;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	207887	208241	.	+	.	ID=id359;Note=Uncharacterised P-loop hydrolase UPF0079 Score %3D 111.1 E-value %3D 1.5e-30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	207950	207973	.	+	.	ID=id360;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	208351	209856	.	+	.	ID=gene155;Name=TW169;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW169
BX072543.1	EMBL	CDS	208351	209856	.	+	0	ID=cds155;Parent=gene155;Dbxref=GOA:Q83I96,InterPro:IPR000182,InterPro:IPR000905,InterPro:IPR016181,InterPro:IPR022496,UniProtKB/TrEMBL:Q83I96,NCBI_GP:CAD66848.1;Name=CAD66848.1;Note=Localised similarity to proteins of unknown function. C-terminal similar to Thermoanaerobacter tengcongensis acetyltransferases RimI3 or tte0537 SWALL:Q8RC99 (EMBL:AE013024) (149 aa) fasta scores: E(): 5e-10%2C 37.24%25 id in 145 aa. N-termional similar to Corynebacterium glutamicum inactive homologs of metal-dependent proteases%2C putative molecular chaperones cgl0592 SWALL:BAB97985 (EMBL:AP005275) (225 aa) fasta scores: E(): 0.00017%2C 39.62%25 id in 106 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66848.1;transl_table=11
BX072543.1	EMBL	sequence_feature	208456	208624	.	+	.	ID=id361;Note=Glycoprotease family Score %3D 18.0 E-value %3D 1.9e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	209551	209788	.	+	.	ID=id362;Note=Acetyltransferase (GNAT) family Score %3D 86.8 E-value %3D 3.2e-23;gbkey=misc_feature
BX072543.1	EMBL	gene	209856	211061	.	+	.	ID=gene156;Name=gcp;gbkey=Gene;gene=gcp;gene_biotype=protein_coding;locus_tag=TW170
BX072543.1	EMBL	CDS	209856	211061	.	+	0	ID=cds156;Parent=gene156;Dbxref=GOA:Q83I95,InterPro:IPR000905,InterPro:IPR017861,InterPro:IPR022450,NCBI_GP:CAD66849.1;Name=CAD66849.1;Note=Similar to Pasteurella haemolytica O-sialoglycoprotein endopeptidase Gcp SWALL:GCP_PASHA (SWALL:P36175) (325 aa) fasta scores: E(): 1.5e-13%2C 36.97%25 id in 384 aa%2C and to Streptomyces coelicolor probable O-sialoglycoprotein endopeptidase Gcp or SCO4752 or SC6G4.30 SWALL:GCP_STRCO (SWALL:O86793) (374 aa) fasta scores: E(): 4.3e-20%2C 43.71%25 id in 398 aa;gbkey=CDS;gene=gcp;product=O-sialoglycoprotein endopeptidase;protein_id=CAD66849.1;transl_table=11
BX072543.1	EMBL	sequence_feature	209859	210987	.	+	.	ID=id363;Note=Glycoprotease family Score %3D 376.6 E-value %3D 1.7e-110;gbkey=misc_feature;gene=gcp
BX072543.1	EMBL	repeat_region	211107	212101	.	+	.	ID=id364;Note=Non-coding degenerate repeat region in Repeat Cluster 1 (RC1).;gbkey=repeat_region
BX072543.1	EMBL	gene	212254	213477	.	+	.	ID=gene157;Name=TW171;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW171
BX072543.1	EMBL	CDS	212254	213477	.	+	0	ID=cds157;Parent=gene157;Dbxref=GOA:Q83I94,InterPro:IPR011063,InterPro:IPR012094,InterPro:IPR012795,InterPro:IPR014729,NCBI_GP:CAD66850.1;Name=CAD66850.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO3406 or SCE9.13c SWALL:Q9X8I6 (EMBL:AL049841) (352 aa) fasta scores: E(): 2.6e-11%2C 32.66%25 id in 401 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66850.1;transl_table=11
BX072543.1	EMBL	gene	213482	213985	.	+	.	ID=gene158;Name=hpt;gbkey=Gene;gene=hpt;gene_biotype=protein_coding;locus_tag=TW172
BX072543.1	EMBL	CDS	213482	213985	.	+	0	ID=cds158;Parent=gene158;Dbxref=GOA:Q83I93,InterPro:IPR000836,InterPro:IPR005904,InterPro:IPR029057,UniProtKB/TrEMBL:Q83I93,NCBI_GP:CAD66851.1;Name=CAD66851.1;Note=Similar to Salmonella typhimurium hypoxanthine phosphoribosyltransferase Hpt or Stm0170 SWALL:HPRT_SALTY (SWALL:O33799) (178 aa) fasta scores: E(): 7.7e-25%2C 46.01%25 id in 163 aa%2C and to Streptomyces coelicolor putative hypoxanthine phosphoribosyltransferase HprT or SCO3405 or SCE9.12c SWALL:Q9X8I5 (EMBL:AL049841) (187 aa) fasta scores: E(): 7.9e-35%2C 54.81%25 id in 166 aa;gbkey=CDS;gene=hpt;product=hypoxanthine phosphoribosyltransferase;protein_id=CAD66851.1;transl_table=11
BX072543.1	EMBL	sequence_feature	213482	213920	.	+	.	ID=id365;Note=Phosphoribosyl transferase domain Score %3D 63.3 E-value %3D 3.6e-16;gbkey=misc_feature;gene=hpt
BX072543.1	EMBL	sequence_feature	213746	213784	.	+	.	ID=id366;Note=PS00103 Purine/pyrimidine phosphoribosyl transferases signature.;gbkey=misc_feature;gene=hpt
BX072543.1	EMBL	gene	213988	215988	.	+	.	ID=gene159;Name=ftsH;gbkey=Gene;gene=ftsH;gene_biotype=protein_coding;locus_tag=TW173
BX072543.1	EMBL	CDS	213988	215988	.	+	0	ID=cds159;Parent=gene159;Dbxref=GOA:Q83I92,InterPro:IPR000642,InterPro:IPR003593,InterPro:IPR003959,InterPro:IPR003960,InterPro:IPR005936,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I92,NCBI_GP:CAD66852.1;Name=CAD66852.1;Note=Similar to Streptococcus pneumoniae cell division protein FtsH or sp0013 SWALL:FTSH_STRPN (SWALL:O69076) (652 aa) fasta scores: E(): 2.5e-86%2C 54.38%25 id in 502 aa%2C and to Streptomyces coelicolor cell division protein FtsH homolog FtsH2 or SCO3404 or SCE9.11c SWALL:Q9X8I4 (EMBL:AL049841) (668 aa) fasta scores: E(): 4.5e-119%2C 55.12%25 id in 664 aa;gbkey=CDS;gene=ftsH;product=FtsH-like putative cell division protein;protein_id=CAD66852.1;transl_table=11
BX072543.1	EMBL	sequence_feature	213988	214083	.	+	.	ID=id367;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.907) with cleavage site probability 0.640 between residues 32 and 33;gbkey=misc_feature;gene=ftsH
BX072543.1	EMBL	sequence_feature	214015	214068	.	+	.	ID=id368;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-27 and 109-131;gbkey=misc_feature;gene=ftsH;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	214312	214380	.	+	.	ID=id368;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-27 and 109-131;gbkey=misc_feature;gene=ftsH;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	214576	215137	.	+	.	ID=id369;Note=ATPase family associated with various cellular activities (AAA) Score %3D 328.5 E-value %3D 5.6e-96;gbkey=misc_feature;gene=ftsH
BX072543.1	EMBL	sequence_feature	214591	214614	.	+	.	ID=id370;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=ftsH
BX072543.1	EMBL	sequence_feature	214888	214944	.	+	.	ID=id371;Note=PS00674 AAA-protein family signature.;gbkey=misc_feature;gene=ftsH
BX072543.1	EMBL	sequence_feature	215155	215785	.	+	.	ID=id372;Note=Peptidase family M41 Score %3D 336.5 E-value %3D 2.1e-98;gbkey=misc_feature;gene=ftsH
BX072543.1	EMBL	gene	216002	216547	.	+	.	ID=gene160;Name=folE;gbkey=Gene;gene=folE;gene_biotype=protein_coding;gene_synonym=mtrA;locus_tag=TW174
BX072543.1	EMBL	CDS	216002	216547	.	+	0	ID=cds160;Parent=gene160;Dbxref=GOA:Q83I91,InterPro:IPR001474,InterPro:IPR020602,UniProtKB/TrEMBL:Q83I91,NCBI_GP:CAD66853.1;Name=CAD66853.1;Note=Similar to Bacillus subtilis GTP cyclohydrolase I FolE or MtrA SWALL:GCH1_BACSU (SWALL:P19465) (190 aa) fasta scores: E(): 1.9e-12%2C 33.53%25 id in 167 aa%2C and to Bacillus halodurans GTP cyclohydrolase I FolE or MtrA or bh1646 SWALL:GCH1_BACHD (SWALL:Q9KCC7) (188 aa) fasta scores: E(): 2.6e-14%2C 32.25%25 id in 186 aa;gbkey=CDS;gene=folE;product=GTP cyclohydrolase I;protein_id=CAD66853.1;transl_table=11
BX072543.1	EMBL	sequence_feature	216197	216482	.	+	.	ID=id373;Note=GTP cyclohydrolase I Score %3D 46.7 E-value %3D 3.8e-11;gbkey=misc_feature;gene=folE
BX072543.1	EMBL	gene	216584	218881	.	+	.	ID=gene161;Name=folP;gbkey=Gene;gene=folP;gene_biotype=protein_coding;gene_synonym=sul;locus_tag=TW175
BX072543.1	EMBL	CDS	216584	218881	.	+	0	ID=cds161;Parent=gene161;Dbxref=GOA:Q83I90,InterPro:IPR000489,InterPro:IPR000550,InterPro:IPR006157,InterPro:IPR006390,InterPro:IPR011005,UniProtKB/TrEMBL:Q83I90,NCBI_GP:CAD66854.1;Name=CAD66854.1;Note=Similar to Bacillus subtilis dihydropteroate synthase Sul SWALL:DHPS_BACSU (SWALL:P28822) (285 aa) fasta scores: E(): 8.7e-28%2C 40.61%25 id in 261 aa%2C and to Streptomyces coelicolor putative dihydropteroate synthase FolP or SCO3398 or SCE9.05 SWALL:Q9X8H8 (EMBL:AL049841) (288 aa) fasta scores: E(): 1.7e-38%2C 46.26%25 id in 268 aa;gbkey=CDS;gene=folP;product=dihydropteroate synthase;protein_id=CAD66854.1;transl_table=11
BX072543.1	EMBL	sequence_feature	216629	216676	.	+	.	ID=id374;Note=PS00792 Dihydropteroate synthase signature 1.;gbkey=misc_feature;gene=folP
BX072543.1	EMBL	sequence_feature	216638	217412	.	+	.	ID=id375;Note=Pterin binding enzyme Score %3D 325.9 E-value %3D 3.3e-95;gbkey=misc_feature;gene=folP
BX072543.1	EMBL	sequence_feature	216731	216772	.	+	.	ID=id376;Note=PS00793 Dihydropteroate synthase signature 2.;gbkey=misc_feature;gene=folP
BX072543.1	EMBL	sequence_feature	217631	217958	.	+	.	ID=id377;Note=Dihydroneopterin aldolase Score %3D 59.2 E-value %3D 6.1e-15;gbkey=misc_feature;gene=folP
BX072543.1	EMBL	sequence_feature	218066	218612	.	+	.	ID=id378;Note=7%2C8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK) Score %3D 100.9 E-value %3D 1.7e-27;gbkey=misc_feature;gene=folP
BX072543.1	EMBL	gene	218878	219327	.	+	.	ID=gene162;Name=TW176;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW176
BX072543.1	EMBL	CDS	218878	219327	.	+	0	ID=cds162;Parent=gene162;Dbxref=InterPro:IPR021517,UniProtKB/TrEMBL:Q83NR9,NCBI_GP:CAD66855.1;Name=CAD66855.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66855.1;transl_table=11
BX072543.1	EMBL	sequence_feature	218878	218958	.	+	.	ID=id379;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.468 between residues 27 and 28;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	218890	218949	.	+	.	ID=id380;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 77-99 and 114-136;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	218977	219045	.	+	.	ID=id380;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 77-99 and 114-136;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	219106	219174	.	+	.	ID=id380;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 77-99 and 114-136;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	219217	219285	.	+	.	ID=id380;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 34-56%2C 77-99 and 114-136;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	219552	220313	.	+	.	ID=gene163;Name=TW177;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW177
BX072543.1	EMBL	CDS	219552	220313	.	+	0	ID=cds163;Parent=gene163;Dbxref=GOA:Q83I89,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I89,NCBI_GP:CAD66856.1;Name=CAD66856.1;Note=Similar to Lactococcus lactis NisF protein NisF SWALL:Q48635 (EMBL:Z29363) (225 aa) fasta scores: E(): 2.3e-15%2C 32.57%25 id in 221 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD66856.1;transl_table=11
BX072543.1	EMBL	sequence_feature	219684	220209	.	+	.	ID=id381;Note=ABC transporter Score %3D 108.4 E-value %3D 9.9e-30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	219705	219728	.	+	.	ID=id382;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	219984	220028	.	+	.	ID=id383;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	220402	221079	.	+	.	ID=gene164;Name=TW178;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW178
BX072543.1	EMBL	CDS	220402	221079	.	+	0	ID=cds164;Parent=gene164;Dbxref=UniProtKB/TrEMBL:Q83NR8,NCBI_GP:CAD66857.1;Name=CAD66857.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66857.1;transl_table=11
BX072543.1	EMBL	sequence_feature	220468	220536	.	+	.	ID=id384;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 75-97%2C 112-134%2C 146-168 and 194-216;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	220624	220692	.	+	.	ID=id384;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 75-97%2C 112-134%2C 146-168 and 194-216;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	220735	220803	.	+	.	ID=id384;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 75-97%2C 112-134%2C 146-168 and 194-216;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	220837	220905	.	+	.	ID=id384;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 75-97%2C 112-134%2C 146-168 and 194-216;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	220981	221049	.	+	.	ID=id384;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 23-45%2C 75-97%2C 112-134%2C 146-168 and 194-216;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	221086	221778	.	+	.	ID=gene165;Name=ung;gbkey=Gene;gene=ung;gene_biotype=protein_coding;locus_tag=TW179
BX072543.1	EMBL	CDS	221086	221778	.	+	0	ID=cds165;Parent=gene165;Dbxref=GOA:P67079,InterPro:IPR002043,InterPro:IPR005122,InterPro:IPR018085,NCBI_GP:CAD66858.1;Name=CAD66858.1;Note=Similar to Streptomyces coelicolor uracil DNA glycosylase Ung or SCO1114 or 2SCG38.07 SWALL:Q9EX12 (EMBL:AL445503) (225 aa) fasta scores: E(): 2.6e-52%2C 59.17%25 id in 218 aa%2C and to Homo sapiens uracil-DNA glycosylase%2C mitochondrial precursor Ung or Dgu or Ung15 SWALL:UNG_HUMAN (SWALL:P13051) (304 aa) fasta scores: E(): 6.1e-26%2C 42.18%25 id in 192 aa;gbkey=CDS;gene=ung;product=uracil DNA glycosylase;protein_id=CAD66858.1;transl_table=11
BX072543.1	EMBL	sequence_feature	221251	221737	.	+	.	ID=id385;Note=Uracil DNA glycosylase superfamily Score %3D 170.1 E-value %3D 2.7e-48;gbkey=misc_feature;gene=ung
BX072543.1	EMBL	sequence_feature	221275	221304	.	+	.	ID=id386;Note=PS00130 Uracil-DNA glycosylase signature.;gbkey=misc_feature;gene=ung
BX072543.1	EMBL	gene	221811	222749	.	+	.	ID=gene166;Name=ribF;gbkey=Gene;gene=ribF;gene_biotype=protein_coding;locus_tag=TW180
BX072543.1	EMBL	CDS	221811	222749	.	+	0	ID=cds166;Parent=gene166;Dbxref=GOA:Q83I88,InterPro:IPR002606,InterPro:IPR004821,InterPro:IPR014729,InterPro:IPR015864,InterPro:IPR015865,InterPro:IPR023465,InterPro:IPR023468,UniProtKB/TrEMBL:Q83I88,NCBI_GP:CAD66859.1;Name=CAD66859.1;Note=Similar to Escherichia coli riboflavin biosynthesis protein RibF [includes: riboflavin kinase] or b0025 or z0029 or ecs0028 SWALL:RIBF_ECOLI (SWALL:P08391) (313 aa) fasta scores: E(): 8.3e-30%2C 35.33%25 id in 317 aa;gbkey=CDS;gene=ribF;product=riboflavin biosynthesis protein RibF [includes: riboflavin kinase];protein_id=CAD66859.1;transl_table=11
BX072543.1	EMBL	sequence_feature	222351	222732	.	+	.	ID=id387;Note=Riboflavin kinase / FAD synthetase Score %3D 125.2 E-value %3D 8.4e-35;gbkey=misc_feature;gene=ribF
BX072543.1	EMBL	gene	223106	223651	.	+	.	ID=gene167;Name=TW181;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW181
BX072543.1	EMBL	CDS	223106	223651	.	+	0	ID=cds167;Parent=gene167;Dbxref=UniProtKB/TrEMBL:Q83NR6,NCBI_GP:CAD66860.1;Name=CAD66860.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD66860.1;transl_table=11
BX072543.1	EMBL	sequence_feature	223106	223195	.	+	.	ID=id388;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.992 between residues 30 and 31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	223133	223201	.	+	.	ID=id389;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 10-32;gbkey=misc_feature
BX072543.1	EMBL	gene	223721	224497	.	+	.	ID=gene168;Name=TW182;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW182
BX072543.1	EMBL	CDS	223721	224497	.	+	0	ID=cds168;Parent=gene168;Dbxref=UniProtKB/TrEMBL:Q83NR5,NCBI_GP:CAD66861.1;Name=CAD66861.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66861.1;transl_table=11
BX072543.1	EMBL	sequence_feature	223730	223783	.	+	.	ID=id390;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 77-99%2C 152-174 and 179-201;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	223949	224017	.	+	.	ID=id390;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 77-99%2C 152-174 and 179-201;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	224174	224242	.	+	.	ID=id390;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 77-99%2C 152-174 and 179-201;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	224255	224323	.	+	.	ID=id390;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-21%2C 77-99%2C 152-174 and 179-201;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	224723	225307	.	+	.	ID=gene169;Name=TW184;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW184
BX072543.1	EMBL	CDS	224723	225307	.	+	0	ID=cds169;Parent=gene169;Dbxref=GOA:Q83NR4,InterPro:IPR000045,UniProtKB/TrEMBL:Q83NR4,NCBI_GP:CAD66862.1;Name=CAD66862.1;Note=Similar to Aeromonas hydrophila type 4 prepilin-like proteins leader peptide processing enzyme [includes: leader peptidase tapD] SWALL:LEP4_AERHY (SWALL:P45794) (290 aa) fasta scores: E(): 1.5e-05%2C 29.44%25 id in 197 aa%2C and to Escherichia coli leader peptidase HopD SWALL:HOPD_ECOLI (SWALL:O68932) (155 aa) fasta scores: E(): 0.0017%2C 32.7%25 id in 159 aa;gbkey=CDS;product=putative peptidase;protein_id=CAD66862.1;transl_table=11
BX072543.1	EMBL	sequence_feature	224723	224857	.	+	.	ID=id391;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.981) with cleavage site probability 0.862 between residues 45 and 46;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	224741	224836	.	+	.	ID=id392;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-38%2C 53-70%2C 83-105%2C 125-147 and 159-181;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	224879	224932	.	+	.	ID=id392;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-38%2C 53-70%2C 83-105%2C 125-147 and 159-181;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	224969	225037	.	+	.	ID=id392;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-38%2C 53-70%2C 83-105%2C 125-147 and 159-181;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	225095	225163	.	+	.	ID=id392;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-38%2C 53-70%2C 83-105%2C 125-147 and 159-181;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	225197	225265	.	+	.	ID=id392;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-38%2C 53-70%2C 83-105%2C 125-147 and 159-181;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	225473	226039	.	+	.	ID=gene170;Name=TW186;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW186
BX072543.1	EMBL	CDS	225473	226039	.	+	0	ID=cds170;Parent=gene170;Dbxref=UniProtKB/TrEMBL:Q83NR3,NCBI_GP:CAD66863.1;Name=CAD66863.1;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66863.1;transl_table=11
BX072543.1	EMBL	sequence_feature	225680	225748	.	+	.	ID=id393;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 97-119%2C 126-145 and 155-177;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	225761	225829	.	+	.	ID=id393;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 97-119%2C 126-145 and 155-177;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	225848	225907	.	+	.	ID=id393;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 97-119%2C 126-145 and 155-177;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	225935	226003	.	+	.	ID=id393;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 97-119%2C 126-145 and 155-177;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	226082	226408	.	+	.	ID=gene171;Name=TW187;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW187
BX072543.1	EMBL	CDS	226082	226408	.	+	0	ID=cds171;Parent=gene171;Dbxref=GOA:Q83NR2,InterPro:IPR000813,InterPro:IPR001450,InterPro:IPR017896,InterPro:IPR017900,UniProtKB/TrEMBL:Q83NR2,NCBI_GP:CAD66864.1;Name=CAD66864.1;Note=Similar to Streptomyces griseus ferredoxin SWALL:FER_STRGR (SWALL:P13279) (105 aa) fasta scores: E(): 1.8e-33%2C 79.2%25 id in 101 aa;gbkey=CDS;product=ferredoxin;protein_id=CAD66864.1;transl_table=11
BX072543.1	EMBL	sequence_feature	226178	226247	.	+	.	ID=id394;Note=4Fe-4S binding domain Score %3D 38.9 E-value %3D 8e-09;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	226199	226234	.	+	.	ID=id395;Note=PS00198 4Fe-4S ferredoxins%2C iron-sulfur binding region signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	226431	227699	.	+	.	ID=gene172;Name=TW188;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW188
BX072543.1	EMBL	CDS	226431	227699	.	+	0	ID=cds172;Parent=gene172;Dbxref=UniProtKB/TrEMBL:Q83NR1,NCBI_GP:CAD66865.1;Name=CAD66865.1;Note=Weakly similar to Streptomyces coelicolor putative integral membrane protein SCO1752 or 2SCI34.05 SWALL:Q9EWX4 (EMBL:AL445403) (396 aa) fasta scores: E(): 4.1e-05%2C 24.72%25 id in 364 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66865.1;transl_table=11
BX072543.1	EMBL	sequence_feature	226536	226604	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	226758	226826	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	226839	226907	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	226926	227030	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	227073	227132	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	227190	227258	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	227391	227459	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	227478	227546	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	227604	227672	.	+	.	ID=id396;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 36-58%2C 110-132%2C 137-159%2C 166-200%2C 215-234%2C 254-276%2C 321-343%2C 350-372 and 392-414;gbkey=misc_feature;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	repeat_region	227946	227956	.	+	.	ID=id397;Note=(g)11;gbkey=repeat_region
BX072543.1	EMBL	gene	228065	228706	.	+	.	ID=gene173;Name=TW189;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW189
BX072543.1	EMBL	CDS	228065	228706	.	+	0	ID=cds173;Parent=gene173;Dbxref=UniProtKB/TrEMBL:Q83NR0,NCBI_GP:CAD66866.1;Name=CAD66866.1;Note=No significant database matches. Possible coiled-coil region at residues 42-80.;gbkey=CDS;product=putative membrane protein;protein_id=CAD66866.1;transl_table=11
BX072543.1	EMBL	sequence_feature	228065	228133	.	+	.	ID=id398;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.405 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	228077	228145	.	+	.	ID=id399;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34 and 195-217;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	228626	228694	.	+	.	ID=id399;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34 and 195-217;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	228948	229565	.	-	.	ID=gene174;Name=mdmC;gbkey=Gene;gene=mdmC;gene_biotype=protein_coding;locus_tag=TW190
BX072543.1	EMBL	CDS	228948	229565	.	-	0	ID=cds174;Parent=gene174;Dbxref=GOA:Q83I87,InterPro:IPR002935,InterPro:IPR029063,UniProtKB/TrEMBL:Q83I87,NCBI_GP:CAD66867.1;Name=CAD66867.1;Note=Similar to Streptomyces mycarofaciens O-methyltransferase MdmC SWALL:MDMC_STRMY (SWALL:Q00719) (221 aa) fasta scores: E(): 8e-05%2C 28.57%25 id in 175 aa;gbkey=CDS;gene=mdmC;product=putative O-methyltransferase;protein_id=CAD66867.1;transl_table=11
BX072543.1	EMBL	sequence_feature	228956	229538	.	-	.	ID=id400;Note=O-methyltransferase Score %3D -50.0 E-value %3D 1.3e-08;gbkey=misc_feature;gene=mdmC
BX072543.1	EMBL	gene	229601	229825	.	+	.	ID=gene175;Name=TW191;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW191
BX072543.1	EMBL	CDS	229601	229825	.	+	0	ID=cds175;Parent=gene175;Dbxref=UniProtKB/TrEMBL:Q83NQ9,NCBI_GP:CAD66868.1;Name=CAD66868.1;Note=N-terminus similar to that of Caulobacter crescentus hypothetical protein Cc2002 SWALL:Q9A6T1 (EMBL:AE005873) (200 aa) fasta scores: E(): 5.2%2C 31.91%25 id in 47 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD66868.1;transl_table=11
BX072543.1	EMBL	sequence_feature	229601	229693	.	+	.	ID=id401;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.889) with cleavage site probability 0.511 between residues 31 and 32;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	229631	229690	.	+	.	ID=id402;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 11-30;gbkey=misc_feature
BX072543.1	EMBL	gene	229953	230495	.	+	.	ID=gene176;Name=TW192;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW192
BX072543.1	EMBL	CDS	229953	230495	.	+	0	ID=cds176;Parent=gene176;Dbxref=UniProtKB/TrEMBL:Q83NQ8,NCBI_GP:CAD66869.1;Name=CAD66869.1;Note=No significant database matches;gbkey=CDS;product=possible integral membrane protein;protein_id=CAD66869.1;transl_table=11
BX072543.1	EMBL	sequence_feature	229953	230036	.	+	.	ID=id403;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.780 between residues 28 and 29;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	229971	230039	.	+	.	ID=id404;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29 and 111-133;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	230283	230351	.	+	.	ID=id404;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29 and 111-133;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	230519	231298	.	+	.	ID=gene177;Name=TW193;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW193
BX072543.1	EMBL	CDS	230519	231298	.	+	0	ID=cds177;Parent=gene177;Dbxref=UniProtKB/TrEMBL:Q83NQ7,NCBI_GP:CAD66870.1;Name=CAD66870.1;Note=No significant database matches;gbkey=CDS;product=possible integral membrane protein;protein_id=CAD66870.1;transl_table=11
BX072543.1	EMBL	sequence_feature	230561	230608	.	+	.	ID=id405;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 64-86%2C 101-123%2C 169-191 and 201-223;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	230708	230776	.	+	.	ID=id405;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 64-86%2C 101-123%2C 169-191 and 201-223;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	230819	230887	.	+	.	ID=id405;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 64-86%2C 101-123%2C 169-191 and 201-223;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	231023	231091	.	+	.	ID=id405;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 64-86%2C 101-123%2C 169-191 and 201-223;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	231119	231187	.	+	.	ID=id405;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 64-86%2C 101-123%2C 169-191 and 201-223;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	231435	232766	.	-	.	ID=gene178;Name=aroA;gbkey=Gene;gene=aroA;gene_biotype=protein_coding;locus_tag=TW194
BX072543.1	EMBL	CDS	231435	232766	.	-	0	ID=cds178;Parent=gene178;Dbxref=GOA:Q83I86,InterPro:IPR001986,InterPro:IPR006264,InterPro:IPR013792,InterPro:IPR023193,NCBI_GP:CAD66871.1;Name=CAD66871.1;Note=Similar to Mycobacterium tuberculosis 3-phosphoshikimate 1-carboxyvinyltransferase AroA or Rv3227 or mt3324 or mtcy20b11.02 SWALL:AROA_MYCTU (SWALL:P22487) (450 aa) fasta scores: E(): 1.6e-52%2C 42.4%25 id in 441 aa;gbkey=CDS;gene=aroA;product=3-phosphoshikimate 1-carboxyvinyltransferase;protein_id=CAD66871.1;transl_table=11
BX072543.1	EMBL	sequence_feature	231458	232721	.	-	.	ID=id406;Note=EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase) Score %3D 326.9 E-value %3D 1.7e-95;gbkey=misc_feature;gene=aroA
BX072543.1	EMBL	gene	232840	234861	.	+	.	ID=gene179;Name=recG;gbkey=Gene;gene=recG;gene_biotype=protein_coding;locus_tag=TW195
BX072543.1	EMBL	CDS	232840	234861	.	+	0	ID=cds179;Parent=gene179;Dbxref=GOA:Q83I85,InterPro:IPR001650,InterPro:IPR004365,InterPro:IPR011545,InterPro:IPR012340,InterPro:IPR014001,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I85,NCBI_GP:CAD66872.1;Name=CAD66872.1;Note=Similar to Staphylococcus aureus ATP-dependent DNA helicase RecG SWALL:RECG_STAAU (SWALL:O50581) (686 aa) fasta scores: E(): 3.9e-62%2C 32.43%25 id in 666 aa;gbkey=CDS;gene=recG;product=ATP-dependent DNA helicase RecG;protein_id=CAD66872.1;transl_table=11
BX072543.1	EMBL	sequence_feature	232966	233191	.	+	.	ID=id407;Note=OB-fold nucleic acid binding domain Score %3D 47.9 E-value %3D 1.6e-11;gbkey=misc_feature;gene=recG
BX072543.1	EMBL	sequence_feature	233545	234124	.	+	.	ID=id408;Note=DEAD/DEAH box helicase Score %3D 98.8 E-value %3D 7.8e-27;gbkey=misc_feature;gene=recG
BX072543.1	EMBL	sequence_feature	233656	233679	.	+	.	ID=id409;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=recG
BX072543.1	EMBL	sequence_feature	234310	234526	.	+	.	ID=id410;Note=Helicase conserved C-terminal domain Score %3D 76.5 E-value %3D 3.9e-20;gbkey=misc_feature;gene=recG
BX072543.1	EMBL	gene	234982	235512	.	+	.	ID=gene180;Name=coaD;gbkey=Gene;gene=coaD;gene_biotype=protein_coding;locus_tag=TW196
BX072543.1	EMBL	CDS	234982	235512	.	+	0	ID=cds180;Parent=gene180;Dbxref=GOA:Q83I84,InterPro:IPR001980,InterPro:IPR004821,InterPro:IPR014729,NCBI_GP:CAD66873.1;Name=CAD66873.1;Note=Similar to Escherichia coli phosphopantetheine adenylyltransferase CoaD or KdtB or b3634 or z5058 or ecs4509 SWALL:COAD_ECOLI (SWALL:P23875) (159 aa) fasta scores: E(): 3.8e-06%2C 33.13%25 id in 169 aa;gbkey=CDS;gene=coaD;product=phosphopantetheine adenylyltransferase;protein_id=CAD66873.1;transl_table=11
BX072543.1	EMBL	sequence_feature	235000	235498	.	+	.	ID=id411;Note=Cytidylyltransferase Score %3D 56.8 E-value %3D 3.4e-14;gbkey=misc_feature;gene=coaD
BX072543.1	EMBL	gene	235965	236714	.	-	.	ID=gene181;Name=TW197;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW197
BX072543.1	EMBL	CDS	235965	236714	.	-	0	ID=cds181;Parent=gene181;Dbxref=InterPro:IPR005754,InterPro:IPR023365,UniProtKB/TrEMBL:Q83NQ6,NCBI_GP:CAD66874.1;Name=CAD66874.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO3849 or SCH69.19c SWALL:Q9XA15 (EMBL:AL079308) (253 aa) fasta scores: E(): 9.6e-09%2C 25.6%25 id in 250 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66874.1;transl_table=11
BX072543.1	EMBL	sequence_feature	235997	236423	.	-	.	ID=id412;Note=Sortase family Score %3D 54.3 E-value %3D 1.9e-13;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	236568	236636	.	-	.	ID=id413;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 27-49;gbkey=misc_feature
BX072543.1	EMBL	gene	236982	237179	.	+	.	ID=gene182;Name=rpmF;gbkey=Gene;gene=rpmF;gene_biotype=protein_coding;locus_tag=TW198
BX072543.1	EMBL	CDS	236982	237179	.	+	0	ID=cds182;Parent=gene182;Dbxref=GOA:Q83I83,InterPro:IPR002677,InterPro:IPR011332,NCBI_GP:CAD66875.1;Name=CAD66875.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L32 RpmF SWALL:RL32_BACST (SWALL:P07840) (56 aa) fasta scores: E(): 4.3%2C 34.92%25 id in 63 aa%2C and to Mycobacterium tuberculosis 50s ribosomal protein L32 RpmF or Rv0979.1c or mt1007 or mtv044.07c.1 SWALL:RL32_MYCTU (SWALL:P58287) (57 aa) fasta scores: E(): 0.00062%2C 55.1%25 id in 49 aa;gbkey=CDS;gene=rpmF;product=50s ribosomal protein L32;protein_id=CAD66875.1;transl_table=11
BX072543.1	EMBL	sequence_feature	236985	237099	.	+	.	ID=id414;Note=Ribosomal L32p protein family Score %3D 17.6 E-value %3D 0.00057;gbkey=misc_feature;gene=rpmF
BX072543.1	EMBL	gene	237204	237851	.	+	.	ID=gene183;Name=rnc;gbkey=Gene;gene=rnc;gene_biotype=protein_coding;locus_tag=TW199
BX072543.1	EMBL	CDS	237204	237851	.	+	0	ID=cds183;Parent=gene183;Dbxref=GOA:Q83I82,InterPro:IPR000999,InterPro:IPR011907,InterPro:IPR014720,NCBI_GP:CAD66876.1;Name=CAD66876.1;Note=Similar to Escherichia coli ribonuclease III Rnc or b2567 or z3848 or ecs3433 SWALL:RNC_ECOLI (SWALL:P05797) (226 aa) fasta scores: E(): 3e-18%2C 35%25 id in 220 aa%2C and to Streptomyces coelicolor ribonuclease III Rnc or SCO5572 or SC7A1.16 SWALL:RNC_STRCO (SWALL:Q9ZBQ7) (272 aa) fasta scores: E(): 3.9e-26%2C 42.05%25 id in 214 aa;gbkey=CDS;gene=rnc;product=ribonuclease III;protein_id=CAD66876.1;transl_table=11
BX072543.1	EMBL	sequence_feature	237300	237570	.	+	.	ID=id415;Note=RNase3 domain Score %3D 160.6 E-value %3D 1.8e-45;gbkey=misc_feature;gene=rnc
BX072543.1	EMBL	sequence_feature	237300	237326	.	+	.	ID=id416;Note=PS00517 Ribonuclease III family signature.;gbkey=misc_feature;gene=rnc
BX072543.1	EMBL	sequence_feature	237651	237831	.	+	.	ID=id417;Note=Double-stranded RNA binding motif Score %3D 71.7 E-value %3D 1.1e-18;gbkey=misc_feature;gene=rnc
BX072543.1	EMBL	gene	237969	239126	.	+	.	ID=gene184;Name=TW200;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW200
BX072543.1	EMBL	CDS	237969	239126	.	+	0	ID=cds184;Parent=gene184;Dbxref=GOA:Q83NQ5,InterPro:IPR000709,InterPro:IPR028081,InterPro:IPR028082,UniProtKB/TrEMBL:Q83NQ5,NCBI_GP:CAD66877.1;Name=CAD66877.1;Note=Similar to Pseudomonas aeruginosa leucine-%2C isoleucine-%2C valine-%2C threonine-%2C and alanine-binding protein precursor BraC or pa1074 SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 3.2e-22%2C 28.78%25 id in 337 aa;gbkey=CDS;product=putative ABC transporter branched chain amino acid binding protein;protein_id=CAD66877.1;transl_table=11
BX072543.1	EMBL	sequence_feature	238092	239115	.	+	.	ID=id418;Note=Receptor family ligand binding region Score %3D -7.8 E-value %3D 4.8e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	239174	240178	.	+	.	ID=gene185;Name=TW201;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW201
BX072543.1	EMBL	CDS	239174	240178	.	+	0	ID=cds185;Parent=gene185;Dbxref=GOA:Q83NQ4,InterPro:IPR001851,UniProtKB/TrEMBL:Q83NQ4,NCBI_GP:CAD66878.1;Name=CAD66878.1;Note=Similar to Escherichia coli high-affinity branched-chain amino acid transport system permease protein LivH or b3457 or z4827 or ecs4304 SWALL:LIVH_ECOLI (SWALL:P08340) (308 aa) fasta scores: E(): 1.1e-30%2C 42.05%25 id in 302 aa;gbkey=CDS;product=putative ABC transporter branched chain amino acid transport permease;protein_id=CAD66878.1;transl_table=11
BX072543.1	EMBL	sequence_feature	239246	240152	.	+	.	ID=id419;Note=Branched-chain amino acid transport system / permease component Score %3D 127.1 E-value %3D 2.3e-35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	239270	239338	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	239351	239419	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	239447	239515	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	239552	239620	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	239678	239746	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	239843	239911	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	239924	239992	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	240011	240064	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	240092	240160	.	+	.	ID=id420;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55%2C 60-82%2C 92-114%2C 127-149%2C 169-191%2C 224-246%2C 251-273%2C 280-297 and 307-329;gbkey=misc_feature;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	gene	240175	241269	.	+	.	ID=gene186;Name=TW202;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW202
BX072543.1	EMBL	CDS	240175	241269	.	+	0	ID=cds186;Parent=gene186;Dbxref=GOA:Q83NQ3,InterPro:IPR001851,UniProtKB/TrEMBL:Q83NQ3,NCBI_GP:CAD66879.1;Name=CAD66879.1;Note=Similar to Escherichia coli high-affinity branched-chain amino acid transport system permease protein LivM or b3456 SWALL:LIVM_ECOLI (SWALL:P22729) (425 aa) fasta scores: E(): 2.9e-14%2C 36.19%25 id in 326 aa;gbkey=CDS;product=putative ABC transporter branched chain amino acid transport permease;protein_id=CAD66879.1;transl_table=11
BX072543.1	EMBL	sequence_feature	240235	240303	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	240331	240390	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	240409	240465	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	240493	240561	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	240580	240648	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	240736	240795	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	240886	240954	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	240997	241065	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	241102	241155	.	+	.	ID=id421;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-72%2C 79-97%2C 107-129%2C 136-158%2C 188-207%2C 238-260%2C 275-297 and 310-327;gbkey=misc_feature;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	240310	241177	.	+	.	ID=id422;Note=Branched-chain amino acid transport system / permease component Score %3D 94.8 E-value %3D 1.2e-25;gbkey=misc_feature
BX072543.1	EMBL	gene	241271	242053	.	+	.	ID=gene187;Name=TW203;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW203
BX072543.1	EMBL	CDS	241271	242053	.	+	0	ID=cds187;Parent=gene187;Dbxref=GOA:Q83I81,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I81,NCBI_GP:CAD66880.1;Name=CAD66880.1;Note=Similar to Escherichia coli high-affinity branched-chain amino acid transport ATP-binding protein LivG or b3455 or z4825 or ecs4302 SWALL:LIVG_ECOLI (SWALL:P22730) (255 aa) fasta scores: E(): 4.7e-36%2C 47.43%25 id in 253 aa;gbkey=CDS;product=putative branched chain amino acid ABC transporter ATP-binding subunit;protein_id=CAD66880.1;transl_table=11
BX072543.1	EMBL	sequence_feature	241379	241973	.	+	.	ID=id423;Note=ABC transporter Score %3D 197.7 E-value %3D 1.3e-56;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	241400	241423	.	+	.	ID=id424;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	242078	242761	.	+	.	ID=gene188;Name=TW204;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW204
BX072543.1	EMBL	CDS	242078	242761	.	+	0	ID=cds188;Parent=gene188;Dbxref=GOA:Q83I80,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I80,NCBI_GP:CAD66881.1;Name=CAD66881.1;Note=Similar to Escherichia coli high-affinity branched-chain amino acid transport ATP-binding protein LivF or b3454 SWALL:LIVF_ECOLI (SWALL:P22731) (237 aa) fasta scores: E(): 1.4e-33%2C 52.42%25 id in 227 aa;gbkey=CDS;product=putative branched chain amino acid ABC transporter ATP-binding subunit;protein_id=CAD66881.1;transl_table=11
BX072543.1	EMBL	sequence_feature	242138	242684	.	+	.	ID=id425;Note=ABC transporter Score %3D 187.2 E-value %3D 1.9e-53;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	242159	242182	.	+	.	ID=id426;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	242459	242503	.	+	.	ID=id427;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	242928	243596	.	+	.	ID=gene189;Name=ftsY;gbkey=Gene;gene=ftsY;gene_biotype=protein_coding;locus_tag=TW205
BX072543.1	EMBL	CDS	242928	243596	.	+	0	ID=cds189;Parent=gene189;Dbxref=GOA:Q83NQ2,InterPro:IPR000897,InterPro:IPR003593,InterPro:IPR004390,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NQ2,NCBI_GP:CAD66882.1;Name=CAD66882.1;Note=Similar to Escherichia coli cell division protein FtsY or b3464 SWALL:FTSY_ECOLI (SWALL:P10121) (497 aa) fasta scores: E(): 4.8e-30%2C 47.32%25 id in 224 aa;gbkey=CDS;gene=ftsY;product=putative SRP54-type protein;protein_id=CAD66882.1;transl_table=11
BX072543.1	EMBL	sequence_feature	242985	243591	.	+	.	ID=id428;Note=SRP54-type protein%2C GTPase domain Score %3D 329.8 E-value %3D 2.2e-96;gbkey=misc_feature;gene=ftsY
BX072543.1	EMBL	sequence_feature	243012	243035	.	+	.	ID=id429;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=ftsY
BX072543.1	EMBL	sequence_feature	243510	243551	.	+	.	ID=id430;Note=PS00300 SRP54-type proteins GTP-binding domain signature.;gbkey=misc_feature;gene=ftsY
BX072543.1	EMBL	gene	243756	244064	.	+	.	ID=gene190;Name=rpsJ;gbkey=Gene;gene=rpsJ;gene_biotype=protein_coding;locus_tag=TW206
BX072543.1	EMBL	CDS	243756	244064	.	+	0	ID=cds190;Parent=gene190;Dbxref=GOA:Q83I79,InterPro:IPR001848,InterPro:IPR018268,InterPro:IPR027486,NCBI_GP:CAD66883.1;Name=CAD66883.1;Note=Similar to Mycobacterium tuberculosis 30s ribosomal protein S10 RpsJ or RpsX or Rv0700 or mt0727 or mtcy210.19 SWALL:RS10_MYCTU (SWALL:P95048) (101 aa) fasta scores: E(): 7.7e-28%2C 70.29%25 id in 101 aa;gbkey=CDS;gene=rpsJ;product=30S ribosomal protein S10;protein_id=CAD66883.1;transl_table=11
BX072543.1	EMBL	sequence_feature	243768	244053	.	+	.	ID=id431;Note=Ribosomal protein S10p/S20e Score %3D 176.1 E-value %3D 4e-50;gbkey=misc_feature;gene=rpsJ
BX072543.1	EMBL	sequence_feature	243840	243887	.	+	.	ID=id432;Note=PS00361 Ribosomal protein S10 signature.;gbkey=misc_feature;gene=rpsJ
BX072543.1	EMBL	gene	244074	244706	.	+	.	ID=gene191;Name=rplC;gbkey=Gene;gene=rplC;gene_biotype=protein_coding;locus_tag=TW207
BX072543.1	EMBL	CDS	244074	244706	.	+	0	ID=cds191;Parent=gene191;Dbxref=GOA:Q83I78,InterPro:IPR000597,InterPro:IPR009000,InterPro:IPR019926,InterPro:IPR019927,NCBI_GP:CAD66884.1;Name=CAD66884.1;Note=Similar to Escherichia coli 50s ribosomal protein L3 RplC or b3320 or z4691 or ecs4185 SWALL:RL3_ECOLI (SWALL:P02386) (209 aa) fasta scores: E(): 2.1e-32%2C 49.26%25 id in 205 aa;gbkey=CDS;gene=rplC;product=50S ribosomal protein L3;protein_id=CAD66884.1;transl_table=11
BX072543.1	EMBL	sequence_feature	244098	244671	.	+	.	ID=id433;Note=Ribosomal protein L3 Score %3D 213.6 E-value %3D 2.2e-61;gbkey=misc_feature;gene=rplC
BX072543.1	EMBL	sequence_feature	244362	244433	.	+	.	ID=id434;Note=PS00474 Ribosomal protein L3 signature.;gbkey=misc_feature;gene=rplC
BX072543.1	EMBL	gene	244696	245442	.	+	.	ID=gene192;Name=rplD;gbkey=Gene;gene=rplD;gene_biotype=protein_coding;locus_tag=TW208
BX072543.1	EMBL	CDS	244696	245442	.	+	0	ID=cds192;Parent=gene192;Dbxref=GOA:Q83I77,InterPro:IPR002136,InterPro:IPR013005,InterPro:IPR023574,NCBI_GP:CAD66885.1;Name=CAD66885.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L4 RplD SWALL:RL4_BACST (SWALL:P28601) (207 aa) fasta scores: E(): 6.1e-28%2C 41.62%25 id in 197 aa;gbkey=CDS;gene=rplD;product=50s ribosomal protein L4;protein_id=CAD66885.1;transl_table=11
BX072543.1	EMBL	sequence_feature	244741	245308	.	+	.	ID=id435;Note=Ribosomal protein L4/L1 family Score %3D 159.9 E-value %3D 3e-45;gbkey=misc_feature;gene=rplD
BX072543.1	EMBL	gene	245439	245750	.	+	.	ID=gene193;Name=rplW;gbkey=Gene;gene=rplW;gene_biotype=protein_coding;locus_tag=TW209
BX072543.1	EMBL	CDS	245439	245750	.	+	0	ID=cds193;Parent=gene193;Dbxref=GOA:Q83I76,InterPro:IPR001014,InterPro:IPR012677,InterPro:IPR012678,InterPro:IPR013025,UniProtKB/TrEMBL:Q83I76,NCBI_GP:CAD66886.1;Name=CAD66886.1;Note=Similar to Mycobacterium bovis 50s ribosomal protein L23 RplW SWALL:RL23_MYCBO (SWALL:O06046) (100 aa) fasta scores: E(): 8.8e-19%2C 69.31%25 id in 88 aa%2C and to Thermus thermophilus ribosomal protein L23 SWALL:Q9RA57 (EMBL:AF094532) (96 aa) fasta scores: E(): 1.4e-11%2C 51.76%25 id in 85 aa;gbkey=CDS;gene=rplW;product=50s ribosomal protein L23;protein_id=CAD66886.1;transl_table=11
BX072543.1	EMBL	sequence_feature	245484	245745	.	+	.	ID=id436;Note=Ribosomal protein L23 Score %3D 107.4 E-value %3D 1.9e-29;gbkey=misc_feature;gene=rplW
BX072543.1	EMBL	sequence_feature	245700	245744	.	+	.	ID=id437;Note=This hit extended beyond the end of the feature by 1 aa and was clipped.%3B~PS00050 Ribosomal protein L23 signature.;gbkey=misc_feature;gene=rplW
BX072543.1	EMBL	gene	245758	246591	.	+	.	ID=gene194;Name=rplB;gbkey=Gene;gene=rplB;gene_biotype=protein_coding;locus_tag=TW210
BX072543.1	EMBL	CDS	245758	246591	.	+	0	ID=cds194;Parent=gene194;Dbxref=GOA:Q83I75,InterPro:IPR002171,InterPro:IPR005880,InterPro:IPR008991,InterPro:IPR012340,InterPro:IPR014722,InterPro:IPR014726,InterPro:IPR022666,InterPro:IPR022669,InterPro:IPR022671,NCBI_GP:CAD66887.1;Name=CAD66887.1;Note=Similar to Escherichia coli 50s ribosomal protein l2 RplB or b3317 or z4688 or ecs4182 SWALL:RL2_ECOLI (SWALL:P02387) (272 aa) fasta scores: E(): 6e-60%2C 56.93%25 id in 274 aa;gbkey=CDS;gene=rplB;product=50s ribosomal protein l2;protein_id=CAD66887.1;transl_table=11
BX072543.1	EMBL	sequence_feature	245881	246112	.	+	.	ID=id438;Note=Ribosomal Proteins L2%2C RNA binding domain Score %3D 162.1 E-value %3D 6.5e-46;gbkey=misc_feature;gene=rplB
BX072543.1	EMBL	sequence_feature	246130	246514	.	+	.	ID=id439;Note=Ribosomal Proteins L2%2C C-terminal domain Score %3D 286.9 E-value %3D 1.8e-83;gbkey=misc_feature;gene=rplB
BX072543.1	EMBL	sequence_feature	246412	246447	.	+	.	ID=id440;Note=PS00467 Ribosomal protein L2 signature.;gbkey=misc_feature;gene=rplB
BX072543.1	EMBL	gene	246596	246877	.	+	.	ID=gene195;Name=rpsS;gbkey=Gene;gene=rpsS;gene_biotype=protein_coding;locus_tag=TW211
BX072543.1	EMBL	CDS	246596	246877	.	+	0	ID=cds195;Parent=gene195;Dbxref=GOA:Q83I74,InterPro:IPR002222,InterPro:IPR005732,InterPro:IPR020934,InterPro:IPR023575,NCBI_GP:CAD66888.1;Name=CAD66888.1;Note=Similar to Escherichia coli 30s ribosomal protein S19 RpsS or b3316 or z4687 or ecs4181 SWALL:RS19_ECOLI (SWALL:P02375) (91 aa) fasta scores: E(): 6.9e-26%2C 67.39%25 id in 92 aa;gbkey=CDS;gene=rpsS;product=30s ribosomal protein s19;protein_id=CAD66888.1;transl_table=11
BX072543.1	EMBL	sequence_feature	246602	246842	.	+	.	ID=id441;Note=Ribosomal protein S19 Score %3D 176.2 E-value %3D 3.8e-50;gbkey=misc_feature;gene=rpsS
BX072543.1	EMBL	sequence_feature	246752	246826	.	+	.	ID=id442;Note=PS00323 Ribosomal protein S19 signature.;gbkey=misc_feature;gene=rpsS
BX072543.1	EMBL	gene	246877	247236	.	+	.	ID=gene196;Name=rplV;gbkey=Gene;gene=rplV;gene_biotype=protein_coding;locus_tag=TW212
BX072543.1	EMBL	CDS	246877	247236	.	+	0	ID=cds196;Parent=gene196;Dbxref=GOA:Q83I73,InterPro:IPR001063,InterPro:IPR005727,InterPro:IPR018260,NCBI_GP:CAD66889.1;Name=CAD66889.1;Note=Similar to Escherichia coli 50s ribosomal protein L22 RplV or EryB or b3315 or z4686 or ecs4180 or stm3435 or sty4363 SWALL:RL22_ECOLI (SWALL:P02423) (110 aa) fasta scores: E(): 2.2e-13%2C 45.37%25 id in 108 aa;gbkey=CDS;gene=rplV;product=50s ribosomal protein l22;protein_id=CAD66889.1;transl_table=11
BX072543.1	EMBL	sequence_feature	246913	247222	.	+	.	ID=id443;Note=Ribosomal protein L22p/L17e Score %3D 127.3 E-value %3D 1.9e-35;gbkey=misc_feature;gene=rplV
BX072543.1	EMBL	sequence_feature	247144	247218	.	+	.	ID=id444;Note=PS00464 Ribosomal protein L22 signature.;gbkey=misc_feature;gene=rplV
BX072543.1	EMBL	gene	247239	247901	.	+	.	ID=gene197;Name=rpsC;gbkey=Gene;gene=rpsC;gene_biotype=protein_coding;locus_tag=TW213
BX072543.1	EMBL	CDS	247239	247901	.	+	0	ID=cds197;Parent=gene197;Dbxref=GOA:Q83I72,InterPro:IPR001351,InterPro:IPR004044,InterPro:IPR004087,InterPro:IPR005704,InterPro:IPR009019,InterPro:IPR015946,InterPro:IPR018280,NCBI_GP:CAD66890.1;Name=CAD66890.1;Note=Similar to Escherichia coli 30s ribosomal protein S3 RpsC or b3314 or z4685 or ecs4179 or stm3434 or sty4364 SWALL:RS3_ECOLI (SWALL:P02352) (232 aa) fasta scores: E(): 7.2e-36%2C 50.72%25 id in 207 aa;gbkey=CDS;gene=rpsC;product=30s ribosomal protein S3;protein_id=CAD66890.1;transl_table=11
BX072543.1	EMBL	sequence_feature	247239	247434	.	+	.	ID=id445;Note=Ribosomal protein S3%2C N-terminal domain Score %3D 98.0 E-value %3D 1.3e-26;gbkey=misc_feature;gene=rpsC
BX072543.1	EMBL	sequence_feature	247443	247584	.	+	.	ID=id446;Note=KH domain Score %3D 20.6 E-value %3D 0.00091;gbkey=misc_feature;gene=rpsC
BX072543.1	EMBL	sequence_feature	247605	247854	.	+	.	ID=id447;Note=Ribosomal protein S3%2C C-terminal domain Score %3D 147.0 E-value %3D 2.3e-41;gbkey=misc_feature;gene=rpsC
BX072543.1	EMBL	sequence_feature	247737	247841	.	+	.	ID=id448;Note=PS00548 Ribosomal protein S3 signature.;gbkey=misc_feature;gene=rpsC
BX072543.1	EMBL	gene	247898	248329	.	+	.	ID=gene198;Name=rplP;gbkey=Gene;gene=rplP;gene_biotype=protein_coding;locus_tag=TW214
BX072543.1	EMBL	CDS	247898	248329	.	+	0	ID=cds198;Parent=gene198;Dbxref=GOA:Q83I71,InterPro:IPR000114,InterPro:IPR016180,InterPro:IPR020798,NCBI_GP:CAD66891.1;Name=CAD66891.1;Note=Similar to Bacillus subtilis 50s ribosomal protein L16 RplP SWALL:RL16_BACSU (SWALL:P14577) (144 aa) fasta scores: E(): 2.4e-32%2C 56.61%25 id in 136 aa;gbkey=CDS;gene=rplP;product=50s ribosomal protein L16;protein_id=CAD66891.1;transl_table=11
BX072543.1	EMBL	sequence_feature	247901	248294	.	+	.	ID=id449;Note=Ribosomal protein L16 Score %3D 246.8 E-value %3D 2.1e-71;gbkey=misc_feature;gene=rplP
BX072543.1	EMBL	sequence_feature	248144	248179	.	+	.	ID=id450;Note=PS00701 Ribosomal protein L16 signature 2.;gbkey=misc_feature;gene=rplP
BX072543.1	EMBL	gene	248316	248555	.	+	.	ID=gene199;Name=rpmC;gbkey=Gene;gene=rpmC;gene_biotype=protein_coding;locus_tag=TW215
BX072543.1	EMBL	CDS	248316	248555	.	+	0	ID=cds199;Parent=gene199;Dbxref=GOA:Q83I70,InterPro:IPR001854,NCBI_GP:CAD66892.1;Name=CAD66892.1;Note=Similar to Escherichia coli 50s ribosomal protein L29 RpmC or b3312 or z4683 or ecs4177 SWALL:RL29_ECOLI (SWALL:P02429) (63 aa) fasta scores: E(): 0.0011%2C 40%25 id in 60 aa%2C and to Streptomyces coelicolor 50s ribosomal protein L29 RpmC or SCO4710 or SCD31.35 SWALL:RL29_STRCO (SWALL:Q9L0D2) (74 aa) fasta scores: E(): 9.1e-12%2C 54.93%25 id in 71 aa;gbkey=CDS;gene=rpmC;product=50s ribosomal protein L29;protein_id=CAD66892.1;transl_table=11
BX072543.1	EMBL	sequence_feature	248340	248526	.	+	.	ID=id451;Note=Ribosomal L29 protein Score %3D 75.4 E-value %3D 8.4e-20;gbkey=misc_feature;gene=rpmC
BX072543.1	EMBL	gene	248552	248812	.	+	.	ID=gene200;Name=rpsQ;gbkey=Gene;gene=rpsQ;gene_biotype=protein_coding;locus_tag=TW216
BX072543.1	EMBL	CDS	248552	248812	.	+	0	ID=cds200;Parent=gene200;Dbxref=GOA:Q83I69,InterPro:IPR000266,InterPro:IPR012340,InterPro:IPR019979,InterPro:IPR019984,NCBI_GP:CAD66893.1;Name=CAD66893.1;Note=Similar to Escherichia coli 30s ribosomal protein S17 RpsQ or NeaA or b3311 or z4681 or ecs4176 SWALL:RS17_ECOLI (SWALL:P02373) (83 aa) fasta scores: E(): 2.3e-12%2C 49.35%25 id in 77 aa;gbkey=CDS;gene=rpsQ;product=30S ribosomal protein S17;protein_id=CAD66893.1;transl_table=11
BX072543.1	EMBL	sequence_feature	248588	248792	.	+	.	ID=id452;Note=Ribosomal protein S17 Score %3D 113.0 E-value %3D 4e-31;gbkey=misc_feature;gene=rpsQ
BX072543.1	EMBL	sequence_feature	248726	248764	.	+	.	ID=id453;Note=PS00056 Ribosomal protein S17 signature.;gbkey=misc_feature;gene=rpsQ
BX072543.1	EMBL	gene	248910	249281	.	+	.	ID=gene201;Name=rplN;gbkey=Gene;gene=rplN;gene_biotype=protein_coding;locus_tag=TW217
BX072543.1	EMBL	CDS	248910	249281	.	+	0	ID=cds201;Parent=gene201;Dbxref=GOA:Q83I68,InterPro:IPR000218,InterPro:IPR005745,InterPro:IPR019972,InterPro:IPR023571,NCBI_GP:CAD66894.1;Name=CAD66894.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L14 RplN SWALL:RL14_BACST (SWALL:P04450) (122 aa) fasta scores: E(): 1e-30%2C 72.35%25 id in 123 aa;gbkey=CDS;gene=rplN;product=50s ribosomal protein L14;protein_id=CAD66894.1;transl_table=11
BX072543.1	EMBL	sequence_feature	248910	249276	.	+	.	ID=id454;Note=Ribosomal protein L14p/L23e Score %3D 260.6 E-value %3D 1.4e-75;gbkey=misc_feature;gene=rplN
BX072543.1	EMBL	sequence_feature	249090	249170	.	+	.	ID=id455;Note=PS00049 Ribosomal protein L14 signature.;gbkey=misc_feature;gene=rplN
BX072543.1	EMBL	gene	249284	249625	.	+	.	ID=gene202;Name=rplX;gbkey=Gene;gene=rplX;gene_biotype=protein_coding;locus_tag=TW218
BX072543.1	EMBL	CDS	249284	249625	.	+	0	ID=cds202;Parent=gene202;Dbxref=GOA:Q83I67,InterPro:IPR003256,InterPro:IPR008991,InterPro:IPR014722,NCBI_GP:CAD66895.1;Name=CAD66895.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L24 RplX SWALL:RL24_BACST (SWALL:P04455) (103 aa) fasta scores: E(): 1.9e-11%2C 42.85%25 id in 112 aa;gbkey=CDS;gene=rplX;product=50S ribosomal protein L24;protein_id=CAD66895.1;transl_table=11
BX072543.1	EMBL	sequence_feature	249302	249382	.	+	.	ID=id456;Note=PS00052 Ribosomal protein S7 signature.;gbkey=misc_feature;gene=rplX
BX072543.1	EMBL	gene	249622	250173	.	+	.	ID=gene203;Name=rplE;gbkey=Gene;gene=rplE;gene_biotype=protein_coding;locus_tag=TW219
BX072543.1	EMBL	CDS	249622	250173	.	+	0	ID=cds203;Parent=gene203;Dbxref=GOA:Q83I66,InterPro:IPR002132,InterPro:IPR020930,InterPro:IPR022803,NCBI_GP:CAD66896.1;Name=CAD66896.1;Note=Similar to Escherichia coli 50s ribosomal protein L5 RplE or b3308 or z4678 or ecs4173 SWALL:RL5_ECOLI (SWALL:P02389) (178 aa) fasta scores: E(): 1.3e-37%2C 54.23%25 id in 177 aa;gbkey=CDS;gene=rplE;product=50S ribosomal protein L5;protein_id=CAD66896.1;transl_table=11
BX072543.1	EMBL	sequence_feature	249703	249871	.	+	.	ID=id457;Note=Ribosomal protein L5 Score %3D 98.0 E-value %3D 1.3e-26;gbkey=misc_feature;gene=rplE
BX072543.1	EMBL	sequence_feature	249883	250165	.	+	.	ID=id458;Note=ribosomal L5P family C-terminus Score %3D 177.5 E-value %3D 1.5e-50;gbkey=misc_feature;gene=rplE
BX072543.1	EMBL	gene	250203	250601	.	+	.	ID=gene204;Name=rpsH;gbkey=Gene;gene=rpsH;gene_biotype=protein_coding;locus_tag=TW220
BX072543.1	EMBL	CDS	250203	250601	.	+	0	ID=cds204;Parent=gene204;Dbxref=GOA:Q83I65,InterPro:IPR000630,NCBI_GP:CAD66897.1;Name=CAD66897.1;Note=Similar to Bacillus stearothermophilus 30s ribosomal protein S8 RpsH SWALL:RS8_BACST (SWALL:P56209) (130 aa) fasta scores: E(): 2.1e-25%2C 57.81%25 id in 128 aa;gbkey=CDS;gene=rpsH;product=30S ribosomal protein S8;protein_id=CAD66897.1;transl_table=11
BX072543.1	EMBL	sequence_feature	250215	250596	.	+	.	ID=id459;Note=Ribosomal protein S8 Score %3D 214.2 E-value %3D 1.4e-61;gbkey=misc_feature;gene=rpsH
BX072543.1	EMBL	sequence_feature	250506	250559	.	+	.	ID=id460;Note=PS00053 Ribosomal protein S8 signature.;gbkey=misc_feature;gene=rpsH
BX072543.1	EMBL	gene	250595	251140	.	+	.	ID=gene205;Name=rplF;gbkey=Gene;gene=rplF;gene_biotype=protein_coding;locus_tag=TW221
BX072543.1	EMBL	CDS	250595	251140	.	+	0	ID=cds205;Parent=gene205;Dbxref=GOA:Q83I64,InterPro:IPR000702,InterPro:IPR002358,InterPro:IPR019906,InterPro:IPR020040,NCBI_GP:CAD66898.1;Name=CAD66898.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L6 RplF SWALL:RL6_BACST (SWALL:P02391) (177 aa) fasta scores: E(): 1.3e-31%2C 54.8%25 id in 177 aa;gbkey=CDS;gene=rplF;product=50S ribosomal protein L6;protein_id=CAD66898.1;transl_table=11
BX072543.1	EMBL	sequence_feature	250634	250847	.	+	.	ID=id461;Note=Ribosomal protein L6 Score %3D 63.0 E-value %3D 4.5e-16;gbkey=misc_feature;gene=rplF
BX072543.1	EMBL	sequence_feature	250871	251096	.	+	.	ID=id462;Note=Ribosomal protein L6 Score %3D 85.9 E-value %3D 5.6e-23;gbkey=misc_feature;gene=rplF
BX072543.1	EMBL	sequence_feature	251063	251089	.	+	.	ID=id463;Note=PS00525 Ribosomal protein L6 signature 1.;gbkey=misc_feature;gene=rplF
BX072543.1	EMBL	gene	251137	251496	.	+	.	ID=gene206;Name=rplR;gbkey=Gene;gene=rplR;gene_biotype=protein_coding;locus_tag=TW222
BX072543.1	EMBL	CDS	251137	251496	.	+	0	ID=cds206;Parent=gene206;Dbxref=GOA:Q83I63,InterPro:IPR004389,InterPro:IPR005484,NCBI_GP:CAD66899.1;Name=CAD66899.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L18 RplR SWALL:RL18_BACST (SWALL:P09415) (120 aa) fasta scores: E(): 8.7e-20%2C 52.54%25 id in 118 aa;gbkey=CDS;gene=rplR;product=50S ribosomal protein L18;protein_id=CAD66899.1;transl_table=11
BX072543.1	EMBL	sequence_feature	251149	251491	.	+	.	ID=id464;Note=Ribosomal L18p/L5e family Score %3D 162.3 E-value %3D 5.9e-46;gbkey=misc_feature;gene=rplR
BX072543.1	EMBL	gene	251493	252353	.	+	.	ID=gene207;Name=rpsE;gbkey=Gene;gene=rpsE;gene_biotype=protein_coding;locus_tag=TW223
BX072543.1	EMBL	CDS	251493	252353	.	+	0	ID=cds207;Parent=gene207;Dbxref=GOA:Q83I62,InterPro:IPR000851,InterPro:IPR005324,InterPro:IPR005712,InterPro:IPR013810,InterPro:IPR014720,InterPro:IPR014721,InterPro:IPR018192,InterPro:IPR020568,NCBI_GP:CAD66900.1;Name=CAD66900.1;Note=Similar to Bacillus stearothermophilus 30s ribosomal protein S5 RpsE SWALL:RS5_BACST (SWALL:P02357) (166 aa) fasta scores: E(): 5.9e-26%2C 62.32%25 id in 146 aa. Has an unusually long N-terminal extension relative to homologues so may use a downstream alternative translational start site.;gbkey=CDS;gene=rpsE;product=30s ribosomal protein S5;protein_id=CAD66900.1;transl_table=11
BX072543.1	EMBL	sequence_feature	251829	252027	.	+	.	ID=id465;Note=Ribosomal protein S5%2C N-terminal domain Score %3D 136.6 E-value %3D 3.2e-38;gbkey=misc_feature;gene=rpsE
BX072543.1	EMBL	sequence_feature	251883	251981	.	+	.	ID=id466;Note=PS00585 Ribosomal protein S5 signature.;gbkey=misc_feature;gene=rpsE
BX072543.1	EMBL	sequence_feature	252054	252273	.	+	.	ID=id467;Note=Ribosomal protein S5%2C C-terminal domain Score %3D 126.0 E-value %3D 4.8e-35;gbkey=misc_feature;gene=rpsE
BX072543.1	EMBL	gene	252558	253001	.	+	.	ID=gene208;Name=rplO;gbkey=Gene;gene=rplO;gene_biotype=protein_coding;locus_tag=TW224
BX072543.1	EMBL	CDS	252558	253001	.	+	0	ID=cds208;Parent=gene208;Dbxref=GOA:Q83I61,InterPro:IPR005749,InterPro:IPR021131,NCBI_GP:CAD66901.1;Name=CAD66901.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L15 RplO SWALL:RL15_BACST (SWALL:P04452) (146 aa) fasta scores: E(): 3.1e-15%2C 44.75%25 id in 143 aa;gbkey=CDS;gene=rplO;product=50s ribosomal protein L15;protein_id=CAD66901.1;transl_table=11
BX072543.1	EMBL	sequence_feature	252567	252861	.	+	.	ID=id468;Note=Ribosomal protein L15 amino terminal region Score %3D 123.2 E-value %3D 3.4e-34;gbkey=misc_feature;gene=rplO
BX072543.1	EMBL	sequence_feature	252630	252653	.	+	.	ID=id469;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=rplO
BX072543.1	EMBL	sequence_feature	252885	252978	.	+	.	ID=id470;Note=Ribosomal protein L15 Score %3D 29.2 E-value %3D 7e-06;gbkey=misc_feature;gene=rplO
BX072543.1	EMBL	gene	253023	254348	.	+	.	ID=gene209;Name=secY;gbkey=Gene;gene=secY;gene_biotype=protein_coding;locus_tag=TW225
BX072543.1	EMBL	CDS	253023	254348	.	+	0	ID=cds209;Parent=gene209;Dbxref=GOA:Q83NQ1,InterPro:IPR002208,InterPro:IPR023201,InterPro:IPR026593,UniProtKB/TrEMBL:Q83NQ1,NCBI_GP:CAD66902.1;Name=CAD66902.1;Note=Similar to Streptomyces griseus preprotein translocase SecY subunit SWALL:SECY_STRGR (SWALL:Q59916) (437 aa) fasta scores: E(): 2.9e-97%2C 57.52%25 id in 445 aa;gbkey=CDS;gene=secY;product=preprotein translocase SecY subunit;protein_id=CAD66902.1;transl_table=11
BX072543.1	EMBL	sequence_feature	253023	253166	.	+	.	ID=id471;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.891) with cleavage site probability 0.399 between residues 48 and 49;gbkey=misc_feature;gene=secY
BX072543.1	EMBL	sequence_feature	253077	253145	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	253242	253310	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	253368	253436	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	253494	253562	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	253581	253649	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	253662	253730	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	253791	253859	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	253980	254048	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	254163	254231	.	+	.	ID=id472;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 74-96%2C 116-138%2C 158-180%2C 187-209%2C 214-236%2C 257-279%2C 320-342 and 381-403;gbkey=misc_feature;gene=secY;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	253239	254295	.	+	.	ID=id473;Note=eubacterial secY protein Score %3D 548.2 E-value %3D 3.8e-162;gbkey=misc_feature;gene=secY
BX072543.1	EMBL	sequence_feature	253239	253298	.	+	.	ID=id474;Note=PS00755 Protein secY signature 1.;gbkey=misc_feature;gene=secY
BX072543.1	EMBL	sequence_feature	253554	253610	.	+	.	ID=id475;Note=PS00756 Protein secY signature 2.;gbkey=misc_feature;gene=secY
BX072543.1	EMBL	gene	254348	254908	.	+	.	ID=gene210;Name=adk;gbkey=Gene;gene=adk;gene_biotype=protein_coding;locus_tag=TW226
BX072543.1	EMBL	CDS	254348	254908	.	+	0	ID=cds210;Parent=gene210;Dbxref=GOA:Q83I60,InterPro:IPR000850,InterPro:IPR027417,NCBI_GP:CAD66903.1;Name=CAD66903.1;Note=Similar to Xanthomonas campestris adenylate kinase Adk or Xcc3291 SWALL:AAM42561 (EMBL:AE012446) (187 aa) fasta scores: E(): 3.3e-21%2C 37.96%25 id in 187 aa%2C and to Homo sapiens adenylate kinase isoenzyme 1 Ak1 SWALL:KAD1_HUMAN (SWALL:P00568) (194 aa) fasta scores: E(): 3.7e-14%2C 32.78%25 id in 183 aa;gbkey=CDS;gene=adk;product=adenylate kinase;protein_id=CAD66903.1;transl_table=11
BX072543.1	EMBL	sequence_feature	254360	254825	.	+	.	ID=id476;Note=Adenylate kinase Score %3D 139.0 E-value %3D 5.8e-39;gbkey=misc_feature;gene=adk
BX072543.1	EMBL	sequence_feature	254576	254611	.	+	.	ID=id477;Note=PS00113 Adenylate kinase signature.;gbkey=misc_feature;gene=adk
BX072543.1	EMBL	gene	254911	255774	.	+	.	ID=gene211;Name=TW227;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW227
BX072543.1	EMBL	CDS	254911	255774	.	+	0	ID=cds211;Parent=gene211;Dbxref=GOA:Q83I59,InterPro:IPR001544,UniProtKB/TrEMBL:Q83I59,NCBI_GP:CAD66904.1;Name=CAD66904.1;Note=Similar to Bacillus licheniformis D-alanine aminotransferase Dat SWALL:DAAA_BACLI (SWALL:P54692) (283 aa) fasta scores: E(): 5.1e-11%2C 29.91%25 id in 244 aa;gbkey=CDS;product=putative aminotransferase;protein_id=CAD66904.1;transl_table=11
BX072543.1	EMBL	sequence_feature	254962	255757	.	+	.	ID=id478;Note=Aminotransferase class IV Score %3D 23.8 E-value %3D 2.5e-12;gbkey=misc_feature
BX072543.1	EMBL	gene	255844	256065	.	+	.	ID=gene212;Name=infA;gbkey=Gene;gene=infA;gene_biotype=protein_coding;locus_tag=TW228
BX072543.1	EMBL	CDS	255844	256065	.	+	0	ID=cds212;Parent=gene212;Dbxref=GOA:Q83I58,InterPro:IPR004368,InterPro:IPR006196,InterPro:IPR012340,InterPro:IPR022967,NCBI_GP:CAD66905.1;Name=CAD66905.1;Note=Similar to Escherichia coli translation initiation factor IF-1 InfA or b0884 or z1228 or ecs0969 or stm0953 or sty0951 SWALL:IF1_ECOLI (SWALL:P02998) (71 aa) fasta scores: E(): 3.7e-16%2C 65.27%25 id in 72 aa;gbkey=CDS;gene=infA;product=translation initiation factor IF-1;protein_id=CAD66905.1;transl_table=11
BX072543.1	EMBL	sequence_feature	255850	256060	.	+	.	ID=id479;Note=S1 RNA binding domain Score %3D 34.6 E-value %3D 1.6e-07;gbkey=misc_feature;gene=infA
BX072543.1	EMBL	sequence_feature	256021	256050	.	+	.	ID=id480;Note=PS00215 Mitochondrial energy transfer proteins signature.;gbkey=misc_feature;gene=infA
BX072543.1	EMBL	gene	256068	256187	.	+	.	ID=gene213;Name=rpmJ;gbkey=Gene;gene=rpmJ;gene_biotype=protein_coding;locus_tag=TW229
BX072543.1	EMBL	CDS	256068	256187	.	+	0	ID=cds213;Parent=gene213;Dbxref=GOA:Q83I57,InterPro:IPR000473,NCBI_GP:CAD66906.1;Name=CAD66906.1;Note=Similar to Thermus thermophilus 50s ribosomal protein L36 RpmJ or Rpl36 SWALL:RL36_THETH (SWALL:P80256) (37 aa) fasta scores: E(): 3.8e-10%2C 70.27%25 id in 37 aa;gbkey=CDS;gene=rpmJ;product=50S ribosomal protein L36;protein_id=CAD66906.1;transl_table=11
BX072543.1	EMBL	sequence_feature	256074	256182	.	+	.	ID=id481;Note=Ribosomal protein L36 Score %3D 62.1 E-value %3D 8.6e-16;gbkey=misc_feature;gene=rpmJ
BX072543.1	EMBL	sequence_feature	256104	256181	.	+	.	ID=id482;Note=PS00828 Ribosomal protein L36 signature.;gbkey=misc_feature;gene=rpmJ
BX072543.1	EMBL	gene	256222	256596	.	+	.	ID=gene214;Name=rpsM;gbkey=Gene;gene=rpsM;gene_biotype=protein_coding;locus_tag=TW230
BX072543.1	EMBL	CDS	256222	256596	.	+	0	ID=cds214;Parent=gene214;Dbxref=GOA:P66398,InterPro:IPR001892,InterPro:IPR010979,InterPro:IPR018269,InterPro:IPR019980,InterPro:IPR027437,NCBI_GP:CAD66907.1;Name=CAD66907.1;Note=Similar to Synechococcus sp. 30s ribosomal protein S13 RpsM or Rps13 SWALL:RS13_SYNP6 (SWALL:O24708) (125 aa) fasta scores: E(): 6.5e-27%2C 61.78%25 id in 123 aa;gbkey=CDS;gene=rpsM;product=30S ribosomal protein S13;protein_id=CAD66907.1;transl_table=11
BX072543.1	EMBL	sequence_feature	256228	256546	.	+	.	ID=id483;Note=Ribosomal protein S13/S18 Score %3D 166.5 E-value %3D 3.1e-47;gbkey=misc_feature;gene=rpsM
BX072543.1	EMBL	sequence_feature	256309	256341	.	+	.	ID=id484;Note=PS00639 Eukaryotic thiol (cysteine) proteases histidine active site.;gbkey=misc_feature;gene=rpsM
BX072543.1	EMBL	gene	256600	256992	.	+	.	ID=gene215;Name=rpsK;gbkey=Gene;gene=rpsK;gene_biotype=protein_coding;locus_tag=TW231
BX072543.1	EMBL	CDS	256600	256992	.	+	0	ID=cds215;Parent=gene215;Dbxref=GOA:P66366,InterPro:IPR001971,InterPro:IPR018102,InterPro:IPR019981,NCBI_GP:CAD66908.1;Name=CAD66908.1;Note=Similar to Escherichia coli 30s ribosomal protein S11 RpsK or b3297 or z4667 or ecs4162 SWALL:RS11_ECOLI (SWALL:P02366) (128 aa) fasta scores: E(): 7.1e-26%2C 56.69%25 id in 127 aa;gbkey=CDS;gene=rpsK;product=30S ribosomal protein S11;protein_id=CAD66908.1;transl_table=11
BX072543.1	EMBL	sequence_feature	256657	256984	.	+	.	ID=id485;Note=Ribosomal protein S11 Score %3D 226.0 E-value %3D 3.8e-65;gbkey=misc_feature;gene=rpsK
BX072543.1	EMBL	gene	257011	257994	.	+	.	ID=gene216;Name=rpoA;gbkey=Gene;gene=rpoA;gene_biotype=protein_coding;locus_tag=TW232
BX072543.1	EMBL	CDS	257011	257994	.	+	0	ID=cds216;Parent=gene216;Dbxref=GOA:Q820D8,InterPro:IPR009025,InterPro:IPR011260,InterPro:IPR011262,InterPro:IPR011263,InterPro:IPR011773,NCBI_GP:CAD66909.1;Name=CAD66909.1;Note=Similar to Streptomyces coelicolor DNA-directed RNA polymerase alpha chain RpoA or SCO4729 or SC6G4.07 SWALL:RPOA_STRCO (SWALL:P72404) (340 aa) fasta scores: E(): 9.7e-75%2C 63.91%25 id in 327 aa;gbkey=CDS;gene=rpoA;product=DNA-directed RNA polymerase alpha chain;protein_id=CAD66909.1;transl_table=11
BX072543.1	EMBL	sequence_feature	257062	257668	.	+	.	ID=id486;Note=Bacterial RNA polymerase%2C alpha chain%2C N terminal domain Score %3D 367.9 E-value %3D 7.6e-108;gbkey=misc_feature;gene=rpoA
BX072543.1	EMBL	sequence_feature	257632	257655	.	+	.	ID=id487;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=rpoA
BX072543.1	EMBL	sequence_feature	257719	257920	.	+	.	ID=id488;Note=Bacterial RNA polymerase%2C alpha chain C terminal domain Score %3D 115.3 E-value %3D 8.3e-32;gbkey=misc_feature;gene=rpoA
BX072543.1	EMBL	gene	258010	258549	.	+	.	ID=gene217;Name=rplQ;gbkey=Gene;gene=rplQ;gene_biotype=protein_coding;locus_tag=TW233
BX072543.1	EMBL	CDS	258010	258549	.	+	0	ID=cds217;Parent=gene217;Dbxref=GOA:Q83I55,InterPro:IPR000456,NCBI_GP:CAD66910.1;Name=CAD66910.1;Note=Similar to Bacillus stearothermophilus 50s ribosomal protein L17 RplQ SWALL:RL17_BACST (SWALL:P07843) (119 aa) fasta scores: E(): 3.8e-13%2C 47.7%25 id in 109 aa;gbkey=CDS;gene=rplQ;product=50S ribosomal protein L17;protein_id=CAD66910.1;transl_table=11
BX072543.1	EMBL	sequence_feature	258067	258355	.	+	.	ID=id489;Note=Ribosomal protein L17 Score %3D 130.0 E-value %3D 3e-36;gbkey=misc_feature;gene=rplQ
BX072543.1	EMBL	gene	258575	259378	.	+	.	ID=gene218;Name=truA;gbkey=Gene;gene=truA;gene_biotype=protein_coding;locus_tag=TW234
BX072543.1	EMBL	CDS	258575	259378	.	+	0	ID=cds218;Parent=gene218;Dbxref=GOA:Q820Z2,InterPro:IPR001406,InterPro:IPR020094,InterPro:IPR020095,InterPro:IPR020097,InterPro:IPR020103,NCBI_GP:CAD66911.1;Name=CAD66911.1;Note=Similar to Escherichia coli tRNA pseudouridine synthase A TruA or HisT or AsuC or LeuK or b2318 SWALL:TRUA_ECOLI (SWALL:P07649) (270 aa) fasta scores: E(): 5.1e-18%2C 32.27%25 id in 251 aa%2C and to Streptomyces coelicolor tRNA pseudouridine synthase A TruA or SCO4731 or SC6G4.09 SWALL:TRUA_STRCO (SWALL:O86776) (284 aa) fasta scores: E(): 4.5e-34%2C 40.59%25 id in 271 aa;gbkey=CDS;gene=truA;product=tRNA pseudouridine synthase A;protein_id=CAD66911.1;transl_table=11
BX072543.1	EMBL	sequence_feature	258596	258896	.	+	.	ID=id490;Note=tRNA pseudouridine synthase Score %3D 83.2 E-value %3D 3.9e-22;gbkey=misc_feature;gene=truA
BX072543.1	EMBL	sequence_feature	259016	259322	.	+	.	ID=id491;Note=tRNA pseudouridine synthase Score %3D 42.0 E-value %3D 9.3e-10;gbkey=misc_feature;gene=truA
BX072543.1	EMBL	gene	259491	260606	.	-	.	ID=gene219;Name=TW235;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW235
BX072543.1	EMBL	CDS	259491	260606	.	-	0	ID=cds219;Parent=gene219;Dbxref=GOA:Q83I54,InterPro:IPR002744,InterPro:IPR019591,InterPro:IPR025669,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I54,NCBI_GP:CAD66912.1;Name=CAD66912.1;Note=Similar to Mycobacterium tuberculosis Mrp protein homolog or rv1229c or mt1267 or mtci61.12c or mtv006.01C SWALL:MRP_MYCTU (SWALL:O33225) (381 aa) fasta scores: E(): 1.2e-45%2C 43.83%25 id in 365 aa;gbkey=CDS;product=putative MRP-family ATP-binding protein;protein_id=CAD66912.1;transl_table=11
BX072543.1	EMBL	sequence_feature	260207	260291	.	-	.	ID=id492;Note=4Fe-4S iron sulfur cluster binding proteins%2C NifH/frxC family Score %3D 24.8 E-value %3D 3.1e-07;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	260247	260270	.	-	.	ID=id493;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	260381	260603	.	-	.	ID=id494;Note=Domain of unknown function DUF59 Score %3D 54.4 E-value %3D 1.8e-13;gbkey=misc_feature
BX072543.1	EMBL	gene	260614	261108	.	-	.	ID=gene220;Name=TW236;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW236
BX072543.1	EMBL	CDS	260614	261108	.	-	0	ID=cds220;Parent=gene220;Dbxref=InterPro:IPR010406,UniProtKB/TrEMBL:Q83I53,NCBI_GP:CAD66913.1;Name=CAD66913.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv1231c or mtv006.03c or mt1269 SWALL:O86314 (EMBL:Z98260) (180 aa) fasta scores: E(): 1.4e-09%2C 39.25%25 id in 135 aa;gbkey=CDS;product=conserved hypothetical membrane protein;protein_id=CAD66913.1;transl_table=11
BX072543.1	EMBL	sequence_feature	260944	261012	.	-	.	ID=id495;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55 and 70-92;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	260833	260901	.	-	.	ID=id495;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 33-55 and 70-92;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	261095	262342	.	-	.	ID=gene221;Name=TW237;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW237
BX072543.1	EMBL	CDS	261095	262342	.	-	0	ID=cds221;Parent=gene221;Dbxref=GOA:Q83I52,InterPro:IPR000644,InterPro:IPR006668,UniProtKB/TrEMBL:Q83I52,NCBI_GP:CAD66914.1;Name=CAD66914.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5154 or SCP8.17c SWALL:Q9FBK4 (EMBL:AL390975) (433 aa) fasta scores: E(): 6.5e-37%2C 38.06%25 id in 423 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66914.1;transl_table=11
BX072543.1	EMBL	sequence_feature	261172	261331	.	-	.	ID=id496;Note=CBS domain Score %3D 37.5 E-value %3D 2.2e-08;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	261349	261538	.	-	.	ID=id497;Note=CBS domain Score %3D 22.5 E-value %3D 0.00068;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	261544	261925	.	-	.	ID=id498;Note=MgtE intracellular domain Score %3D 58.7 E-value %3D 8.8e-15;gbkey=misc_feature
BX072543.1	EMBL	gene	262339	263508	.	-	.	ID=gene222;Name=TW238;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW238
BX072543.1	EMBL	CDS	262339	263508	.	-	0	ID=cds222;Parent=gene222;Dbxref=GOA:Q83I51,InterPro:IPR000994,InterPro:IPR001131,InterPro:IPR007865,InterPro:IPR028980,InterPro:IPR029149,UniProtKB/TrEMBL:Q83I51,NCBI_GP:CAD66915.1;Name=CAD66915.1;Note=Similar to Streptomyces coelicolor Xaa-Pro aminopeptidase I PepP1 or SCO3970 or SCBAC25e3.07c SWALL:AMP1_STRCO (SWALL:Q05813) (490 aa) fasta scores: E(): 6.8e-55%2C 43.76%25 id in 409 aa%2C and to Escherichia coli Xaa-Pro aminopeptidase PepP or b2908 SWALL:AMPP_ECOLI (SWALL:P15034) (440 aa) fasta scores: E(): 1.9e-26%2C 35.63%25 id in 275 aa;gbkey=CDS;product=Xaa-Pro aminopeptidase;protein_id=CAD66915.1;transl_table=11
BX072543.1	EMBL	sequence_feature	262365	263142	.	-	.	ID=id499;Note=metallopeptidase family M24 Score %3D 185.4 E-value %3D 6.3e-53;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	262579	262617	.	-	.	ID=id500;Note=PS00491 Aminopeptidase P and proline dipeptidase signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	263951	264562	.	+	.	ID=gene223;Name=TW240;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW240
BX072543.1	EMBL	CDS	263951	264562	.	+	0	ID=cds223;Parent=gene223;Dbxref=UniProtKB/TrEMBL:Q83I50,NCBI_GP:CAD66916.1;Name=CAD66916.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66916.1;transl_table=11
BX072543.1	EMBL	gene	264653	264874	.	-	.	ID=gene224;Name=TW241;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW241
BX072543.1	EMBL	CDS	264653	264874	.	-	0	ID=cds224;Parent=gene224;Dbxref=InterPro:IPR021456,UniProtKB/TrEMBL:Q83I49,NCBI_GP:CAD66917.1;Name=CAD66917.1;Note=Similar to Corynebacterium glutamicum hypothetical protein Cgl0772 SWALL:BAB98165 (EMBL:AP005276) (75 aa) fasta scores: E(): 0.0016%2C 34.72%25 id in 72 aa%3B~No significant database matches;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66917.1;transl_table=11
BX072543.1	EMBL	gene	264900	267881	.	+	.	ID=gene225;Name=TW242;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW242
BX072543.1	EMBL	CDS	264900	267881	.	+	0	ID=cds225;Parent=gene225;Dbxref=GOA:Q83I48,InterPro:IPR000212,InterPro:IPR003593,InterPro:IPR014016,InterPro:IPR014017,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I48,NCBI_GP:CAD66918.1;Name=CAD66918.1;Note=Similar to Streptomyces coelicolor putative ATP-dependent DNA helicase SCO5183 or 2SC3B6.07 SWALL:Q9FCK5 (EMBL:AL390968) (1159 aa) fasta scores: E(): 2.7e-07%2C 24.49%25 id in 1139 aa;gbkey=CDS;product=putative ATP-dependent DNA helicase subunit;protein_id=CAD66918.1;transl_table=11
BX072543.1	EMBL	sequence_feature	264987	265010	.	+	.	ID=id501;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	267878	270799	.	+	.	ID=gene226;Name=TW243;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW243
BX072543.1	EMBL	CDS	267878	270799	.	+	0	ID=cds226;Parent=gene226;Dbxref=GOA:Q83I47,InterPro:IPR000212,InterPro:IPR011335,InterPro:IPR014016,InterPro:IPR014017,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I47,NCBI_GP:CAD66919.1;Name=CAD66919.1;Note=Similar to Streptomyces coelicolor putative ATP-dependent DNA helicase SCO5184 or 2SC3B6.08 SWALL:Q9FCK4 (EMBL:AL390968) (1222 aa) fasta scores: E(): 9.9e-16%2C 26.61%25 id in 1161 aa%2C and to Escherichia coli DNA helicase II UvrB or MutU or PdeB or Rad or Recl or b3813 SWALL:UVRD_ECOLI (SWALL:P03018) (720 aa) fasta scores: E(): 2.8e-09%2C 24.25%25 id in 800 aa;gbkey=CDS;product=putative ATP-dependent DNA helicase subunit;protein_id=CAD66919.1;transl_table=11
BX072543.1	EMBL	sequence_feature	267935	269465	.	+	.	ID=id502;Note=UvrD/REP helicase Score %3D 189.1 E-value %3D 4.8e-54;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	267992	268015	.	+	.	ID=id503;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	270823	271998	.	-	.	ID=gene227;Name=TW244;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW244
BX072543.1	EMBL	CDS	270823	271998	.	-	0	ID=cds227;Parent=gene227;Dbxref=GOA:Q83I46,InterPro:IPR011009,UniProtKB/TrEMBL:Q83I46,NCBI_GP:CAD66920.1;Name=CAD66920.1;Note=Weakly similar to Escherichia coli macrolide 2'-phosphotransferase I MphA SWALL:Q47396 (EMBL:D16251) (301 aa) fasta scores: E(): 1.4e-07%2C 26.1%25 id in 226 aa;gbkey=CDS;product=putative transferase;protein_id=CAD66920.1;transl_table=11
BX072543.1	EMBL	sequence_feature	271915	271998	.	-	.	ID=id504;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.931) with cleavage site probability 0.359 between residues 28 and 29;gbkey=misc_feature
BX072543.1	EMBL	gene	272079	273836	.	+	.	ID=gene228;Name=TW245;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW245
BX072543.1	EMBL	CDS	272079	273836	.	+	0	ID=cds228;Parent=gene228;Dbxref=GOA:Q83I45,InterPro:IPR000212,InterPro:IPR014016,InterPro:IPR014017,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I45,NCBI_GP:CAD66921.1;Name=CAD66921.1;Note=Similar to Streptomyces coelicolor putative ATP-dependent DNA helicase SCO5188 or 2SC3B6.12 SWALL:Q9FCK0 (EMBL:AL390968) (785 aa) fasta scores: E(): 2.7e-40%2C 35.14%25 id in 606 aa%2C and to Escherichia coli DNA helicase II UvrD or MutU or PdeB or Rad or Recl or b3813 SWALL:UVRD_ECOLI (SWALL:P03018) (720 aa) fasta scores: E(): 1.5e-19%2C 25.47%25 id in 636 aa;gbkey=CDS;product=putative ATP-dependent DNA helicase;protein_id=CAD66921.1;transl_table=11
BX072543.1	EMBL	sequence_feature	272103	273642	.	+	.	ID=id505;Note=UvrD/REP helicase Score %3D 125.7 E-value %3D 5.9e-35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	272160	272183	.	+	.	ID=id506;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	273875	275149	.	-	.	ID=gene229;Name=TW246;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW246
BX072543.1	EMBL	CDS	273875	275149	.	-	0	ID=cds229;Parent=gene229;Dbxref=InterPro:IPR018766,UniProtKB/TrEMBL:Q83I44,NCBI_GP:CAD66922.1;Name=CAD66922.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5199 or 2SC3B6.23c SWALL:Q9FCI9 (EMBL:AL390968) (487 aa) fasta scores: E(): 1.7e-38%2C 32.7%25 id in 425 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66922.1;transl_table=11
BX072543.1	EMBL	gene	275690	276775	.	+	.	ID=gene230;Name=ftsZ;gbkey=Gene;gene=ftsZ;gene_biotype=protein_coding;locus_tag=TW247
BX072543.1	EMBL	CDS	275690	276775	.	+	0	ID=cds230;Parent=gene230;Dbxref=GOA:Q83NQ0,InterPro:IPR000158,InterPro:IPR003008,InterPro:IPR008280,InterPro:IPR018316,InterPro:IPR020805,InterPro:IPR024757,UniProtKB/TrEMBL:Q83NQ0,NCBI_GP:CAD66923.1;Name=CAD66923.1;Note=Similar to Streptomyces coelicolor cell division protein FtsZ or SCO2082 or SC4A10.15c SWALL:FTSZ_STRCO (SWALL:P45500) (399 aa) fasta scores: E(): 4.9e-88%2C 77.28%25 id in 339 aa;gbkey=CDS;gene=ftsZ;product=cell division protein FtsZ;protein_id=CAD66923.1;transl_table=11
BX072543.1	EMBL	sequence_feature	275723	276302	.	+	.	ID=id507;Note=Tubulin/FtsZ family%2C GTPase domain Score %3D 293.0 E-value %3D 2.6e-85;gbkey=misc_feature;gene=ftsZ
BX072543.1	EMBL	sequence_feature	275819	275923	.	+	.	ID=id508;Note=PS01134 FtsZ protein signature 1.;gbkey=misc_feature;gene=ftsZ
BX072543.1	EMBL	sequence_feature	275978	276043	.	+	.	ID=id509;Note=PS01135 FtsZ protein signature 2.;gbkey=misc_feature;gene=ftsZ
BX072543.1	EMBL	sequence_feature	276308	276665	.	+	.	ID=id510;Note=Tubulin/FtsZ family%2C C-terminal domain Score %3D 110.2 E-value %3D 2.8e-30;gbkey=misc_feature;gene=ftsZ
BX072543.1	EMBL	gene	276892	277263	.	+	.	ID=gene231;Name=TW248;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW248
BX072543.1	EMBL	CDS	276892	277263	.	+	0	ID=cds231;Parent=gene231;Dbxref=GOA:Q83I43,InterPro:IPR007561,InterPro:IPR023052,NCBI_GP:CAD66924.1;Name=CAD66924.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1749 or 2SCI34.02 SWALL:Q9EWX7 (EMBL:AL445403) (146 aa) fasta scores: E(): 3.5e-07%2C 35.33%25 id in 133 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66924.1;transl_table=11
BX072543.1	EMBL	sequence_feature	277006	277243	.	+	.	ID=id511;Note=Protein of unknown function (DUF552) Score %3D 105.1 E-value %3D 9.9e-29;gbkey=misc_feature
BX072543.1	EMBL	gene	277348	277875	.	+	.	ID=gene232;Name=TW249;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW249
BX072543.1	EMBL	CDS	277348	277875	.	+	0	ID=cds232;Parent=gene232;Dbxref=GOA:Q83I42,InterPro:IPR007793,InterPro:IPR019933,UniProtKB/TrEMBL:Q83I42,NCBI_GP:CAD66925.1;Name=CAD66925.1;Note=Similar to Bacillus subtilis minicell-associated protein DivIVA SWALL:P71021 (EMBL:U60901) (164 aa) fasta scores: E(): 0.031%2C 27.32%25 id in 161 aa;gbkey=CDS;product=putative cell division protein;protein_id=CAD66925.1;transl_table=11
BX072543.1	EMBL	gene	277872	278324	.	+	.	ID=gene233;Name=lspA;gbkey=Gene;gene=lspA;gene_biotype=protein_coding;locus_tag=TW250
BX072543.1	EMBL	CDS	277872	278324	.	+	0	ID=cds233;Parent=gene233;Dbxref=GOA:Q83I41,InterPro:IPR001872,NCBI_GP:CAD66926.1;Name=CAD66926.1;Note=Similar to Staphylococcus aureus lipoprotein signal peptidase LspA or Lsp SWALL:LSPA_STAAU (SWALL:P31024) (163 aa) fasta scores: E(): 1.9e-07%2C 35.82%25 id in 134 aa%2C and to Bacillus halodurans lipoprotein signal peptidase LspA or Lsp or bh2543 SWALL:LSPA_BACHD (SWALL:Q9K9V2) (156 aa) fasta scores: E(): 3.5e-09%2C 36.48%25 id in 148 aa;gbkey=CDS;gene=lspA;product=lipoprotein signal peptidase;protein_id=CAD66926.1;transl_table=11
BX072543.1	EMBL	sequence_feature	277887	278319	.	+	.	ID=id512;Note=Signal peptidase (SPase) II Score %3D 51.6 E-value %3D 1.2e-12;gbkey=misc_feature;gene=lspA
BX072543.1	EMBL	sequence_feature	277896	277964	.	+	.	ID=id513;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 56-78%2C 85-104 and 124-146;gbkey=misc_feature;gene=lspA;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	278037	278105	.	+	.	ID=id513;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 56-78%2C 85-104 and 124-146;gbkey=misc_feature;gene=lspA;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	278124	278183	.	+	.	ID=id513;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 56-78%2C 85-104 and 124-146;gbkey=misc_feature;gene=lspA;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	278241	278309	.	+	.	ID=id513;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 56-78%2C 85-104 and 124-146;gbkey=misc_feature;gene=lspA;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	278405	279316	.	+	.	ID=gene234;Name=TW251;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW251
BX072543.1	EMBL	CDS	278405	279316	.	+	0	ID=cds234;Parent=gene234;Dbxref=GOA:Q83NP9,InterPro:IPR006145,InterPro:IPR006224,InterPro:IPR006225,InterPro:IPR020103,UniProtKB/TrEMBL:Q83NP9,NCBI_GP:CAD66927.1;Name=CAD66927.1;Note=Similar to Streptomyces coelicolor putative ribosomal large subunit pseudouridine synthase SCO2073 or SC4A10.06c SWALL:Q9S2X8 (EMBL:AL109663) (314 aa) fasta scores: E(): 2.5e-42%2C 49.55%25 id in 224 aa;gbkey=CDS;product=putative pseudouridine synthase;protein_id=CAD66927.1;transl_table=11
BX072543.1	EMBL	sequence_feature	278654	279107	.	+	.	ID=id514;Note=RNA pseudouridylate synthase Score %3D 184.6 E-value %3D 1.1e-52;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	278783	278827	.	+	.	ID=id515;Note=PS01129 Rlu family of pseudouridine synthase signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	279326	282820	.	+	.	ID=gene235;Name=dnaE;gbkey=Gene;gene=dnaE;gene_biotype=protein_coding;locus_tag=TW252
BX072543.1	EMBL	CDS	279326	282820	.	+	0	ID=cds235;Parent=gene235;Dbxref=GOA:Q83I40,InterPro:IPR003141,InterPro:IPR004013,InterPro:IPR004365,InterPro:IPR004805,InterPro:IPR011708,InterPro:IPR016195,InterPro:IPR029460,UniProtKB/TrEMBL:Q83I40,NCBI_GP:CAD66928.1;Name=CAD66928.1;Note=Similar to Escherichia coli DNA polymerase III alpha subunit DnaE or PolC or b0184 SWALL:DP3A_ECOLI (SWALL:P10443) (1160 aa) fasta scores: E(): 2.8e-112%2C 36.11%25 id in 1188 aa;gbkey=CDS;gene=dnaE;product=DNA polymerase III alpha subunit;protein_id=CAD66928.1;transl_table=11
BX072543.1	EMBL	sequence_feature	279347	279542	.	+	.	ID=id516;Note=PHP domain N-terminal region Score %3D 123.8 E-value %3D 2.2e-34;gbkey=misc_feature;gene=dnaE
BX072543.1	EMBL	sequence_feature	279623	280016	.	+	.	ID=id517;Note=PHP domain C-terminal region Score %3D 124.3 E-value %3D 1.6e-34;gbkey=misc_feature;gene=dnaE
BX072543.1	EMBL	sequence_feature	282332	282566	.	+	.	ID=id518;Note=OB-fold nucleic acid binding domain Score %3D 50.6 E-value %3D 2.5e-12;gbkey=misc_feature;gene=dnaE
BX072543.1	EMBL	tRNA	282872	282944	.	+	.	ID=rna11;Note=tRNA Glu anticodon CTC%2C Cove score 56.40;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	exon	282872	282944	.	+	.	ID=id519;Parent=rna11;Note=tRNA Glu anticodon CTC%2C Cove score 56.40;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	gene	283033	283935	.	+	.	ID=gene236;Name=TW253;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW253
BX072543.1	EMBL	CDS	283033	283935	.	+	0	ID=cds236;Parent=gene236;Dbxref=GOA:Q83NP8,InterPro:IPR005496,InterPro:IPR022369,UniProtKB/TrEMBL:Q83NP8,NCBI_GP:CAD66929.1;Name=CAD66929.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO0892 or SCM1.25c SWALL:Q9RD18 (EMBL:AL133422) (316 aa) fasta scores: E(): 8.5e-37%2C 42.12%25 id in 292 aa;gbkey=CDS;product=conserved integral membrane protein.;protein_id=CAD66929.1;transl_table=11
BX072543.1	EMBL	sequence_feature	283078	283143	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	283186	283254	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	283273	283341	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	283351	283404	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	283525	283584	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	283597	283665	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	283723	283782	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	283825	283893	.	+	.	ID=id520;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-28%2C 43-65%2C 72-94%2C 98-115%2C 156-175%2C 180-202%2C 222-241 and 256-278;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	283153	283891	.	+	.	ID=id521;Note=Integral membrane protein TerC family Score %3D 166.4 E-value %3D 3.5e-47;gbkey=misc_feature
BX072543.1	EMBL	gene	283980	285305	.	+	.	ID=gene237;Name=murA;gbkey=Gene;gene=murA;gene_biotype=protein_coding;locus_tag=TW254
BX072543.1	EMBL	CDS	283980	285305	.	+	0	ID=cds237;Parent=gene237;Dbxref=GOA:Q83I39,InterPro:IPR001986,InterPro:IPR005750,InterPro:IPR013792,UniProtKB/TrEMBL:Q83I39,NCBI_GP:CAD66930.1;Name=CAD66930.1;Note=Similar to Bacillus subtilis UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1 MurAa or MurA SWALL:MUA1_BACSU (SWALL:P70965) (436 aa) fasta scores: E(): 3.9e-41%2C 35.94%25 id in 434 aa%2C and to Streptomyces coelicolor UDP-N-acetylglucosamine transferase MurA or SCO2949 or SCE59.08 SWALL:Q9L1U5 (EMBL:AL138851) (448 aa) fasta scores: E(): 5e-102%2C 58.73%25 id in 441 aa;gbkey=CDS;gene=murA;product=UDP-N-acetylglucosamine 1-carboxyvinyltransferase;protein_id=CAD66930.1;transl_table=11
BX072543.1	EMBL	sequence_feature	284013	285273	.	+	.	ID=id522;Note=EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase) Score %3D 229.6 E-value %3D 3.2e-66;gbkey=misc_feature;gene=murA
BX072543.1	EMBL	sequence_feature	285195	285218	.	+	.	ID=id523;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=murA
BX072543.1	EMBL	gene	285371	286027	.	+	.	ID=gene238;Name=TW255;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW255
BX072543.1	EMBL	CDS	285371	286027	.	+	0	ID=cds238;Parent=gene238;Dbxref=GOA:Q83I38,InterPro:IPR002123,UniProtKB/TrEMBL:Q83I38,NCBI_GP:CAD66931.1;Name=CAD66931.1;Note=Similar to Mycobacterium tuberculosis hypothetical 27.0 kDa protein Rv2182c or mtv021.15c or mt2237 SWALL:O53516 (EMBL:AL021957) (247 aa) fasta scores: E(): 6.9e-07%2C 26.92%25 id in 208 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66931.1;transl_table=11
BX072543.1	EMBL	sequence_feature	285389	285968	.	+	.	ID=id524;Note=Acyltransferase Score %3D 77.5 E-value %3D 1.9e-20;gbkey=misc_feature
BX072543.1	EMBL	gene	286002	286979	.	+	.	ID=gene239;Name=gpsA;gbkey=Gene;gene=gpsA;gene_biotype=protein_coding;locus_tag=TW256
BX072543.1	EMBL	CDS	286002	286979	.	+	0	ID=cds239;Parent=gene239;Dbxref=GOA:Q83I37,InterPro:IPR006109,InterPro:IPR006168,InterPro:IPR008927,InterPro:IPR011128,InterPro:IPR013328,InterPro:IPR016040,NCBI_GP:CAD66932.1;Name=CAD66932.1;Note=Similar to Bacillus subtilis glycerol-3-phosphate dehydrogenase GpsA or GlyC SWALL:GPDA_BACSU (SWALL:P46919) (345 aa) fasta scores: E(): 1.2e-31%2C 36.94%25 id in 314 aa%2C and to Streptomyces coelicolor glycerol-3-phosphate dehydrogenase GpsA or SCO5559 or SC7A1.03 SWALL:GPDA_STRCO (SWALL:Q9ZBS0) (336 aa) fasta scores: E(): 1.6e-39%2C 43.59%25 id in 312 aa;gbkey=CDS;gene=gpsA;product=glycerol-3-phosphate dehydrogenase;protein_id=CAD66932.1;transl_table=11
BX072543.1	EMBL	sequence_feature	286020	286962	.	+	.	ID=id525;Note=NAD-dependent glycerol-3-phosphate dehydrogenase Score %3D 324.5 E-value %3D 8.9e-95;gbkey=misc_feature;gene=gpsA
BX072543.1	EMBL	gene	286979	288022	.	+	.	ID=gene240;Name=ddlA;gbkey=Gene;gene=ddlA;gene_biotype=protein_coding;locus_tag=TW257
BX072543.1	EMBL	CDS	286979	288022	.	+	0	ID=cds240;Parent=gene240;Dbxref=GOA:Q83I36,InterPro:IPR000291,InterPro:IPR005905,InterPro:IPR011095,InterPro:IPR011127,InterPro:IPR011761,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,NCBI_GP:CAD66933.1;Name=CAD66933.1;Note=Similar to Escherichia coli%2C and Escherichia coli O157:H7 D-alanine--D-alanine ligase A DdlA or b0381 or z0477 or ecs0431 SWALL:DDLA_ECOLI (SWALL:P23844) (364 aa) fasta scores: E(): 5.1e-32%2C 32.86%25 id in 353 aa;gbkey=CDS;gene=ddlA;product=D-alanine--D-alanine ligase A;protein_id=CAD66933.1;transl_table=11
BX072543.1	EMBL	sequence_feature	286979	287993	.	+	.	ID=id526;Note=D-ala D-ala ligase Score %3D 313.1 E-value %3D 2.4e-91;gbkey=misc_feature;gene=ddlA
BX072543.1	EMBL	sequence_feature	287276	287311	.	+	.	ID=id527;Note=PS00843 D-alanine--D-alanine ligase signature 1.;gbkey=misc_feature;gene=ddlA
BX072543.1	EMBL	gene	288036	288500	.	-	.	ID=gene241;Name=TW258;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW258
BX072543.1	EMBL	CDS	288036	288500	.	-	0	ID=cds241;Parent=gene241;Dbxref=InterPro:IPR021903,UniProtKB/TrEMBL:Q83I35,NCBI_GP:CAD66934.1;Name=CAD66934.1;Note=Weakly similar to Streptomyces coelicolor hypothetical protein SCO3628 or SCH10.06c SWALL:Q9X8P5 (EMBL:AL049754) (163 aa) fasta scores: E(): 3.8e-07%2C 32.79%25 id in 125 aa;gbkey=CDS;product=conserved hypothetical lipoprotein;protein_id=CAD66934.1;transl_table=11
BX072543.1	EMBL	sequence_feature	288408	288500	.	-	.	ID=id528;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.997) with cleavage site probability 0.910 between residues 44 and 45;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	288441	288473	.	-	.	ID=id529;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	288527	289912	.	-	.	ID=gene242;Name=TW259;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW259
BX072543.1	EMBL	CDS	288527	289912	.	-	0	ID=cds242;Parent=gene242;Dbxref=GOA:Q83I34,InterPro:IPR000089,InterPro:IPR001078,InterPro:IPR003016,InterPro:IPR004167,InterPro:IPR011053,InterPro:IPR014276,InterPro:IPR023213,UniProtKB/TrEMBL:Q83I34,NCBI_GP:CAD66935.1;Name=CAD66935.1;Note=Similar to Bacillus subtilis lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex BfmB SWALL:ODB2_BACSU (SWALL:P37942) (424 aa) fasta scores: E(): 1.6e-33%2C 34.64%25 id in 459 aa%2C and to Streptomyces seoulensis dihydrolipoamide acetyltransferase PdhB SWALL:Q9Z6I4 (EMBL:AF047034) (612 aa) fasta scores: E(): 1.3e-48%2C 41.3%25 id in 477 aa;gbkey=CDS;product=putative lipoamide acyltransferase;protein_id=CAD66935.1;transl_table=11
BX072543.1	EMBL	sequence_feature	288550	289234	.	-	.	ID=id530;Note=2-oxo acid dehydrogenases acyltransferase (catalytic domain) Score %3D 345.2 E-value %3D 4.9e-101;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	289333	289447	.	-	.	ID=id531;Note=e3 binding domain Score %3D 55.3 E-value %3D 9.7e-14;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	289687	289906	.	-	.	ID=id532;Note=Biotin-requiring enzyme Score %3D 86.1 E-value %3D 5.2e-23;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	289745	289834	.	-	.	ID=id533;Note=PS00189 2-oxo acid dehydrogenases acyltransferase component lipoyl binding site.;gbkey=misc_feature
BX072543.1	EMBL	gene	290066	291418	.	-	.	ID=gene243;Name=acoL;gbkey=Gene;gene=acoL;gene_biotype=protein_coding;locus_tag=TW260
BX072543.1	EMBL	CDS	290066	291418	.	-	0	ID=cds243;Parent=gene243;Dbxref=GOA:Q83I33,InterPro:IPR001327,InterPro:IPR004099,InterPro:IPR006258,InterPro:IPR012999,InterPro:IPR013027,InterPro:IPR016156,InterPro:IPR023753,UniProtKB/TrEMBL:Q83I33,NCBI_GP:CAD66936.1;Name=CAD66936.1;Note=Similar to Bacillus subtilis dihydrolipoamide dehydrogenase AcoL SWALL:DLD3_BACSU (SWALL:O34324) (458 aa) fasta scores: E(): 2.9e-46%2C 35.07%25 id in 459 aa;gbkey=CDS;gene=acoL;product=dihydrolipoamide dehydrogenase;protein_id=CAD66936.1;transl_table=11
BX072543.1	EMBL	sequence_feature	290104	290431	.	-	.	ID=id534;Note=Pyridine nucleotide-disulphide oxidoreductase%2C dimerisation domain Score %3D 126.5 E-value %3D 3.6e-35;gbkey=misc_feature;gene=acoL
BX072543.1	EMBL	sequence_feature	290506	291409	.	-	.	ID=id535;Note=Pyridine nucleotide-disulphide oxidoreductase Score %3D 273.2 E-value %3D 2.3e-79;gbkey=misc_feature;gene=acoL
BX072543.1	EMBL	sequence_feature	291278	291310	.	-	.	ID=id536;Note=PS00076 Pyridine nucleotide-disulphide oxidoreductases class-I active site.;gbkey=misc_feature;gene=acoL
BX072543.1	EMBL	gene	291425	292933	.	-	.	ID=gene244;Name=TW261;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW261
BX072543.1	EMBL	CDS	291425	292933	.	-	0	ID=cds244;Parent=gene244;Dbxref=GOA:Q83I32,InterPro:IPR000819,InterPro:IPR008283,InterPro:IPR011356,InterPro:IPR023042,NCBI_GP:CAD66937.1;Name=CAD66937.1;Note=Similar to Rickettsia prowazekii cytosol aminopeptidase PepA or Rp142 SWALL:AMPA_RICPR (SWALL:P27888) (500 aa) fasta scores: E(): 5.4e-43%2C 35.72%25 id in 459 aa;gbkey=CDS;product=putative aminopeptidase;protein_id=CAD66937.1;transl_table=11
BX072543.1	EMBL	sequence_feature	291472	292423	.	-	.	ID=id537;Note=Cytosol aminopeptidase family%2C catalytic domain Score %3D 408.1 E-value %3D 5.7e-120;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	291911	291934	.	-	.	ID=id538;Note=PS00631 Cytosol aminopeptidase signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	292528	292864	.	-	.	ID=id539;Note=Cytosol aminopeptidase family%2C N-terminal domain Score %3D 25.8 E-value %3D 6.8e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	293012	296086	.	-	.	ID=gene245;Name=glyQS;gbkey=Gene;gene=glyQS;gene_biotype=protein_coding;locus_tag=TW262
BX072543.1	EMBL	CDS	293012	296086	.	-	0	ID=cds245;Parent=gene245;Dbxref=GOA:Q83I31,InterPro:IPR002310,InterPro:IPR006194,InterPro:IPR015944,UniProtKB/TrEMBL:Q83I31,NCBI_GP:CAD66938.1;Name=CAD66938.1;Note=Similar to Chlamydia pneumoniae glycyl-tRNA synthetase GlyQS or GlyQ or cpn0946 or cp0913 SWALL:SYG_CHLPN (SWALL:Q9Z6W0) (1010 aa) fasta scores: E(): 8.9e-78%2C 30.52%25 id in 1055 aa%2C and to Arabidopsis thaliana aminoacyl-t-RNA synthetase precursor Edd1 SWALL:O23150 (EMBL:AJ003069) (1067 aa) fasta scores: E(): 1.1e-100%2C 39.47%25 id in 1021 aa;gbkey=CDS;gene=glyQS;product=glycyl-tRNA synthetase;protein_id=CAD66938.1;transl_table=11
BX072543.1	EMBL	sequence_feature	293404	295129	.	-	.	ID=id540;Note=Glycyl-tRNA synthetase beta subunit Score %3D 342.0 E-value %3D 4.7e-100;gbkey=misc_feature;gene=glyQS
BX072543.1	EMBL	sequence_feature	293786	293809	.	-	.	ID=id541;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=glyQS
BX072543.1	EMBL	sequence_feature	295216	296065	.	-	.	ID=id542;Note=Glycyl-tRNA synthetase alpha subunit Score %3D 579.1 E-value %3D 1.9e-171;gbkey=misc_feature;gene=glyQS
BX072543.1	EMBL	gene	296144	297307	.	+	.	ID=gene246;Name=hrdB;gbkey=Gene;gene=hrdB;gene_biotype=protein_coding;locus_tag=TW263
BX072543.1	EMBL	CDS	296144	297307	.	+	0	ID=cds246;Parent=gene246;Dbxref=GOA:Q83NP7,InterPro:IPR000943,InterPro:IPR007624,InterPro:IPR007627,InterPro:IPR007630,InterPro:IPR009042,InterPro:IPR011991,InterPro:IPR012760,InterPro:IPR013324,InterPro:IPR013325,InterPro:IPR014284,InterPro:IPR028630,UniProtKB/TrEMBL:Q83NP7,NCBI_GP:CAD66939.1;Name=CAD66939.1;Note=Similar to Streptomyces coelicolor RNA polymerase principal sigma factor HrdB or SCO5820 or SC5B8.10 SWALL:HRDB_STRCO (SWALL:P18183) (511 aa) fasta scores: E(): 2.2e-90%2C 68.31%25 id in 385 aa;gbkey=CDS;gene=hrdB;product=RNA polymerase principal sigma factor hrdb;protein_id=CAD66939.1;transl_table=11
BX072543.1	EMBL	sequence_feature	296405	296513	.	+	.	ID=id543;Note=Sigma-70 factor%2C region 1.2 Score %3D 68.6 E-value %3D 9.5e-18;gbkey=misc_feature;gene=hrdB
BX072543.1	EMBL	sequence_feature	296603	296813	.	+	.	ID=id544;Note=Sigma-70 region 2 Score %3D 103.3 E-value %3D 3.3e-28;gbkey=misc_feature;gene=hrdB
BX072543.1	EMBL	sequence_feature	296675	296716	.	+	.	ID=id545;Note=PS00715 Sigma-70 factors family signature 1.;gbkey=misc_feature;gene=hrdB
BX072543.1	EMBL	sequence_feature	296825	297071	.	+	.	ID=id546;Note=Sigma-70 region 3 Score %3D 143.0 E-value %3D 3.8e-40;gbkey=misc_feature;gene=hrdB
BX072543.1	EMBL	sequence_feature	297107	297266	.	+	.	ID=id547;Note=Sigma-70%2C region 4 Score %3D 70.7 E-value %3D 2.2e-18;gbkey=misc_feature;gene=hrdB
BX072543.1	EMBL	gene	297309	298694	.	+	.	ID=gene247;Name=TW264;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW264
BX072543.1	EMBL	CDS	297309	298694	.	+	0	ID=cds247;Parent=gene247;Dbxref=GOA:Q820Z1,InterPro:IPR013221,InterPro:IPR013564,UniProtKB/TrEMBL:Q820Z1,NCBI_GP:CAD66940.1;Name=CAD66940.1;Note=Similar to Mycobacterium tuberculosis hypothetical 43.4 kDa protein Rv3712 or mtv025.060 or mt3815 SWALL:O69679 (EMBL:AL022121) (413 aa) fasta scores: E(): 1.4e-18%2C 31.18%25 id in 388 aa. Weak similarity to murein ligases.;gbkey=CDS;product=conserved hypothetical protein (possible murein ligase);protein_id=CAD66940.1;transl_table=11
BX072543.1	EMBL	sequence_feature	297453	297708	.	+	.	ID=id548;Note=Mur ligase family%2C catalytic domain Score %3D 28.9 E-value %3D 1.3e-08;gbkey=misc_feature
BX072543.1	EMBL	gene	298685	299464	.	+	.	ID=gene248;Name=TW265;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW265
BX072543.1	EMBL	CDS	298685	299464	.	+	0	ID=cds248;Parent=gene248;Dbxref=GOA:Q83I30,InterPro:IPR011698,InterPro:IPR017929,InterPro:IPR029062,UniProtKB/TrEMBL:Q83I30,NCBI_GP:CAD66941.1;Name=CAD66941.1;Note=Weakly similar to many eg. Staphylococcus aureus hypothetical protein sav1891 sav1891 or sa1707 or mw1832 SWALL:Q99SZ5 (EMBL:AP003363) (243 aa) fasta scores: E(): 9e-10%2C 25.12%25 id in 203 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66941.1;transl_table=11
BX072543.1	EMBL	gene	299448	300608	.	-	.	ID=gene249;Name=alr1;gbkey=Gene;gene=alr1;gene_biotype=protein_coding;locus_tag=TW266
BX072543.1	EMBL	CDS	299448	300608	.	-	0	ID=cds249;Parent=gene249;Dbxref=GOA:Q83I29,InterPro:IPR000821,InterPro:IPR001608,InterPro:IPR029066,UniProtKB/TrEMBL:Q83I29,NCBI_GP:CAD66942.1;Name=CAD66942.1;Note=Provides the d-alanine required for cell wall biosynthesis. Similar to Streptomyces coelicolor alanine racemase Alr or SCO4745 or SC6G4.23 SWALL:ALR_STRCO (SWALL:O86786) (391 aa) fasta scores: E(): 1.2e-19%2C 29.5%25 id in 400 aa%2C and to Lactobacillus plantarum alanine racemase Alr SWALL:ALR_LACPL (SWALL:O08445) (375 aa) fasta scores: E(): 0.0001%2C 24.13%25 id in 377 aa;gbkey=CDS;gene=alr1;product=alanine racemase I;protein_id=CAD66942.1;transl_table=11
BX072543.1	EMBL	sequence_feature	299462	300503	.	-	.	ID=id549;Note=Alanine racemase Score %3D -93.7 E-value %3D 8e-08;gbkey=misc_feature;gene=alr1
BX072543.1	EMBL	gene	300658	301320	.	-	.	ID=gene250;Name=alr2;gbkey=Gene;gene=alr2;gene_biotype=protein_coding;locus_tag=TW267
BX072543.1	EMBL	CDS	300658	301320	.	-	0	ID=cds250;Parent=gene250;Dbxref=GOA:Q83I28,InterPro:IPR009006,InterPro:IPR011079,InterPro:IPR029066,UniProtKB/TrEMBL:Q83I28,NCBI_GP:CAD66943.1;Name=CAD66943.1;Note=Provides the d-alanine required for cell wall biosynthesis. Similar to the C-terminal region of alanine racemases eg. Corynebacterium glutamicum alanine racemase Alr or cgl0588 SWALL:BAB97981 (EMBL:AY077456) (361 aa) fasta scores: E(): 1.8e-07%2C 34.82%25 id in 112 aa.;gbkey=CDS;gene=alr2;product=alanine racemase II;protein_id=CAD66943.1;transl_table=11
BX072543.1	EMBL	sequence_feature	300666	301317	.	-	.	ID=id550;Note=Alanine racemase Score %3D -136.6 E-value %3D 8.7e-06;gbkey=misc_feature;gene=alr2
BX072543.1	EMBL	gene	301377	303365	.	+	.	ID=gene251;Name=gyrB2;gbkey=Gene;gene=gyrB2;gene_biotype=protein_coding;locus_tag=TW268
BX072543.1	EMBL	CDS	301377	303365	.	+	0	ID=cds251;Parent=gene251;Dbxref=GOA:Q83I27,InterPro:IPR001241,InterPro:IPR002288,InterPro:IPR003594,InterPro:IPR006171,InterPro:IPR013506,InterPro:IPR013759,InterPro:IPR013760,InterPro:IPR014721,InterPro:IPR018522,InterPro:IPR020568,UniProtKB/TrEMBL:Q83I27,NCBI_GP:CAD66944.1;Name=CAD66944.1;Note=Similar to Streptomyces sphaeroides DNA gyrase subunit B%2C novobiocin-sensitive GyrBS SWALL:GYBS_STRSH (SWALL:P50075) (684 aa) fasta scores: E(): 1.7e-98%2C 43%25 id in 665 aa;gbkey=CDS;gene=gyrB2;product=DNA gyrase subunit B;protein_id=CAD66944.1;transl_table=11
BX072543.1	EMBL	sequence_feature	301470	301902	.	+	.	ID=id551;Note=Histidine kinase-%2C DNA gyrase B-%2C and HSP90-like ATPase Score %3D 81.0 E-value %3D 1.7e-21;gbkey=misc_feature;gene=gyrB2
BX072543.1	EMBL	sequence_feature	302040	302616	.	+	.	ID=id552;Note=DNA gyrase B Score %3D 116.2 E-value %3D 4.4e-32;gbkey=misc_feature;gene=gyrB2
BX072543.1	EMBL	sequence_feature	302709	302735	.	+	.	ID=id553;Note=PS00177 DNA topoisomerase II signature.;gbkey=misc_feature;gene=gyrB2
BX072543.1	EMBL	sequence_feature	302787	303030	.	+	.	ID=id554;Note=Toprim domain Score %3D 29.8 E-value %3D 4.5e-06;gbkey=misc_feature;gene=gyrB2
BX072543.1	EMBL	sequence_feature	303138	303327	.	+	.	ID=id555;Note=DNA gyrase B subunit%2C carboxyl terminus Score %3D 111.5 E-value %3D 1.1e-30;gbkey=misc_feature;gene=gyrB2
BX072543.1	EMBL	pseudogene	303376	305618	.	-	.	ID=gene252;Name=ptrB;gbkey=Gene;gene=ptrB;gene_biotype=pseudogene;locus_tag=TW269;pseudo=true
BX072543.1	EMBL	CDS	305334	305618	.	-	0	ID=cds252;Parent=gene252;Note=Pseudogene. Similar to Escherichia coli protease II PtrB or Tlp or b1845 SWALL:PTRB_ECOLI (SWALL:P24555) (686 aa) fasta scores: E(): 9.4e-45%2C 30.41%25 id in 720 aa%2C and to Moraxella lacunata protease II PtrB SWALL:PTRB_MORLA (SWALL:Q59536) (690 aa) fasta scores: E(): 1.2e-52%2C 33.6%25 id in 729 aa;gbkey=CDS;gene=ptrB;product=protease ii;pseudo=true;transl_table=11
BX072543.1	EMBL	CDS	303376	305334	.	-	0	ID=cds252;Parent=gene252;Note=Pseudogene. Similar to Escherichia coli protease II PtrB or Tlp or b1845 SWALL:PTRB_ECOLI (SWALL:P24555) (686 aa) fasta scores: E(): 9.4e-45%2C 30.41%25 id in 720 aa%2C and to Moraxella lacunata protease II PtrB SWALL:PTRB_MORLA (SWALL:Q59536) (690 aa) fasta scores: E(): 1.2e-52%2C 33.6%25 id in 729 aa;gbkey=CDS;gene=ptrB;product=protease ii;pseudo=true;transl_table=11
BX072543.1	EMBL	sequence_feature	303801	304038	.	-	.	ID=id556;Note=Prolyl oligopeptidase family Score %3D 107.4 E-value %3D 2e-29;gbkey=misc_feature;gene=ptrB
BX072543.1	EMBL	sequence_feature	304497	304881	.	-	.	ID=id557;Note=Prolyl oligopeptidase%2C N-terminal beta-propeller domain Score %3D 59.2 E-value %3D 3.6e-18;gbkey=misc_feature;gene=ptrB
BX072543.1	EMBL	sequence_feature	305348	305534	.	-	.	ID=id558;Note=Prolyl oligopeptidase%2C N-terminal beta-propeller domain Score %3D 26.6 E-value %3D 2.1e-08;gbkey=misc_feature;gene=ptrB
BX072543.1	EMBL	tRNA	305818	305891	.	+	.	ID=rna12;Note=tRNA Ala anticodon CGC%2C Cove score 74.59;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	exon	305818	305891	.	+	.	ID=id559;Parent=rna12;Note=tRNA Ala anticodon CGC%2C Cove score 74.59;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	gene	305928	307358	.	+	.	ID=gene253;Name=gnd;gbkey=Gene;gene=gnd;gene_biotype=protein_coding;locus_tag=TW272
BX072543.1	EMBL	CDS	305928	307358	.	+	0	ID=cds253;Parent=gene253;Dbxref=GOA:Q83I26,InterPro:IPR006113,InterPro:IPR006114,InterPro:IPR006115,InterPro:IPR008927,InterPro:IPR012284,InterPro:IPR013328,InterPro:IPR016040,UniProtKB/TrEMBL:Q83I26,NCBI_GP:CAD66946.1;Name=CAD66946.1;Note=Similar to Escherichia coli 6-phosphogluconate dehydrogenase%2C decarboxylating Gnd or b2029 SWALL:6PGD_ECOLI (SWALL:P00350) (468 aa) fasta scores: E(): 1.8e-86%2C 49.57%25 id in 468 aa;gbkey=CDS;gene=gnd;product=6-phosphogluconate dehydrogenase%2C decarboxylating;protein_id=CAD66946.1;transl_table=11
BX072543.1	EMBL	sequence_feature	305931	306444	.	+	.	ID=id560;Note=NAD binding domain of 6-phosphogluconate dehydrogenase Score %3D 261.6 E-value %3D 7.5e-76;gbkey=misc_feature;gene=gnd
BX072543.1	EMBL	sequence_feature	306450	307329	.	+	.	ID=id561;Note=6-phosphogluconate dehydrogenase%2C C-terminal domain Score %3D 442.0 E-value %3D 3.8e-130;gbkey=misc_feature;gene=gnd
BX072543.1	EMBL	gene	307631	310096	.	-	.	ID=gene254;Name=gyrA1;gbkey=Gene;gene=gyrA1;gene_biotype=protein_coding;locus_tag=TW273
BX072543.1	EMBL	CDS	307631	310096	.	-	0	ID=cds254;Parent=gene254;Dbxref=GOA:Q83I25,InterPro:IPR002205,InterPro:IPR006691,InterPro:IPR013758,InterPro:IPR013760,InterPro:IPR024946,UniProtKB/TrEMBL:Q83I25,NCBI_GP:CAD66947.1;Name=CAD66947.1;Note=Similar to Clostridium acetobutylicum DNA gyrase subunit A GyrA or cac0007 SWALL:GYRA_CLOAB (SWALL:P94605) (830 aa) fasta scores: E(): 7.6e-93%2C 36.54%25 id in 799 aa;gbkey=CDS;gene=gyrA1;product=DNA gyrase subunit A;protein_id=CAD66947.1;transl_table=11
BX072543.1	EMBL	sequence_feature	307969	308119	.	-	.	ID=id562;Note=DNA gyrase C-terminal domain%2C beta-propeller Score %3D 25.5 E-value %3D 9.1e-05;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	sequence_feature	308632	309973	.	-	.	ID=id563;Note=DNA gyrase/topoisomerase IV%2C subunit A Score %3D 715.1 E-value %3D 2.2e-212;gbkey=misc_feature;gene=gyrA1
BX072543.1	EMBL	gene	310102	311025	.	-	.	ID=gene255;Name=TW274;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW274
BX072543.1	EMBL	CDS	310102	311025	.	-	0	ID=cds255;Parent=gene255;Dbxref=GOA:Q83I24,InterPro:IPR021421,UniProtKB/TrEMBL:Q83I24,NCBI_GP:CAD66948.1;Name=CAD66948.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5855 or SC9B10.22c SWALL:O50529 (EMBL:AL009204) (352 aa) fasta scores: E(): 0.00048%2C 28.57%25 id in 350 aa;gbkey=CDS;product=conserved DNA-binding protein;protein_id=CAD66948.1;transl_table=11
BX072543.1	EMBL	sequence_feature	310765	310830	.	-	.	ID=id564;Note=Predicted helix-turn-helix motif with score 1162.000%2C SD 3.14 at aa 79-100%2C sequence LPAEKVAQKLSTSIERVKRFEP;gbkey=misc_feature
BX072543.1	EMBL	gene	311166	311444	.	+	.	ID=gene256;Name=TW275;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW275
BX072543.1	EMBL	CDS	311166	311444	.	+	0	ID=cds256;Parent=gene256;Dbxref=InterPro:IPR025242,UniProtKB/TrEMBL:Q83I23,NCBI_GP:CAD66949.1;Name=CAD66949.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5864 or SC2E9.05 SWALL:O54130 (EMBL:AL021530) (98 aa) fasta scores: E(): 8.6e-13%2C 49.48%25 id in 97 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66949.1;transl_table=11
BX072543.1	EMBL	gene	311511	311978	.	-	.	ID=gene257;Name=TW276;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW276
BX072543.1	EMBL	CDS	311511	311978	.	-	0	ID=cds257;Parent=gene257;Dbxref=InterPro:IPR021443,UniProtKB/TrEMBL:Q83NP6,NCBI_GP:CAD66950.1;Name=CAD66950.1;Note=Similar to Mycobacterium leprae u1764i ml1027 putative membrane protein SWALL:Q49991 (EMBL:U15181) (157 aa) fasta scores: E(): 2.4e-10%2C 33.76%25 id in 154 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66950.1;transl_table=11
BX072543.1	EMBL	sequence_feature	311877	311945	.	-	.	ID=id565;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34 and 39-61;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	311796	311864	.	-	.	ID=id565;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34 and 39-61;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	311871	311978	.	-	.	ID=id566;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.976) with cleavage site probability 0.938 between residues 36 and 37;gbkey=misc_feature
BX072543.1	EMBL	gene	312051	312491	.	+	.	ID=gene258;Name=dut;gbkey=Gene;gene=dut;gene_biotype=protein_coding;locus_tag=TW277
BX072543.1	EMBL	CDS	312051	312491	.	+	0	ID=cds258;Parent=gene258;Dbxref=GOA:Q83I22,InterPro:IPR008180,InterPro:IPR008181,InterPro:IPR029054,NCBI_GP:CAD66951.1;Name=CAD66951.1;Note=Similar to Streptomyces coelicolor deoxyuridine 5'-triphosphate nucleotidohydrolase Dut or SCO5868 or SC2E9.09 SWALL:DUT_STRCO (SWALL:O54134) (183 aa) fasta scores: E(): 5.6e-21%2C 50%25 id in 130 aa;gbkey=CDS;gene=dut;product=deoxyuridine 5'-triphosphate nucleotidohydrolase;protein_id=CAD66951.1;transl_table=11
BX072543.1	EMBL	sequence_feature	312072	312468	.	+	.	ID=id567;Note=dUTPase Score %3D 139.9 E-value %3D 3.2e-39;gbkey=misc_feature;gene=dut
BX072543.1	EMBL	gene	312484	313059	.	+	.	ID=gene259;Name=TW278;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW278
BX072543.1	EMBL	CDS	312484	313059	.	+	0	ID=cds259;Parent=gene259;Dbxref=InterPro:IPR022183,UniProtKB/TrEMBL:Q83I21,NCBI_GP:CAD66952.1;Name=CAD66952.1;Note=Weak and partial similarity to Streptomyces coelicolor hypothetical protein SCO5869 or SC2E9.10 SWALL:O54135 (EMBL:AL021530) (250 aa) fasta scores: E(): 2.5e-19%2C 40%25 id in 175 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66952.1;transl_table=11
BX072543.1	EMBL	gene	313063	313719	.	+	.	ID=gene260;Name=TW279;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW279
BX072543.1	EMBL	CDS	313063	313719	.	+	0	ID=cds260;Parent=gene260;Dbxref=InterPro:IPR016566,UniProtKB/TrEMBL:Q83NP5,NCBI_GP:CAD66953.1;Name=CAD66953.1;Note=Similar to Streptomyces coelicolor hypothetical protein sSCO5874 or SC2E9.15 SWALL:O54140 (EMBL:AL021530) (272 aa) fasta scores: E(): 7.4e-13%2C 28.72%25 id in 188 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66953.1;transl_table=11
BX072543.1	EMBL	sequence_feature	313216	313284	.	+	.	ID=id568;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 81-103%2C 108-142%2C 155-177 and 192-210;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	313303	313371	.	+	.	ID=id568;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 81-103%2C 108-142%2C 155-177 and 192-210;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	313384	313488	.	+	.	ID=id568;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 81-103%2C 108-142%2C 155-177 and 192-210;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	313525	313593	.	+	.	ID=id568;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 81-103%2C 108-142%2C 155-177 and 192-210;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	313636	313692	.	+	.	ID=id568;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 52-74%2C 81-103%2C 108-142%2C 155-177 and 192-210;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	313747	315636	.	+	.	ID=gene261;Name=Dxs;gbkey=Gene;gene=Dxs;gene_biotype=protein_coding;locus_tag=TW280
BX072543.1	EMBL	CDS	313747	315636	.	+	0	ID=cds261;Parent=gene261;Dbxref=GOA:Q83I20,InterPro:IPR005474,InterPro:IPR005475,InterPro:IPR005476,InterPro:IPR005477,InterPro:IPR009014,InterPro:IPR020826,InterPro:IPR029061,NCBI_GP:CAD66954.1;Name=CAD66954.1;Note=Similar to Streptomyces sp. 1-deoxy-D-xylulose 5-phosphate synthase Dxs SWALL:DXS_STRC1 (SWALL:Q9RBN6) (631 aa) fasta scores: E(): 3.4e-117%2C 49.75%25 id in 621 aa;gbkey=CDS;gene=Dxs;product=1-deoxy-D-xylulose 5-phosphate synthase;protein_id=CAD66954.1;transl_table=11
BX072543.1	EMBL	sequence_feature	313849	313908	.	+	.	ID=id569;Note=PS00801 Transketolase signature 1.;gbkey=misc_feature;gene=Dxs
BX072543.1	EMBL	sequence_feature	314719	315211	.	+	.	ID=id570;Note=Transketolase%2C pyridine binding domain Score %3D 187.2 E-value %3D 1.9e-53;gbkey=misc_feature;gene=Dxs
BX072543.1	EMBL	sequence_feature	315241	315586	.	+	.	ID=id571;Note=Transketolase%2C C-terminal domain Score %3D 37.5 E-value %3D 2.2e-08;gbkey=misc_feature;gene=Dxs
BX072543.1	EMBL	tRNA	315950	316020	.	-	.	ID=rna13;Note=tRNA Gly anticodon TCC%2C Cove score 77.64;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	exon	315950	316020	.	-	.	ID=id572;Parent=rna13;Note=tRNA Gly anticodon TCC%2C Cove score 77.64;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	tRNA	316230	316303	.	+	.	ID=rna14;Note=tRNA Pro anticodon TGG%2C Cove score 86.69;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	exon	316230	316303	.	+	.	ID=id573;Parent=rna14;Note=tRNA Pro anticodon TGG%2C Cove score 86.69;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	gene	316355	317668	.	+	.	ID=gene262;Name=tig;gbkey=Gene;gene=tig;gene_biotype=protein_coding;locus_tag=TW281
BX072543.1	EMBL	CDS	316355	317668	.	+	0	ID=cds262;Parent=gene262;Dbxref=GOA:Q83NP4,InterPro:IPR005215,InterPro:IPR008880,InterPro:IPR008881,InterPro:IPR027304,UniProtKB/TrEMBL:Q83NP4,NCBI_GP:CAD66955.1;Name=CAD66955.1;Note=Similar to Escherichia coli trigger factor Tig or b0436 or z0541 or ecs0490 SWALL:TIG_ECOLI (SWALL:P22257) (432 aa) fasta scores: E(): 2.8e-12%2C 25.55%25 id in 407 aa%2C and to Streptomyces coelicolor trigger factor Tig or SCO2620 or SCC80.05c SWALL:Q9F314 (EMBL:AL442143) (468 aa) fasta scores: E(): 6.4e-24%2C 30.9%25 id in 453 aa;gbkey=CDS;gene=tig;product=trigger factor;protein_id=CAD66955.1;transl_table=11
BX072543.1	EMBL	gene	317665	318867	.	+	.	ID=gene263;Name=TW282;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW282
BX072543.1	EMBL	CDS	317665	318867	.	+	0	ID=cds263;Parent=gene263;Dbxref=UniProtKB/TrEMBL:Q83NP3,NCBI_GP:CAD66956.1;Name=CAD66956.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD66956.1;transl_table=11
BX072543.1	EMBL	sequence_feature	317665	317850	.	+	.	ID=id574;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.488 between residues 62 and 63;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	317722	317790	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=1/10;partial=true
BX072543.1	EMBL	sequence_feature	317866	317934	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=2/10;partial=true
BX072543.1	EMBL	sequence_feature	317968	318036	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=3/10;partial=true
BX072543.1	EMBL	sequence_feature	318073	318132	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=4/10;partial=true
BX072543.1	EMBL	sequence_feature	318151	318210	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=5/10;partial=true
BX072543.1	EMBL	sequence_feature	318253	318321	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=6/10;partial=true
BX072543.1	EMBL	sequence_feature	318340	318408	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=7/10;partial=true
BX072543.1	EMBL	sequence_feature	318451	318519	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=8/10;partial=true
BX072543.1	EMBL	sequence_feature	318580	318648	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=9/10;partial=true
BX072543.1	EMBL	sequence_feature	318691	318759	.	+	.	ID=id575;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 68-90%2C 102-124%2C 137-156%2C 163-182%2C 197-219%2C 226-248%2C 263-285%2C 306-328 and 343-365;gbkey=misc_feature;is_ordered=true;part=10/10;partial=true
BX072543.1	EMBL	gene	318864	319406	.	+	.	ID=gene264;Name=clpP1;gbkey=Gene;gene=clpP1;gene_biotype=protein_coding;locus_tag=TW283
BX072543.1	EMBL	CDS	318864	319406	.	+	0	ID=cds264;Parent=gene264;Dbxref=GOA:Q83I19,InterPro:IPR001907,InterPro:IPR018215,InterPro:IPR023562,InterPro:IPR029045,NCBI_GP:CAD66957.1;Name=CAD66957.1;Note=Similar to Streptomyces coelicolor ATP-dependent Clp protease proteolytic subunit 1 ClpP1 or SCO2619 or SCC80.04c SWALL:CLP1_STRCO (SWALL:Q9F315) (219 aa) fasta scores: E(): 5.1e-39%2C 58.82%25 id in 170 aa;gbkey=CDS;gene=clpP1;product=ATP-dependent Clp protease proteolytic subunit 1;protein_id=CAD66957.1;transl_table=11
BX072543.1	EMBL	sequence_feature	318867	319401	.	+	.	ID=id576;Note=Clp protease Score %3D 282.2 E-value %3D 4.5e-82;gbkey=misc_feature;gene=clpP1
BX072543.1	EMBL	gene	319418	320041	.	+	.	ID=gene265;Name=clpP2;gbkey=Gene;gene=clpP2;gene_biotype=protein_coding;locus_tag=TW284
BX072543.1	EMBL	CDS	319418	320041	.	+	0	ID=cds265;Parent=gene265;Dbxref=GOA:Q83I18,InterPro:IPR001907,InterPro:IPR018215,InterPro:IPR023562,InterPro:IPR029045,NCBI_GP:CAD66958.1;Name=CAD66958.1;Note=Similar to Streptomyces coelicolor ATP-dependent Clp protease proteolytic subunit 2 ClpP2 or SCO2618 or SCC80.03c SWALL:CLP2_STRCO (SWALL:Q9ZH58) (218 aa) fasta scores: E(): 3e-48%2C 67%25 id in 197 aa;gbkey=CDS;gene=clpP2;product=ATP dependent Clp protease proteolytic subunit 2;protein_id=CAD66958.1;transl_table=11
BX072543.1	EMBL	sequence_feature	319466	320015	.	+	.	ID=id577;Note=Clp protease Score %3D 283.0 E-value %3D 2.6e-82;gbkey=misc_feature;gene=clpP2
BX072543.1	EMBL	sequence_feature	319700	319735	.	+	.	ID=id578;Note=PS00381 Endopeptidase Clp serine active site.;gbkey=misc_feature;gene=clpP2
BX072543.1	EMBL	gene	320051	321322	.	+	.	ID=gene266;Name=clpX;gbkey=Gene;gene=clpX;gene_biotype=protein_coding;locus_tag=TW285
BX072543.1	EMBL	CDS	320051	321322	.	+	0	ID=cds266;Parent=gene266;Dbxref=GOA:Q83MI6,InterPro:IPR003593,InterPro:IPR003959,InterPro:IPR004487,InterPro:IPR010603,InterPro:IPR019489,InterPro:IPR027417,NCBI_GP:CAD66959.1;Name=CAD66959.1;Note=Similar to Bacillus subtilis ATP-dependent Clp protease ATP-binding subunit ClpX SWALL:CLPX_BACSU (SWALL:P50866) (420 aa) fasta scores: E(): 6.7e-66%2C 56.89%25 id in 406 aa;gbkey=CDS;gene=clpX;product=ATP dependent Clp Protease ATP binding subunit;protein_id=CAD66959.1;transl_table=11
BX072543.1	EMBL	sequence_feature	320408	321167	.	+	.	ID=id579;Note=ATPase family associated with various cellular activities (AAA) Score %3D 79.5 E-value %3D 4.9e-21;gbkey=misc_feature;gene=clpX
BX072543.1	EMBL	sequence_feature	320423	320446	.	+	.	ID=id580;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=clpX
BX072543.1	EMBL	gene	321314	323884	.	-	.	ID=gene267;Name=TW286;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW286
BX072543.1	EMBL	CDS	321314	323884	.	-	0	ID=cds267;Parent=gene267;Dbxref=GOA:Q83I17,InterPro:IPR001412,InterPro:IPR002300,InterPro:IPR002303,InterPro:IPR009008,InterPro:IPR009080,InterPro:IPR013155,InterPro:IPR014729,InterPro:IPR022874,NCBI_GP:CAD66960.1;Name=CAD66960.1;Note=Similar to Rickettsia conorii valyl-tRNA synthetase ValS or rc1053 SWALL:Q92GR9 (EMBL:AE008656) (812 aa) fasta scores: E(): 3.5e-56%2C 39.75%25 id in 825 aa%2C and to Thermotoga maritima isoleucyl-tRNA synthetase IleS or tm1361 SWALL:SYI_THEMA (SWALL:P46213) (919 aa) fasta scores: E(): 2.7e-24%2C 24.4%25 id in 881 aa;gbkey=CDS;product=class I tRNA synthetase (I%2C L%2C M and V);protein_id=CAD66960.1;transl_table=11
BX072543.1	EMBL	sequence_feature	322036	323842	.	-	.	ID=id581;Note=tRNA synthetases class I (I%2C L%2C M and V) Score %3D 155.0 E-value %3D 9.4e-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	323711	323746	.	-	.	ID=id582;Note=PS00178 Aminoacyl-transfer RNA synthetases class-I signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	324081	327251	.	+	.	ID=gene268;Name=TW287;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW287
BX072543.1	EMBL	CDS	324081	327251	.	+	0	ID=cds268;Parent=gene268;Dbxref=GOA:Q83I16,InterPro:IPR002300,InterPro:IPR002301,InterPro:IPR009008,InterPro:IPR009080,InterPro:IPR013155,InterPro:IPR014729,InterPro:IPR023586,NCBI_GP:CAD66961.1;Name=CAD66961.1;Note=Similar to Mycobacterium tuberculosis isoleucyl-tRNA synthetase IleS or Rv1536 or mt1587 or mtcy48.29C SWALL:SYI_MYCTU (SWALL:Q10765) (1041 aa) fasta scores: E(): 0%2C 52.58%25 id in 1046 aa%2C and to Methanosarcina barkeri isoleucyl-tRNA synthetase IleS SWALL:Q9P9L9 (EMBL:AF208389) (1058 aa) fasta scores: E(): 3.3e-65%2C 30.23%25 id in 1065 aa;gbkey=CDS;product=class I tRNA synthetase (I%2C L%2C M and V);protein_id=CAD66961.1;transl_table=11
BX072543.1	EMBL	sequence_feature	324174	326094	.	+	.	ID=id583;Note=tRNA synthetases class I (I%2C L%2C M and V) Score %3D 626.0 E-value %3D 1.5e-185;gbkey=misc_feature
BX072543.1	EMBL	gene	327361	328722	.	+	.	ID=gene269;Name=fgs;gbkey=Gene;gene=fgs;gene_biotype=protein_coding;locus_tag=TW288
BX072543.1	EMBL	CDS	327361	328722	.	+	0	ID=cds269;Parent=gene269;Dbxref=GOA:Q83I15,InterPro:IPR001645,InterPro:IPR004101,InterPro:IPR013221,InterPro:IPR018109,UniProtKB/TrEMBL:Q83I15,NCBI_GP:CAD66962.1;Name=CAD66962.1;Note=Similar to Lactobacillus casei folylpolyglutamate synthase Fgs SWALL:FOLC_LACCA (SWALL:P15925) (428 aa) fasta scores: E(): 6.4e-22%2C 33.23%25 id in 343 aa%2C and to Corynebacterium glutamicum folylpolyglutamate synthase cgl2375 SWALL:BAB99768 (EMBL:AP005281) (458 aa) fasta scores: E(): 5.6e-47%2C 37.14%25 id in 455 aa;gbkey=CDS;gene=fgs;product=folylpolyglutamate synthase;protein_id=CAD66962.1;transl_table=11
BX072543.1	EMBL	sequence_feature	327385	328228	.	+	.	ID=id584;Note=Mur ligase family%2C catalytic domain Score %3D 34.0 E-value %3D 1.1e-07;gbkey=misc_feature;gene=fgs
BX072543.1	EMBL	sequence_feature	327457	327528	.	+	.	ID=id585;Note=PS01011 Folylpolyglutamate synthase signature 1.;gbkey=misc_feature;gene=fgs
BX072543.1	EMBL	sequence_feature	327763	327810	.	+	.	ID=id586;Note=PS01012 Folylpolyglutamate synthase signature 2.;gbkey=misc_feature;gene=fgs
BX072543.1	EMBL	sequence_feature	328249	328489	.	+	.	ID=id587;Note=Mur ligase family%2C glutamate ligase domain Score %3D 27.3 E-value %3D 2.6e-05;gbkey=misc_feature;gene=fgs
BX072543.1	EMBL	gene	328727	329056	.	+	.	ID=gene270;Name=TW289;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW289
BX072543.1	EMBL	CDS	328727	329056	.	+	0	ID=cds270;Parent=gene270;Dbxref=InterPro:IPR025327,UniProtKB/TrEMBL:Q83NP2,NCBI_GP:CAD66963.1;Name=CAD66963.1;Note=Similar to Streptomyces coelicolor putative membrane protein SCO2613 or SCC88.24c SWALL:Q9L1G5 (EMBL:AL139298) (118 aa) fasta scores: E(): 0.83%2C 28.84%25 id in 104 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD66963.1;transl_table=11
BX072543.1	EMBL	sequence_feature	328727	328906	.	+	.	ID=id588;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.899) with cleavage site probability 0.318 between residues 60 and 61;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	328760	328813	.	+	.	ID=id589;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-29%2C 39-61 and 74-96;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	328841	328909	.	+	.	ID=id589;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-29%2C 39-61 and 74-96;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	328946	329014	.	+	.	ID=id589;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-29%2C 39-61 and 74-96;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	329121	329531	.	+	.	ID=gene271;Name=ndk;gbkey=Gene;gene=ndk;gene_biotype=protein_coding;locus_tag=TW290
BX072543.1	EMBL	CDS	329121	329531	.	+	0	ID=cds271;Parent=gene271;Dbxref=GOA:Q83I14,InterPro:IPR001564,InterPro:IPR023005,UniProtKB/TrEMBL:Q83I14,NCBI_GP:CAD66964.1;Name=CAD66964.1;Note=Similar to Streptomyces coelicolor nucleoside diphosphate kinase Ndk or SCO2612 or SCC88.23c SWALL:NDK_STRCO (SWALL:P50589) (137 aa) fasta scores: E(): 5.6e-23%2C 48.52%25 id in 136 aa%2C and to Dictyostelium discoideum nucleoside diphosphate kinase%2C cytosolic NdkB or NdkC or Gip17 SWALL:NDKC_DICDI (SWALL:P22887) (155 aa) fasta scores: E(): 3e-24%2C 48.5%25 id in 134 aa;gbkey=CDS;gene=ndk;product=nucleoside diphosphate kinase;protein_id=CAD66964.1;transl_table=11
BX072543.1	EMBL	sequence_feature	329124	329526	.	+	.	ID=id590;Note=Nucleoside diphosphate kinase Score %3D 164.4 E-value %3D 1.3e-46;gbkey=misc_feature;gene=ndk
BX072543.1	EMBL	sequence_feature	329466	329492	.	+	.	ID=id591;Note=PS00469 Nucleoside diphosphate kinases active site.;gbkey=misc_feature;gene=ndk
BX072543.1	EMBL	gene	329749	331398	.	+	.	ID=gene272;Name=rne;gbkey=Gene;gene=rne;gene_biotype=protein_coding;locus_tag=TW291
BX072543.1	EMBL	CDS	329749	331398	.	+	0	ID=cds272;Parent=gene272;Dbxref=GOA:Q83I13,InterPro:IPR003029,InterPro:IPR004659,InterPro:IPR012340,InterPro:IPR019307,InterPro:IPR022967,UniProtKB/TrEMBL:Q83I13,NCBI_GP:CAD66965.1;Name=CAD66965.1;Note=Similar to Escherichia coli ribonuclease E Rne or Ams or Hmp1 or b1084 SWALL:RNE_ECOLI (SWALL:P21513) (1061 aa) fasta scores: E(): 9.7e-38%2C 36.25%25 id in 411 aa%2C and to Streptomyces coelicolor hypothetical protein SCO2599 or SCC88.10c SWALL:Q9L1H8 (EMBL:AL139298) (1340 aa) fasta scores: E(): 1.6e-58%2C 44.28%25 id in 560 aa;gbkey=CDS;gene=rne;product=ribonuclease E;protein_id=CAD66965.1;transl_table=11
BX072543.1	EMBL	gene	331522	331836	.	+	.	ID=gene273;Name=rplU;gbkey=Gene;gene=rplU;gene_biotype=protein_coding;locus_tag=TW292
BX072543.1	EMBL	CDS	331522	331836	.	+	0	ID=cds273;Parent=gene273;Dbxref=GOA:Q83I12,InterPro:IPR001787,InterPro:IPR028909,NCBI_GP:CAD66966.1;Name=CAD66966.1;Note=Similar to Mycobacterium tuberculosis 50s ribosomal protein L21 RplU or Rv2442c or mt2518 or mtcy428.04 SWALL:RL21_MYCTU (SWALL:P71907) (104 aa) fasta scores: E(): 9.8e-15%2C 50.5%25 id in 99 aa%2C and to Escherichia coli 50s ribosomal protein L21 RplU or b3186 or z4549 or ecs4065 SWALL:RL21_ECOLI (SWALL:P02422) (103 aa) fasta scores: E(): 0.00059%2C 29.7%25 id in 101 aa;gbkey=CDS;gene=rplU;product=50s ribosomal protein L21;protein_id=CAD66966.1;transl_table=11
BX072543.1	EMBL	sequence_feature	331522	331804	.	+	.	ID=id592;Note=Ribosomal prokaryotic L21 protein Score %3D 73.3 E-value %3D 3.7e-19;gbkey=misc_feature;gene=rplU
BX072543.1	EMBL	gene	331877	332125	.	+	.	ID=gene274;Name=rpmA;gbkey=Gene;gene=rpmA;gene_biotype=protein_coding;locus_tag=TW293
BX072543.1	EMBL	CDS	331877	332125	.	+	0	ID=cds274;Parent=gene274;Dbxref=GOA:Q83I11,InterPro:IPR001684,InterPro:IPR018261,NCBI_GP:CAD66967.1;Name=CAD66967.1;Note=Similar to Escherichia coli 50s ribosomal protein l27 RpmA or b3185 or z4547 or ecs4064 SWALL:RL27_ECOLI (SWALL:P02427) (84 aa) fasta scores: E(): 1.5e-15%2C 59.75%25 id in 82 aa;gbkey=CDS;gene=rpmA;product=50s ribosomal protein L27;protein_id=CAD66967.1;transl_table=11
BX072543.1	EMBL	sequence_feature	331880	332117	.	+	.	ID=id593;Note=Ribosomal L27 protein Score %3D 165.7 E-value %3D 5.7e-47;gbkey=misc_feature;gene=rpmA
BX072543.1	EMBL	sequence_feature	331976	332020	.	+	.	ID=id594;Note=PS00831 Ribosomal protein L27 signature.;gbkey=misc_feature;gene=rpmA
BX072543.1	EMBL	gene	332125	333462	.	+	.	ID=gene275;Name=obg;gbkey=Gene;gene=obg;gene_biotype=protein_coding;locus_tag=TW294
BX072543.1	EMBL	CDS	332125	333462	.	+	0	ID=cds275;Parent=gene275;Dbxref=GOA:Q83NP1,InterPro:IPR006073,InterPro:IPR006074,InterPro:IPR006169,InterPro:IPR014100,InterPro:IPR015349,InterPro:IPR027417,NCBI_GP:CAD66968.1;Name=CAD66968.1;Note=Similar to Streptomyces coelicolor Obg or SCO2595 or SCC88.06c SWALL:P95722 (EMBL:D87915) (478 aa) fasta scores: E(): 9.7e-75%2C 50.34%25 id in 441 aa;gbkey=CDS;gene=obg;product=GTP-binding protein;protein_id=CAD66968.1;transl_table=11
BX072543.1	EMBL	sequence_feature	332188	333010	.	+	.	ID=id595;Note=GTP1/OBG family Score %3D 366.1 E-value %3D 2.6e-107;gbkey=misc_feature;gene=obg
BX072543.1	EMBL	sequence_feature	332635	332658	.	+	.	ID=id596;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=obg
BX072543.1	EMBL	sequence_feature	332773	332814	.	+	.	ID=id597;Note=PS00905 GTP1/OBG family signature.;gbkey=misc_feature;gene=obg
BX072543.1	EMBL	gene	333528	333767	.	+	.	ID=gene276;Name=TW295;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW295
BX072543.1	EMBL	CDS	333528	333767	.	+	0	ID=cds276;Parent=gene276;Dbxref=UniProtKB/TrEMBL:Q83NP0,NCBI_GP:CAD66969.1;Name=CAD66969.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD66969.1;transl_table=11
BX072543.1	EMBL	sequence_feature	333594	333662	.	+	.	ID=id598;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 23-45;gbkey=misc_feature
BX072543.1	EMBL	gene	333790	334350	.	+	.	ID=gene277;Name=nadD;gbkey=Gene;gene=nadD;gene_biotype=protein_coding;locus_tag=TW296
BX072543.1	EMBL	CDS	333790	334350	.	+	0	ID=cds277;Parent=gene277;Dbxref=GOA:Q83I10,InterPro:IPR004821,InterPro:IPR005248,InterPro:IPR014729,NCBI_GP:CAD66970.1;Name=CAD66970.1;Note=Similar to Escherichia coli nicotinate-nucleotide adenylyltransferase NadD or b0639 SWALL:NADD_ECOLI (SWALL:P52085) (213 aa) fasta scores: E(): 1e-11%2C 32.19%25 id in 205 aa%2C and to Streptomyces coelicolor probable nicotinate-nucleotide adenylyltransferase NadD or SCO2579 or SCC123.17c SWALL:NADD_STRCO (SWALL:Q9RDK7) (188 aa) fasta scores: E(): 2.1e-46%2C 62.36%25 id in 186 aa;gbkey=CDS;gene=nadD;product=nicotinate-nucleotide adenylyltransferase;protein_id=CAD66970.1;transl_table=11
BX072543.1	EMBL	sequence_feature	333790	334330	.	+	.	ID=id599;Note=Cytidylyltransferase Score %3D 135.4 E-value %3D 7e-38;gbkey=misc_feature;gene=nadD
BX072543.1	EMBL	gene	334343	335269	.	+	.	ID=gene278;Name=TW297;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW297
BX072543.1	EMBL	CDS	334343	335269	.	+	0	ID=cds278;Parent=gene278;Dbxref=UniProtKB/TrEMBL:Q83NN9,NCBI_GP:CAD66971.1;Name=CAD66971.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD66971.1;transl_table=11
BX072543.1	EMBL	sequence_feature	335174	335242	.	+	.	ID=id600;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 278-300;gbkey=misc_feature
BX072543.1	EMBL	tRNA	335403	335478	.	+	.	ID=rna15;Note=tRNA Ala anticodon GGC%2C Cove score 84.05;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	exon	335403	335478	.	+	.	ID=id601;Parent=rna15;Note=tRNA Ala anticodon GGC%2C Cove score 84.05;gbkey=tRNA;product=tRNA-Ala
BX072543.1	EMBL	gene	335653	336300	.	+	.	ID=gene279;Name=TW298;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW298
BX072543.1	EMBL	CDS	335653	336300	.	+	0	ID=cds279;Parent=gene279;Dbxref=UniProtKB/TrEMBL:Q83I09,NCBI_GP:CAD66972.1;Name=CAD66972.1;Note=C-terminal portion similar to that of Corynebacterium glutamicum hypothetical protein Cgl1342 cgl1342 SWALL:BAB98735 (EMBL:AP005278) (285 aa) fasta scores: E(): 2.1e-09%2C 40%25 id in 120 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66972.1;transl_table=11
BX072543.1	EMBL	gene	336318	337370	.	+	.	ID=gene280;Name=TW299;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW299
BX072543.1	EMBL	CDS	336318	337370	.	+	0	ID=cds280;Parent=gene280;Dbxref=InterPro:IPR005135,UniProtKB/TrEMBL:Q83MI5,NCBI_GP:CAD66973.1;Name=CAD66973.1;Note=Similar to Streptococcus pneumoniae R6 hypothetical 37.7 kDa protein spr0510 SWALL:AAK99314 (EMBL:AE008430) (333 aa) fasta scores: E(): 4.6e-13%2C 26.08%25 id in 322 aa;gbkey=CDS;product=putative integral membrane protein (possible nuclease activity);protein_id=CAD66973.1;transl_table=11
BX072543.1	EMBL	sequence_feature	336318	336470	.	+	.	ID=id602;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.504 between residues 51 and 52;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	336378	336446	.	+	.	ID=id603;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80 and 87-109;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	336489	336557	.	+	.	ID=id603;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80 and 87-109;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	336576	336644	.	+	.	ID=id603;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80 and 87-109;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	336705	337353	.	+	.	ID=id604;Note=Endonuclease/Exonuclease/phosphatase family Score %3D 36.3 E-value %3D 5e-08;gbkey=misc_feature
BX072543.1	EMBL	gene	337674	338228	.	-	.	ID=gene281;Name=TW300;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW300
BX072543.1	EMBL	CDS	337674	338228	.	-	0	ID=cds281;Parent=gene281;Dbxref=GOA:Q83I08,InterPro:IPR001497,InterPro:IPR011991,InterPro:IPR014048,UniProtKB/TrEMBL:Q83I08,NCBI_GP:CAD66974.1;Name=CAD66974.1;Note=Similar to Bacillus subtilis methylated-DNA--protein-cysteine methyltransferase Ogt or Dat or Dat1 SWALL:OGT_BACSU (SWALL:P11742) (165 aa) fasta scores: E(): 4.4e-12%2C 44.62%25 id in 121 aa;gbkey=CDS;product=putative DNA-binding/repair enzyme;protein_id=CAD66974.1;transl_table=11
BX072543.1	EMBL	sequence_feature	337682	337931	.	-	.	ID=id605;Note=6-O-methylguanine DNA methyltransferase%2C DNA binding domain Score %3D 82.2 E-value %3D 7.7e-22;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	337764	337784	.	-	.	ID=id606;Note=PS00374 Methylated-DNA--protein-cysteine methyltransferase active site.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	337806	337871	.	-	.	ID=id607;Note=Predicted helix-turn-helix motif with score 1060.000%2C SD 2.80 at aa 120-141%2C sequence VSYGEIASKVNSSPRAVGAYCA;gbkey=misc_feature
BX072543.1	EMBL	gene	338230	339285	.	-	.	ID=gene282;Name=lipA;gbkey=Gene;gene=lipA;gene_biotype=protein_coding;locus_tag=TW301
BX072543.1	EMBL	CDS	338230	339285	.	-	0	ID=cds282;Parent=gene282;Dbxref=GOA:Q83NN8,InterPro:IPR003698,InterPro:IPR006638,InterPro:IPR007197,InterPro:IPR013785,NCBI_GP:CAD66975.1;Name=CAD66975.1;Note=Similar to Streptomyces coelicolor lipoic acid synthetase LipA or SCO2194 or SC5F7.07 or SC3H12.02 SWALL:LIPA_STRCO (SWALL:Q9S2P2) (317 aa) fasta scores: E(): 4.3e-85%2C 68.59%25 id in 312 aa%2C and to Escherichia coli%2C and Escherichia coli O157:H7 lipoic acid synthetase LipA or Lip or b0628 or z0773 or ecs0666 SWALL:LIPA_ECOLI (SWALL:P25845) (321 aa) fasta scores: E(): 4.9e-43%2C 41.31%25 id in 305 aa;gbkey=CDS;gene=lipA;product=lipoic acid synthetase;protein_id=CAD66975.1;transl_table=11
BX072543.1	EMBL	sequence_feature	338523	339006	.	-	.	ID=id608;Note=Radical SAM superfamily Score %3D 63.6 E-value %3D 3.1e-16;gbkey=misc_feature;gene=lipA
BX072543.1	EMBL	gene	339304	339981	.	-	.	ID=gene283;Name=lipB;gbkey=Gene;gene=lipB;gene_biotype=protein_coding;locus_tag=TW302
BX072543.1	EMBL	CDS	339304	339981	.	-	0	ID=cds283;Parent=gene283;Dbxref=GOA:Q83I07,InterPro:IPR000544,InterPro:IPR004143,InterPro:IPR020605,NCBI_GP:CAD66976.1;Name=CAD66976.1;Note=Similar to Escherichia coli lipoate-protein ligase B LipB or b0630 SWALL:LIPB_ECOLI (SWALL:P30976) (213 aa) fasta scores: E(): 2.4e-13%2C 30.08%25 id in 226 aa%2C and to Mycobacterium tuberculosis lipoate-protein ligase B LipB or Rv2217 or mt2274 or mtcy190.28 SWALL:LIPB_MYCTU (SWALL:Q10404) (230 aa) fasta scores: E(): 6.1e-32%2C 48.24%25 id in 199 aa;gbkey=CDS;gene=lipB;product=lipoate-protein ligase B;protein_id=CAD66976.1;transl_table=11
BX072543.1	EMBL	sequence_feature	339465	339819	.	-	.	ID=id609;Note=Biotin/lipoate A/B protein ligase family Score %3D 113.2 E-value %3D 3.6e-31;gbkey=misc_feature;gene=lipB
BX072543.1	EMBL	sequence_feature	339700	339747	.	-	.	ID=id610;Note=PS01313 Lipoate-protein ligase B signature.;gbkey=misc_feature;gene=lipB
BX072543.1	EMBL	gene	340094	341434	.	+	.	ID=gene284;Name=ffh;gbkey=Gene;gene=ffh;gene_biotype=protein_coding;locus_tag=TW303
BX072543.1	EMBL	CDS	340094	341434	.	+	0	ID=cds284;Parent=gene284;Dbxref=GOA:Q83NN7,InterPro:IPR000897,InterPro:IPR003593,InterPro:IPR004125,InterPro:IPR004780,InterPro:IPR013822,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NN7,NCBI_GP:CAD66977.1;Name=CAD66977.1;Note=Similar to Escherichia coli signal recognition particle protein Ffh or b2610 or z3904 or ecs3473 SWALL:SR54_ECOLI (SWALL:P07019) (453 aa) fasta scores: E(): 1.1e-33%2C 34.89%25 id in 447 aa;gbkey=CDS;gene=ffh;product=signal recognition particle protein;protein_id=CAD66977.1;transl_table=11
BX072543.1	EMBL	sequence_feature	340097	340352	.	+	.	ID=id611;Note=SRP54-type protein%2C helical bundle domain Score %3D 65.4 E-value %3D 8.8e-17;gbkey=misc_feature;gene=ffh
BX072543.1	EMBL	sequence_feature	340385	340970	.	+	.	ID=id612;Note=SRP54-type protein%2C GTPase domain Score %3D 269.3 E-value %3D 3.6e-78;gbkey=misc_feature;gene=ffh
BX072543.1	EMBL	sequence_feature	340412	340435	.	+	.	ID=id613;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=ffh
BX072543.1	EMBL	sequence_feature	341039	341318	.	+	.	ID=id614;Note=Signal peptide binding domain Score %3D 77.6 E-value %3D 1.8e-20;gbkey=misc_feature;gene=ffh
BX072543.1	EMBL	gene	341630	342076	.	+	.	ID=gene285;Name=rpsP;gbkey=Gene;gene=rpsP;gene_biotype=protein_coding;locus_tag=TW304
BX072543.1	EMBL	CDS	341630	342076	.	+	0	ID=cds285;Parent=gene285;Dbxref=GOA:Q83I06,InterPro:IPR000307,InterPro:IPR020592,InterPro:IPR023803,NCBI_GP:CAD66978.1;Name=CAD66978.1;Note=Similar to Bacillus subtilis 30s ribosomal protein S16 RpsP SWALL:RS16_BACSU (SWALL:P21474) (89 aa) fasta scores: E(): 1.9e-10%2C 52.43%25 id in 82 aa%2C and to Streptomyces coelicolor 30s ribosomal protein S16 RpsP or SCO5591 or SC2E1.08 SWALL:RS16_STRCO (SWALL:O69879) (139 aa) fasta scores: E(): 6.5e-19%2C 53.78%25 id in 119 aa;gbkey=CDS;gene=rpsP;product=30s ribosomal protein S16;protein_id=CAD66978.1;transl_table=11
BX072543.1	EMBL	sequence_feature	341696	341828	.	+	.	ID=id615;Note=Ribosomal protein S16 Score %3D 57.4 E-value %3D 2.2e-14;gbkey=misc_feature;gene=rpsP
BX072543.1	EMBL	gene	342073	342303	.	+	.	ID=gene286;Name=TW305;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW305
BX072543.1	EMBL	CDS	342073	342303	.	+	0	ID=cds286;Parent=gene286;Dbxref=GOA:Q83I05,InterPro:IPR004088,InterPro:IPR009019,UniProtKB/TrEMBL:Q83I05,NCBI_GP:CAD66979.1;Name=CAD66979.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2908c or mt2976 or mtcy274.40C SWALL:YT08_MYCTU (SWALL:Q10826) (80 aa) fasta scores: E(): 1.4e-07%2C 46.91%25 id in 81 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66979.1;transl_table=11
BX072543.1	EMBL	sequence_feature	342169	342241	.	+	.	ID=id616;Note=KH domain Score %3D 21.4 E-value %3D 1.1e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	342303	342851	.	+	.	ID=gene287;Name=rimM;gbkey=Gene;gene=rimM;gene_biotype=protein_coding;locus_tag=TW306
BX072543.1	EMBL	CDS	342303	342851	.	+	0	ID=cds287;Parent=gene287;Dbxref=GOA:Q83NN6,InterPro:IPR002676,InterPro:IPR009000,InterPro:IPR011033,InterPro:IPR011961,UniProtKB/TrEMBL:Q83NN6,NCBI_GP:CAD66980.1;Name=CAD66980.1;Note=Similar to Mycobacterium tuberculosis probable 16s rRNA processing protein RimM or Rv2907c or mt2975 or mtcy274.38C SWALL:RIMM_MYCTU (SWALL:Q10824) (176 aa) fasta scores: E(): 1.5e-10%2C 30.72%25 id in 179 aa;gbkey=CDS;gene=rimM;product=probable 16s rRNA processing protein RimM;protein_id=CAD66980.1;transl_table=11
BX072543.1	EMBL	sequence_feature	342312	342819	.	+	.	ID=id617;Note=RimM Score %3D 51.0 E-value %3D 1.9e-12;gbkey=misc_feature;gene=rimM
BX072543.1	EMBL	gene	342884	343588	.	+	.	ID=gene288;Name=trmD;gbkey=Gene;gene=trmD;gene_biotype=protein_coding;locus_tag=TW307
BX072543.1	EMBL	CDS	342884	343588	.	+	0	ID=cds288;Parent=gene288;Dbxref=GOA:Q820Z0,InterPro:IPR002649,InterPro:IPR016009,InterPro:IPR023148,InterPro:IPR029026,InterPro:IPR029028,NCBI_GP:CAD66981.1;Name=CAD66981.1;Note=Similar to Escherichia coli tRNA (guanine-N1)-methyltransferase TrmB or b2607 or z3901 or ecs3470 SWALL:TRMD_ECOLI (SWALL:P07020) (255 aa) fasta scores: E(): 4.3e-30%2C 42.29%25 id in 227 aa%2C and to Mycobacterium tuberculosis tRNA (guanine-N1)-methyltransferase TrmB or rv2906c or mt2974 or mtcy274.37C SWALL:TRMD_MYCTU (SWALL:Q10797) (230 aa) fasta scores: E(): 7.9e-41%2C 49.55%25 id in 226 aa;gbkey=CDS;gene=trmD;product=tRNA (guanine-N1)-methyltransferase;protein_id=CAD66981.1;transl_table=11
BX072543.1	EMBL	sequence_feature	342884	343138	.	+	.	ID=id618;Note=PS00430 TonB-dependent receptor proteins signature 1.;gbkey=misc_feature;gene=trmD
BX072543.1	EMBL	sequence_feature	342953	343580	.	+	.	ID=id619;Note=tRNA (Guanine-1)-methyltransferase Score %3D 350.8 E-value %3D 1.1e-102;gbkey=misc_feature;gene=trmD
BX072543.1	EMBL	gene	343681	344028	.	+	.	ID=gene289;Name=rplS;gbkey=Gene;gene=rplS;gene_biotype=protein_coding;locus_tag=TW308
BX072543.1	EMBL	CDS	343681	344028	.	+	0	ID=cds289;Parent=gene289;Dbxref=GOA:Q83I04,InterPro:IPR001857,InterPro:IPR008991,InterPro:IPR018257,NCBI_GP:CAD66982.1;Name=CAD66982.1;Note=Similar to Escherichia coli 50s ribosomal protein L19 RplS or b2606 or z3900 or ecs3469 SWALL:RL19_ECOLI (SWALL:P02420) (114 aa) fasta scores: E(): 4.3e-18%2C 50.94%25 id in 106 aa;gbkey=CDS;gene=rplS;product=50s ribosomal protein L19;protein_id=CAD66982.1;transl_table=11
BX072543.1	EMBL	sequence_feature	343681	344017	.	+	.	ID=id620;Note=Ribosomal protein L19 Score %3D 189.8 E-value %3D 3.1e-54;gbkey=misc_feature;gene=rplS
BX072543.1	EMBL	gene	344025	344717	.	+	.	ID=gene290;Name=sipS;gbkey=Gene;gene=sipS;gene_biotype=protein_coding;locus_tag=TW309
BX072543.1	EMBL	CDS	344025	344717	.	+	0	ID=cds290;Parent=gene290;Dbxref=GOA:Q83I03,InterPro:IPR000223,InterPro:IPR015927,InterPro:IPR019758,InterPro:IPR019759,InterPro:IPR028360,UniProtKB/TrEMBL:Q83I03,NCBI_GP:CAD66983.1;Name=CAD66983.1;Note=Similar to Bacillus subtilis signal peptidase I SipS SWALL:LEPS_BACSU (SWALL:P28628) (184 aa) fasta scores: E(): 1.5e-06%2C 29.64%25 id in 199 aa%2C and to Streptomyces lividans signal peptidase I sipX SWALL:O86869 (EMBL:Z86111) (320 aa) fasta scores: E(): 8.4e-30%2C 46%25 id in 213 aa;gbkey=CDS;gene=sipS;product=signal peptidase I;protein_id=CAD66983.1;transl_table=11
BX072543.1	EMBL	sequence_feature	344043	344622	.	+	.	ID=id621;Note=Signal peptidase I Score %3D 55.6 E-value %3D 7.9e-14;gbkey=misc_feature;gene=sipS
BX072543.1	EMBL	sequence_feature	344085	344153	.	+	.	ID=id622;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-43;gbkey=misc_feature;gene=sipS
BX072543.1	EMBL	sequence_feature	344526	344567	.	+	.	ID=id623;Note=PS00761 Signal peptidases I signature 3.;gbkey=misc_feature;gene=sipS
BX072543.1	EMBL	gene	344979	345098	.	+	.	ID=gene291;Name=TW311;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW311
BX072543.1	EMBL	CDS	344979	345098	.	+	0	ID=cds291;Parent=gene291;Dbxref=UniProtKB/TrEMBL:Q83I02,NCBI_GP:CAD66984.1;Name=CAD66984.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66984.1;transl_table=11
BX072543.1	EMBL	gene	345350	345712	.	+	.	ID=gene292;Name=TW312;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW312
BX072543.1	EMBL	CDS	345350	345712	.	+	0	ID=cds292;Parent=gene292;Dbxref=GOA:Q83I01,InterPro:IPR003509,InterPro:IPR011335,InterPro:IPR011856,NCBI_GP:CAD66985.1;Name=CAD66985.1;Note=Similar to Thermotoga maritima hypothetical protein Tm0253 SWALL:Y253_THEMA (SWALL:Q9WY95) (108 aa) fasta scores: E(): 9.1e-09%2C 41.5%25 id in 106 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66985.1;transl_table=11
BX072543.1	EMBL	sequence_feature	345386	345665	.	+	.	ID=id624;Note=Uncharacterised protein family UPF0102 Score %3D 72.7 E-value %3D 5.4e-19;gbkey=misc_feature
BX072543.1	EMBL	gene	345709	347244	.	+	.	ID=gene293;Name=TW313;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW313
BX072543.1	EMBL	CDS	345709	347244	.	+	0	ID=cds293;Parent=gene293;Dbxref=GOA:Q83I00,InterPro:IPR000523,InterPro:IPR003593,InterPro:IPR004482,InterPro:IPR014721,InterPro:IPR020568,InterPro:IPR025158,InterPro:IPR027417,UniProtKB/TrEMBL:Q83I00,NCBI_GP:CAD66986.1;Name=CAD66986.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2897c or mt2965 or mtcy274.28C SWALL:YS97_MYCTU (SWALL:Q10818) (503 aa) fasta scores: E(): 1.9e-61%2C 43.77%25 id in 514 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD66986.1;transl_table=11
BX072543.1	EMBL	sequence_feature	345760	346750	.	+	.	ID=id625;Note=Magnesium chelatase%2C subunit ChlI Score %3D 159.0 E-value %3D 5.7e-45;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	346369	346392	.	+	.	ID=id626;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	347316	348461	.	+	.	ID=gene294;Name=TW314;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW314
BX072543.1	EMBL	CDS	347316	348461	.	+	0	ID=cds294;Parent=gene294;Dbxref=GOA:Q83NN5,InterPro:IPR003488,UniProtKB/TrEMBL:Q83NN5,NCBI_GP:CAD66987.1;Name=CAD66987.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2896c or mt2964 or mtcy274.27C SWALL:YS96_MYCTU (SWALL:Q10817) (389 aa) fasta scores: E(): 9.6e-28%2C 40.07%25 id in 272 aa%2C and to Haemophilus influenzae Smf protein or DprA or hi0985 SWALL:SMF_HAEIN (SWALL:P43862) (373 aa) fasta scores: E(): 8e-16%2C 30.63%25 id in 284 aa;gbkey=CDS;product=putative DNA processing protein;protein_id=CAD66987.1;transl_table=11
BX072543.1	EMBL	sequence_feature	347586	348204	.	+	.	ID=id627;Note=SMF family Score %3D 217.7 E-value %3D 1.2e-62;gbkey=misc_feature
BX072543.1	EMBL	gene	348498	349418	.	+	.	ID=gene295;Name=TW315;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW315
BX072543.1	EMBL	CDS	348498	349418	.	+	0	ID=cds295;Parent=gene295;Dbxref=GOA:Q83NN4,InterPro:IPR002104,InterPro:IPR004107,InterPro:IPR011010,InterPro:IPR013762,InterPro:IPR023009,InterPro:IPR023109,UniProtKB/TrEMBL:Q83NN4,NCBI_GP:CAD66988.1;Name=CAD66988.1;Note=Similar to Mycobacterium tuberculosis probable integrase/recombinase XerC or Rv2894c or mt2962 or mtcy274.25C SWALL:XERC_MYCTU (SWALL:Q10815) (298 aa) fasta scores: E(): 2.2e-35%2C 43.18%25 id in 301 aa%2C and to Pseudomonas fluorescens Sss/XerC protein SWALL:O05324 (EMBL:Y12268) (299 aa) fasta scores: E(): 4.6e-29%2C 36.11%25 id in 288 aa;gbkey=CDS;product=putative DNA recombinase;protein_id=CAD66988.1;transl_table=11
BX072543.1	EMBL	sequence_feature	348537	348801	.	+	.	ID=id628;Note=Phage integrase%2C N-terminal SAM-like domain Score %3D 58.6 E-value %3D 9.7e-15;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	348867	349386	.	+	.	ID=id629;Note=Phage integrase family Score %3D 137.8 E-value %3D 1.4e-38;gbkey=misc_feature
BX072543.1	EMBL	gene	349918	350202	.	+	.	ID=gene296;Name=TW316;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW316
BX072543.1	EMBL	CDS	349918	350202	.	+	0	ID=cds296;Parent=gene296;Dbxref=UniProtKB/TrEMBL:Q83HZ9,NCBI_GP:CAD66989.1;Name=CAD66989.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66989.1;transl_table=11
BX072543.1	EMBL	gene	350217	350912	.	-	.	ID=gene297;Name=TW317;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW317
BX072543.1	EMBL	CDS	350217	350912	.	-	0	ID=cds297;Parent=gene297;Dbxref=InterPro:IPR011055,InterPro:IPR016047,UniProtKB/TrEMBL:Q83HZ8,NCBI_GP:CAD66990.1;Name=CAD66990.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66990.1;transl_table=11
BX072543.1	EMBL	sequence_feature	350261	350666	.	-	.	ID=id630;Note=Peptidase family M23/M37 Score %3D 36.2 E-value %3D 5.3e-08;gbkey=misc_feature
BX072543.1	EMBL	gene	351125	351988	.	+	.	ID=gene298;Name=rpsB;gbkey=Gene;gene=rpsB;gene_biotype=protein_coding;locus_tag=TW318
BX072543.1	EMBL	CDS	351125	351988	.	+	0	ID=cds298;Parent=gene298;Dbxref=GOA:Q83HZ7,InterPro:IPR001865,InterPro:IPR005706,InterPro:IPR023591,NCBI_GP:CAD66991.1;Name=CAD66991.1;Note=Similar to Streptomyces coelicolor 30s ribosomal protein S2 RpsB or SCO5624 or SC2E1.41 SWALL:RS2_STRCO (SWALL:O31212) (310 aa) fasta scores: E(): 1.5e-50%2C 51.56%25 id in 287 aa%2C and to Spirulina platensis 30s ribosomal protein s2 rpsB SWALL:RS2_SPIPL (SWALL:P34831) (251 aa) fasta scores: E(): 1.1e-39%2C 45.71%25 id in 245 aa;gbkey=CDS;gene=rpsB;product=30s ribosomal protein S2;protein_id=CAD66991.1;transl_table=11
BX072543.1	EMBL	sequence_feature	351167	351809	.	+	.	ID=id631;Note=Ribosomal protein S2 Score %3D 273.4 E-value %3D 2.1e-79;gbkey=misc_feature;gene=rpsB
BX072543.1	EMBL	gene	352019	352840	.	+	.	ID=gene299;Name=tsf;gbkey=Gene;gene=tsf;gene_biotype=protein_coding;locus_tag=TW319
BX072543.1	EMBL	CDS	352019	352840	.	+	0	ID=cds299;Parent=gene299;Dbxref=GOA:Q83NN3,InterPro:IPR000449,InterPro:IPR001816,InterPro:IPR009060,InterPro:IPR014039,InterPro:IPR018101,NCBI_GP:CAD66992.1;Name=CAD66992.1;Note=Similar to Streptomyces coelicolor elongation factor Ts Tsf or SCO5625 or SC2E1.42 SWALL:EFTS_STRCO (SWALL:O31213) (278 aa) fasta scores: E(): 3e-39%2C 45.48%25 id in 277 aa;gbkey=CDS;gene=tsf;product=elongation factor Ts;protein_id=CAD66992.1;transl_table=11
BX072543.1	EMBL	sequence_feature	352028	352148	.	+	.	ID=id632;Note=UBA/TS-N domain Score %3D 32.0 E-value %3D 9.5e-07;gbkey=misc_feature;gene=tsf
BX072543.1	EMBL	sequence_feature	352187	352835	.	+	.	ID=id633;Note=Elongation factor TS Score %3D 216.4 E-value %3D 2.9e-62;gbkey=misc_feature;gene=tsf
BX072543.1	EMBL	gene	352851	353546	.	+	.	ID=gene300;Name=pyrH;gbkey=Gene;gene=pyrH;gene_biotype=protein_coding;locus_tag=TW320
BX072543.1	EMBL	CDS	352851	353546	.	+	0	ID=cds300;Parent=gene300;Dbxref=GOA:Q83HZ6,InterPro:IPR001048,InterPro:IPR011817,InterPro:IPR015963,NCBI_GP:CAD66993.1;Name=CAD66993.1;Note=Similar to Escherichia coli uridylate kinase PyrH or SmbA or b0171 or z0182 or ecs0173 SWALL:PYRH_ECOLI (SWALL:P29464) (240 aa) fasta scores: E(): 1.2e-29%2C 44.63%25 id in 233 aa%2C and to Streptomyces coelicolor uridylate kinase PyrH or SCO5626 or SC2E1.43 SWALL:O69913 (EMBL:AL023797) (253 aa) fasta scores: E(): 1.5e-46%2C 61.3%25 id in 230 aa;gbkey=CDS;gene=pyrH;product=uridylate kinase;protein_id=CAD66993.1;transl_table=11
BX072543.1	EMBL	sequence_feature	352860	353484	.	+	.	ID=id634;Note=Amino acid kinase family Score %3D 203.3 E-value %3D 2.7e-58;gbkey=misc_feature;gene=pyrH
BX072543.1	EMBL	gene	353710	354255	.	+	.	ID=gene301;Name=frr;gbkey=Gene;gene=frr;gene_biotype=protein_coding;locus_tag=TW321
BX072543.1	EMBL	CDS	353710	354255	.	+	0	ID=cds301;Parent=gene301;Dbxref=GOA:Q83HZ5,InterPro:IPR002661,InterPro:IPR023584,NCBI_GP:CAD66994.1;Name=CAD66994.1;Note=Similar to Pseudomonas aeruginosa ribosome recycling factor Frr or pa3653 SWALL:RRF_PSEAE (SWALL:O82853) (185 aa) fasta scores: E(): 9.4e-15%2C 35.59%25 id in 177 aa%2C and to Streptomyces coelicolor ribosome recycling factor Frr or SCO5627 or SC6A9.40C SWALL:RRF_STRCO (SWALL:O86770) (185 aa) fasta scores: E(): 2.1e-21%2C 42.45%25 id in 179 aa;gbkey=CDS;gene=frr;product=ribosome recycling factor;protein_id=CAD66994.1;transl_table=11
BX072543.1	EMBL	sequence_feature	353764	354244	.	+	.	ID=id635;Note=Ribosome recycling factor Score %3D 158.3 E-value %3D 9.2e-45;gbkey=misc_feature;gene=frr
BX072543.1	EMBL	gene	354324	355133	.	+	.	ID=gene302;Name=TW322;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW322
BX072543.1	EMBL	CDS	354324	355133	.	+	0	ID=cds302;Parent=gene302;Dbxref=GOA:Q83NN2,InterPro:IPR000374,UniProtKB/TrEMBL:Q83NN2,NCBI_GP:CAD66995.1;Name=CAD66995.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO5628 or SC6A9.39C SWALL:O86769 (EMBL:AL031035) (391 aa) fasta scores: E(): 1.7e-18%2C 35.44%25 id in 268 aa%2C and to Escherichia coli phosphatidate cytidylyltransferase CdsA or Cds or b0175 or z0186 or ecs0177 SWALL:CDSA_ECOLI (SWALL:P06466) (249 aa) fasta scores: E(): 1.5e-15%2C 33.85%25 id in 192 aa;gbkey=CDS;product=putative integral membrane phospholipid biosynthetic nucleotidyltransferase;protein_id=CAD66995.1;transl_table=11
BX072543.1	EMBL	sequence_feature	354360	354413	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	354423	354491	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	354510	354578	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	354588	354647	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	354666	354734	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	354744	354812	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	354849	354917	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	354930	354983	.	+	.	ID=id636;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-30%2C 34-56%2C 63-85%2C 89-108%2C 115-137%2C 141-163%2C 176-198 and 203-220;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	354732	355128	.	+	.	ID=id637;Note=Phosphatidate cytidylyltransferase Score %3D 170.2 E-value %3D 2.4e-48;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	354996	355076	.	+	.	ID=id638;Note=PS01315 Phosphatidate cytidylyltransferase signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	355281	356120	.	+	.	ID=gene303;Name=xthA1;gbkey=Gene;gene=xthA1;gene_biotype=protein_coding;locus_tag=TW323
BX072543.1	EMBL	CDS	355281	356120	.	+	0	ID=cds303;Parent=gene303;Dbxref=GOA:Q83HZ4,InterPro:IPR004808,InterPro:IPR005135,InterPro:IPR020848,UniProtKB/TrEMBL:Q83HZ4,NCBI_GP:CAD66996.1;Name=CAD66996.1;Note=Similar to Escherichia coli exodeoxyribonuclease III XthA or Xth or b1749 SWALL:EX3_ECOLI (SWALL:P09030) (268 aa) fasta scores: E(): 6.8e-14%2C 28.96%25 id in 290 aa%2C and to Streptomyces coelicolor putative exonuclease SCO6341 or SC3A7.09 SWALL:O86610 (EMBL:AL031155) (259 aa) fasta scores: E(): 6.4e-24%2C 40.07%25 id in 272 aa;gbkey=CDS;gene=xthA1;product=exodeoxyribonuclease III;protein_id=CAD66996.1;transl_table=11
BX072543.1	EMBL	sequence_feature	355281	356082	.	+	.	ID=id639;Note=Endonuclease/Exonuclease/phosphatase family Score %3D 131.7 E-value %3D 9.2e-37;gbkey=misc_feature;gene=xthA1
BX072543.1	EMBL	sequence_feature	355944	355979	.	+	.	ID=id640;Note=PS00728 AP endonucleases family 1 signature 3.;gbkey=misc_feature;gene=xthA1
BX072543.1	EMBL	gene	356139	356681	.	+	.	ID=gene304;Name=TW324;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW324
BX072543.1	EMBL	CDS	356139	356681	.	+	0	ID=cds304;Parent=gene304;Dbxref=InterPro:IPR019932,InterPro:IPR019933,UniProtKB/TrEMBL:Q83HZ3,NCBI_GP:CAD66997.1;Name=CAD66997.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD66997.1;transl_table=11
BX072543.1	EMBL	gene	356911	357549	.	-	.	ID=gene305;Name=TW325;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW325
BX072543.1	EMBL	CDS	356911	357549	.	-	0	ID=cds305;Parent=gene305;Dbxref=InterPro:IPR008258,InterPro:IPR023346,UniProtKB/TrEMBL:Q83NN1,NCBI_GP:CAD66998.1;Name=CAD66998.1;Note=Similar to Streptomyces coelicolor putative secreted protein SCO5029 or SCK7.02 SWALL:Q9FBP7 (EMBL:AL391754) (238 aa) fasta scores: E(): 1.2e-14%2C 47.36%25 id in 114 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD66998.1;transl_table=11
BX072543.1	EMBL	sequence_feature	357388	357549	.	-	.	ID=id641;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.986) with cleavage site probability 0.797 between residues 54 and 55;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	357394	357462	.	-	.	ID=id642;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 30-52;gbkey=misc_feature
BX072543.1	EMBL	gene	357802	359424	.	+	.	ID=gene306;Name=groEL;gbkey=Gene;gene=groEL;gene_biotype=protein_coding;locus_tag=TW327
BX072543.1	EMBL	CDS	357802	359424	.	+	0	ID=cds306;Parent=gene306;Dbxref=GOA:Q83NN0,InterPro:IPR001844,InterPro:IPR002423,InterPro:IPR018370,InterPro:IPR027409,InterPro:IPR027413,NCBI_GP:CAD66999.1;Name=CAD66999.1;Note=Similar to Tropheryma whipplei 60 kDa chaperonin groL or groEL SWALL:CH60_TROWH (SWALL:Q9KJC0) (540 aa) fasta scores: E(): 4.7e-183%2C 99.81%25 id in 540 aa%2C and to Streptomyces albus G 60 kDa chaperonin 2 GroL2 or GroEL2 SWALL:CH62_STRAL (SWALL:Q00768) (539 aa) fasta scores: E(): 1.1e-139%2C 75.37%25 id in 540 aa;gbkey=CDS;gene=groEL;product=60 kDa chaperonin;protein_id=CAD66999.1;transl_table=11
BX072543.1	EMBL	sequence_feature	357865	359368	.	+	.	ID=id643;Note=TCP-1/cpn60 chaperonin family Score %3D 660.1 E-value %3D 8.4e-196;gbkey=misc_feature;gene=groEL
BX072543.1	EMBL	sequence_feature	359008	359043	.	+	.	ID=id644;Note=PS00296 Chaperonins cpn60 signature.;gbkey=misc_feature;gene=groEL
BX072543.1	EMBL	gene	359486	360241	.	-	.	ID=gene307;Name=TW328;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW328
BX072543.1	EMBL	CDS	359486	360241	.	-	0	ID=cds307;Parent=gene307;Dbxref=UniProtKB/TrEMBL:Q83NM9,NCBI_GP:CAD67000.1;Name=CAD67000.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67000.1;transl_table=11
BX072543.1	EMBL	sequence_feature	360119	360172	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=1/7;partial=true
BX072543.1	EMBL	sequence_feature	360050	360109	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=2/7;partial=true
BX072543.1	EMBL	sequence_feature	359972	360031	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=3/7;partial=true
BX072543.1	EMBL	sequence_feature	359846	359914	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=4/7;partial=true
BX072543.1	EMBL	sequence_feature	359741	359809	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=5/7;partial=true
BX072543.1	EMBL	sequence_feature	359660	359728	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=6/7;partial=true
BX072543.1	EMBL	sequence_feature	359531	359599	.	-	.	ID=id645;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-41%2C 45-64%2C 71-90%2C 110-132%2C 145-167%2C 172-194 and 215-237;gbkey=misc_feature;is_ordered=true;part=7/7;partial=true
BX072543.1	EMBL	sequence_feature	360185	360241	.	-	.	ID=id646;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.674) with cleavage site probability 0.179 between residues 19 and 20;gbkey=misc_feature
BX072543.1	EMBL	gene	360443	361912	.	+	.	ID=gene308;Name=hom;gbkey=Gene;gene=hom;gene_biotype=protein_coding;gene_synonym=thrA;locus_tag=TW329
BX072543.1	EMBL	CDS	360443	361912	.	+	0	ID=cds308;Parent=gene308;Dbxref=GOA:Q83HZ2,InterPro:IPR001342,InterPro:IPR005106,InterPro:IPR016040,InterPro:IPR019811,UniProtKB/TrEMBL:Q83HZ2,NCBI_GP:CAD67001.1;Name=CAD67001.1;Note=Similar to Corynebacterium glutamicum homoserine dehydrogenase Hom or ThrA or cgl1183 SWALL:DHOM_CORGL (SWALL:P08499) (445 aa) fasta scores: E(): 6.7e-54%2C 43.56%25 id in 443 aa;gbkey=CDS;gene=hom;product=homoserine dehydrogenase;protein_id=CAD67001.1;transl_table=11
BX072543.1	EMBL	sequence_feature	360551	360938	.	+	.	ID=id647;Note=Homoserine dehydrogenase%2C NAD binding domain Score %3D 91.8 E-value %3D 9.7e-25;gbkey=misc_feature;gene=hom
BX072543.1	EMBL	sequence_feature	360944	361484	.	+	.	ID=id648;Note=Homoserine dehydrogenase Score %3D 250.4 E-value %3D 1.7e-72;gbkey=misc_feature;gene=hom
BX072543.1	EMBL	sequence_feature	361082	361150	.	+	.	ID=id649;Note=PS01042 Homoserine dehydrogenase signature.;gbkey=misc_feature;gene=hom
BX072543.1	EMBL	gene	361919	362971	.	+	.	ID=gene309;Name=thrC;gbkey=Gene;gene=thrC;gene_biotype=protein_coding;locus_tag=TW330
BX072543.1	EMBL	CDS	361919	362971	.	+	0	ID=cds309;Parent=gene309;Dbxref=GOA:Q83HZ1,InterPro:IPR000634,InterPro:IPR001926,InterPro:IPR004450,InterPro:IPR026260,UniProtKB/TrEMBL:Q83HZ1,NCBI_GP:CAD67002.1;Name=CAD67002.1;Note=Similar to Bacillus sp. threonine synthase ThrC SWALL:THRC_BACSP (SWALL:P09123) (352 aa) fasta scores: E(): 4.9e-61%2C 49.14%25 id in 350 aa;gbkey=CDS;gene=thrC;product=threonine synthase;protein_id=CAD67002.1;transl_table=11
BX072543.1	EMBL	sequence_feature	361985	362858	.	+	.	ID=id650;Note=Pyridoxal-phosphate dependent enzyme Score %3D 265.9 E-value %3D 3.8e-77;gbkey=misc_feature;gene=thrC
BX072543.1	EMBL	sequence_feature	362069	362110	.	+	.	ID=id651;Note=PS00165 Serine/threonine dehydratases pyridoxal-phosphate attachment site.;gbkey=misc_feature;gene=thrC
BX072543.1	EMBL	gene	363012	364019	.	+	.	ID=gene310;Name=thrB;gbkey=Gene;gene=thrB;gene_biotype=protein_coding;locus_tag=TW331
BX072543.1	EMBL	CDS	363012	364019	.	+	0	ID=cds310;Parent=gene310;Dbxref=GOA:Q83HZ0,InterPro:IPR000870,InterPro:IPR006204,InterPro:IPR013750,InterPro:IPR014721,InterPro:IPR020568,UniProtKB/TrEMBL:Q83HZ0,NCBI_GP:CAD67003.1;Name=CAD67003.1;Note=Similar to Clostridium acetobutylicum homoserine kinase ThrB or cac1235 SWALL:KHSE_CLOAB (SWALL:Q97JN8) (296 aa) fasta scores: E(): 6.2e-11%2C 30.18%25 id in 318 aa%2C and to Streptomyces coelicolor homoserine kinase ThrB or SCO5356 or SCBAC5H2.25 SWALL:KHSE_STRCO (SWALL:Q9ADB2) (309 aa) fasta scores: E(): 1e-16%2C 42.67%25 id in 321 aa;gbkey=CDS;gene=thrB;product=homoserine kinase;protein_id=CAD67003.1;transl_table=11
BX072543.1	EMBL	sequence_feature	363039	363984	.	+	.	ID=id652;Note=GHMP kinases putative ATP-binding protein Score %3D 133.0 E-value %3D 3.8e-37;gbkey=misc_feature;gene=thrB
BX072543.1	EMBL	gene	364090	365454	.	+	.	ID=gene311;Name=rho;gbkey=Gene;gene=rho;gene_biotype=protein_coding;locus_tag=TW332
BX072543.1	EMBL	CDS	364090	365454	.	+	0	ID=cds311;Parent=gene311;Dbxref=GOA:Q83NM8,InterPro:IPR000194,InterPro:IPR011113,InterPro:IPR012340,InterPro:IPR020003,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NM8,NCBI_GP:CAD67004.1;Name=CAD67004.1;Note=Similar to Streptomyces lividans transcription termination factor Rho SWALL:RHO_STRLI (SWALL:P52157) (707 aa) fasta scores: E(): 1.5e-46%2C 39.79%25 id in 387 aa%2C and to Micrococcus luteus transcription termination factor Rho SWALL:RHO_MICLU (SWALL:P52154) (690 aa) fasta scores: E(): 7.1e-48%2C 41.96%25 id in 386 aa%2C and to Staphylococcus aureus transcription termination factor Rho SWALL:Q9AGF7 (EMBL:AF333962) (443 aa) fasta scores: E(): 1.3e-39%2C 39.36%25 id in 348 aa;gbkey=CDS;gene=rho;product=transcription termination factor Rho;protein_id=CAD67004.1;transl_table=11
BX072543.1	EMBL	sequence_feature	364543	365392	.	+	.	ID=id653;Note=ATP synthase alpha/beta family%2C nucleotide-binding domain Score %3D 62.7 E-value %3D 5.7e-16;gbkey=misc_feature;gene=rho
BX072543.1	EMBL	sequence_feature	365347	365376	.	+	.	ID=id654;Note=PS00152 ATP synthase alpha and beta subunits signature.;gbkey=misc_feature;gene=rho
BX072543.1	EMBL	gene	365530	366573	.	+	.	ID=gene312;Name=prfA;gbkey=Gene;gene=prfA;gene_biotype=protein_coding;locus_tag=TW333
BX072543.1	EMBL	CDS	365530	366573	.	+	0	ID=cds312;Parent=gene312;Dbxref=GOA:Q83NM7,InterPro:IPR000352,InterPro:IPR005139,InterPro:IPR014720,UniProtKB/TrEMBL:Q83NM7,NCBI_GP:CAD67005.1;Name=CAD67005.1;Note=Similar to Escherichia coli peptide chain release factor 1 PrfA or SueB or Uar or b1211 or z1982 or ecs1716 SWALL:RF1_ECOLI (SWALL:P07011) (360 aa) fasta scores: E(): 1.3e-47%2C 44.41%25 id in 322 aa%2C and to Streptomyces coelicolor peptide chain release factor 1 PrfA or SCO5360 or 2SC6G5.04 SWALL:RF1_STRCO (SWALL:Q9K4E4) (358 aa) fasta scores: E(): 3.2e-74%2C 55.11%25 id in 352 aa;gbkey=CDS;gene=prfA;product=peptide chain release factor 1;protein_id=CAD67005.1;transl_table=11
BX072543.1	EMBL	sequence_feature	365701	366049	.	+	.	ID=id655;Note=PCRF domain Score %3D 123.5 E-value %3D 2.8e-34;gbkey=misc_feature;gene=prfA
BX072543.1	EMBL	sequence_feature	366139	366478	.	+	.	ID=id656;Note=Peptidyl-tRNA hydrolase domain Score %3D 212.9 E-value %3D 3.4e-61;gbkey=misc_feature;gene=prfA
BX072543.1	EMBL	gene	366577	367434	.	+	.	ID=gene313;Name=TW334;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW334
BX072543.1	EMBL	CDS	366577	367434	.	+	0	ID=cds313;Parent=gene313;Dbxref=GOA:Q83HY9,InterPro:IPR002052,InterPro:IPR004556,InterPro:IPR019874,InterPro:IPR029063,UniProtKB/TrEMBL:Q83HY9,NCBI_GP:CAD67006.1;Name=CAD67006.1;Note=Similar to Escherichia coli protein methyltransferase HemK or b1212 SWALL:HEMK_ECOLI (SWALL:P37186) (277 aa) fasta scores: E(): 1.1e-18%2C 30.03%25 id in 273 aa;gbkey=CDS;product=putative peptide chain release factor methyltransferase;protein_id=CAD67006.1;transl_table=11
BX072543.1	EMBL	sequence_feature	367144	367164	.	+	.	ID=id657;Note=PS00092 N-6 Adenine-specific DNA methylases signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	367483	368160	.	+	.	ID=gene314;Name=TW335;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW335
BX072543.1	EMBL	CDS	367483	368160	.	+	0	ID=cds314;Parent=gene314;Dbxref=GOA:Q83HY8,InterPro:IPR006070,InterPro:IPR017945,UniProtKB/TrEMBL:Q83HY8,NCBI_GP:CAD67007.1;Name=CAD67007.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5362 or 2SC6G5.06 SWALL:Q9K4E2 (EMBL:AL359152) (215 aa) fasta scores: E(): 9.1e-23%2C 44.44%25 id in 189 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67007.1;transl_table=11
BX072543.1	EMBL	sequence_feature	367540	368101	.	+	.	ID=id658;Note=yrdC domain Score %3D 122.0 E-value %3D 8e-34;gbkey=misc_feature
BX072543.1	EMBL	gene	368207	369307	.	+	.	ID=gene315;Name=TW336;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW336
BX072543.1	EMBL	CDS	368207	369307	.	+	0	ID=cds315;Parent=gene315;Dbxref=GOA:Q83HY7,InterPro:IPR000715,InterPro:IPR018480,UniProtKB/TrEMBL:Q83HY7,NCBI_GP:CAD67008.1;Name=CAD67008.1;Note=Similar to Mycobacterium tuberculosis putative undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase Rfe or rv1302 or mt1341 or mtcy373.22 SWALL:RFE_MYCTU (SWALL:Q10606) (404 aa) fasta scores: E(): 3.8e-34%2C 34.98%25 id in 363 aa%2C and to Yersinia enterocolitica WbcO protein SWALL:Q56918 (EMBL:Z47767) (341 aa) fasta scores: E(): 1.6e-10%2C 27.18%25 id in 320 aa;gbkey=CDS;product=putative glycosyl transferase;protein_id=CAD67008.1;transl_table=11
BX072543.1	EMBL	sequence_feature	368216	368284	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=1/11;partial=true
BX072543.1	EMBL	sequence_feature	368345	368413	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=2/11;partial=true
BX072543.1	EMBL	sequence_feature	368441	368500	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=3/11;partial=true
BX072543.1	EMBL	sequence_feature	368519	368587	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=4/11;partial=true
BX072543.1	EMBL	sequence_feature	368615	368674	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=5/11;partial=true
BX072543.1	EMBL	sequence_feature	368693	368752	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=6/11;partial=true
BX072543.1	EMBL	sequence_feature	368780	368848	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=7/11;partial=true
BX072543.1	EMBL	sequence_feature	368882	368950	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=8/11;partial=true
BX072543.1	EMBL	sequence_feature	368978	369046	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=9/11;partial=true
BX072543.1	EMBL	sequence_feature	369134	369202	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=10/11;partial=true
BX072543.1	EMBL	sequence_feature	369212	369280	.	+	.	ID=id659;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 47-69%2C 79-98%2C 105-127%2C 137-156%2C 163-182%2C 192-214%2C 226-248%2C 258-280%2C 310-332 and 336-358;gbkey=misc_feature;is_ordered=true;part=11/11;partial=true
BX072543.1	EMBL	sequence_feature	368447	368942	.	+	.	ID=id660;Note=Glycosyl transferase Score %3D 107.7 E-value %3D 1.6e-29;gbkey=misc_feature
BX072543.1	EMBL	gene	369348	369785	.	+	.	ID=gene316;Name=atpI;gbkey=Gene;gene=atpI;gene_biotype=protein_coding;locus_tag=TW337
BX072543.1	EMBL	CDS	369348	369785	.	+	0	ID=cds316;Parent=gene316;Dbxref=UniProtKB/TrEMBL:Q83NM6,NCBI_GP:CAD67009.1;Name=CAD67009.1;Note=Similar to Streptomyces coelicolor ATP synthase protein I AtpI or SCO5366 or 2SC6G5.10 SWALL:ATPZ_STRCO (SWALL:P50015) (144 aa) fasta scores: E(): 5.9%2C 20.63%25 id in 126 aa;gbkey=CDS;gene=atpI;product=ATP synthase protein I;protein_id=CAD67009.1;transl_table=11
BX072543.1	EMBL	sequence_feature	369405	369473	.	+	.	ID=id661;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103 and 115-137;gbkey=misc_feature;gene=atpI;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	369492	369560	.	+	.	ID=id661;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103 and 115-137;gbkey=misc_feature;gene=atpI;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	369588	369656	.	+	.	ID=id661;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103 and 115-137;gbkey=misc_feature;gene=atpI;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	369690	369758	.	+	.	ID=id661;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103 and 115-137;gbkey=misc_feature;gene=atpI;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	369786	370601	.	+	.	ID=gene317;Name=atpB;gbkey=Gene;gene=atpB;gene_biotype=protein_coding;locus_tag=TW338
BX072543.1	EMBL	CDS	369786	370601	.	+	0	ID=cds317;Parent=gene317;Dbxref=GOA:Q83HY6,InterPro:IPR000568,UniProtKB/TrEMBL:Q83HY6,NCBI_GP:CAD67010.1;Name=CAD67010.1;Note=Similar to Streptomyces lividans ATP synthase A chain AtpB SWALL:ATP6_STRLI (SWALL:P50012) (281 aa) fasta scores: E(): 9.7e-26%2C 34.2%25 id in 269 aa%2C and to Brevibacterium flavum H+-ATPase A subunit atpB SWALL:Q9ETX4 (EMBL:AB048368) (322 aa) fasta scores: E(): 1.5e-41%2C 48.88%25 id in 270 aa;gbkey=CDS;gene=atpB;product=ATP synthase A chain;protein_id=CAD67010.1;transl_table=11
BX072543.1	EMBL	sequence_feature	369921	369980	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	370092	370160	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	370173	370241	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	370302	370370	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	370434	370502	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	370521	370589	.	+	.	ID=id662;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 103-125%2C 130-152%2C 173-195%2C 217-239 and 246-268;gbkey=misc_feature;gene=atpB;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	370080	370578	.	+	.	ID=id663;Note=ATP synthase A chain Score %3D 111.9 E-value %3D 8.9e-31;gbkey=misc_feature;gene=atpB
BX072543.1	EMBL	gene	370645	370872	.	+	.	ID=gene318;Name=atpE;gbkey=Gene;gene=atpE;gene_biotype=protein_coding;locus_tag=TW339
BX072543.1	EMBL	CDS	370645	370872	.	+	0	ID=cds318;Parent=gene318;Dbxref=GOA:Q83HY5,InterPro:IPR000454,InterPro:IPR002379,InterPro:IPR005953,InterPro:IPR020537,NCBI_GP:CAD67011.1;Name=CAD67011.1;Note=Similar to Bacillus subtilis ATP synthase C chain AtpE SWALL:ATPL_BACSU (SWALL:P37815) (70 aa) fasta scores: E(): 6.5e-07%2C 49.18%25 id in 61 aa;gbkey=CDS;gene=atpE;product=ATP synthase C chain;protein_id=CAD67011.1;transl_table=11
BX072543.1	EMBL	sequence_feature	370672	370740	.	+	.	ID=id664;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32 and 52-74;gbkey=misc_feature;gene=atpE;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	370798	370866	.	+	.	ID=id664;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32 and 52-74;gbkey=misc_feature;gene=atpE;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	370678	370867	.	+	.	ID=id665;Note=ATP synthase subunit C Score %3D 67.7 E-value %3D 1.8e-17;gbkey=misc_feature;gene=atpE
BX072543.1	EMBL	sequence_feature	370762	370827	.	+	.	ID=id666;Note=PS00605 ATP synthase c subunit signature.;gbkey=misc_feature;gene=atpE
BX072543.1	EMBL	gene	370894	371412	.	+	.	ID=gene319;Name=atpF;gbkey=Gene;gene=atpF;gene_biotype=protein_coding;locus_tag=TW340
BX072543.1	EMBL	CDS	370894	371412	.	+	0	ID=cds319;Parent=gene319;Dbxref=GOA:Q83HY4,InterPro:IPR002146,InterPro:IPR005864,InterPro:IPR028987,NCBI_GP:CAD67012.1;Name=CAD67012.1;Note=Similar to Streptomyces lividans ATP synthase B chain AtpF SWALL:ATPF_STRLI (SWALL:P50013) (181 aa) fasta scores: E(): 1.2e-10%2C 32.31%25 id in 164 aa;gbkey=CDS;gene=atpF;product=ATP synthase B chain;protein_id=CAD67012.1;transl_table=11
BX072543.1	EMBL	sequence_feature	370936	371004	.	+	.	ID=id667;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 15-37;gbkey=misc_feature;gene=atpF
BX072543.1	EMBL	sequence_feature	370939	371401	.	+	.	ID=id668;Note=ATP synthase B/B' CF(0) Score %3D 89.7 E-value %3D 4.3e-24;gbkey=misc_feature;gene=atpF
BX072543.1	EMBL	gene	371402	372190	.	+	.	ID=gene320;Name=atpH;gbkey=Gene;gene=atpH;gene_biotype=protein_coding;locus_tag=TW341
BX072543.1	EMBL	CDS	371402	372190	.	+	0	ID=cds320;Parent=gene320;Dbxref=GOA:Q83HY3,InterPro:IPR000711,InterPro:IPR020781,NCBI_GP:CAD67013.1;Name=CAD67013.1;Note=Similar to Streptomyces lividans ATP synthase delta chain AtpH SWALL:ATPD_STRLI (SWALL:P50008) (272 aa) fasta scores: E(): 3.2e-08%2C 27.27%25 id in 264 aa;gbkey=CDS;gene=atpH;product=ATP synthase delta chain;protein_id=CAD67013.1;transl_table=11
BX072543.1	EMBL	sequence_feature	371687	372164	.	+	.	ID=id669;Note=ATP synthase delta (OSCP) subunit Score %3D -30.5 E-value %3D 2.2e-05;gbkey=misc_feature;gene=atpH
BX072543.1	EMBL	sequence_feature	372050	372109	.	+	.	ID=id670;Note=PS00389 ATP synthase delta (OSCP) subunit signature.;gbkey=misc_feature;gene=atpH
BX072543.1	EMBL	gene	372201	373829	.	+	.	ID=gene321;Name=atpA;gbkey=Gene;gene=atpA;gene_biotype=protein_coding;locus_tag=TW342
BX072543.1	EMBL	CDS	372201	373829	.	+	0	ID=cds321;Parent=gene321;Dbxref=GOA:Q83HY2,InterPro:IPR000194,InterPro:IPR000793,InterPro:IPR004100,InterPro:IPR005294,InterPro:IPR020003,InterPro:IPR023366,InterPro:IPR027417,NCBI_GP:CAD67014.1;Name=CAD67014.1;Note=Similar to Streptomyces lividans ATP synthase alpha chain AtpA SWALL:ATPA_STRLI (SWALL:P50001) (528 aa) fasta scores: E(): 3.5e-126%2C 64.96%25 id in 508 aa;gbkey=CDS;gene=atpA;product=ATP synthase alpha chain;protein_id=CAD67014.1;transl_table=11
BX072543.1	EMBL	sequence_feature	372291	372495	.	+	.	ID=id671;Note=ATP synthase alpha/beta family%2C beta-barrel domain Score %3D 66.7 E-value %3D 3.4e-17;gbkey=misc_feature;gene=atpA
BX072543.1	EMBL	sequence_feature	372504	373347	.	+	.	ID=id672;Note=ATP synthase alpha/beta family%2C nucleotide-binding domain Score %3D 503.6 E-value %3D 1.1e-148;gbkey=misc_feature;gene=atpA
BX072543.1	EMBL	sequence_feature	372726	372749	.	+	.	ID=id673;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=atpA
BX072543.1	EMBL	sequence_feature	373302	373331	.	+	.	ID=id674;Note=PS00152 ATP synthase alpha and beta subunits signature.;gbkey=misc_feature;gene=atpA
BX072543.1	EMBL	sequence_feature	373353	373644	.	+	.	ID=id675;Note=ATP synthase alpha/beta chain%2C C terminal domain Score %3D 86.0 E-value %3D 5.2e-23;gbkey=misc_feature;gene=atpA
BX072543.1	EMBL	gene	373849	374859	.	+	.	ID=gene322;Name=atpG;gbkey=Gene;gene=atpG;gene_biotype=protein_coding;locus_tag=TW343
BX072543.1	EMBL	CDS	373849	374859	.	+	0	ID=cds322;Parent=gene322;Dbxref=GOA:Q83HY1,InterPro:IPR000131,InterPro:IPR023633,UniProtKB/TrEMBL:Q83HY1,NCBI_GP:CAD67015.1;Name=CAD67015.1;Note=Similar to Streptomyces lividans ATP synthase gamma chain AtpG SWALL:ATPG_STRLI (SWALL:P50007) (302 aa) fasta scores: E(): 4.5e-22%2C 43.07%25 id in 332 aa;gbkey=CDS;gene=atpG;product=ATP synthase gamma chain;protein_id=CAD67015.1;transl_table=11
BX072543.1	EMBL	sequence_feature	373855	374845	.	+	.	ID=id676;Note=ATP synthase Score %3D 294.3 E-value %3D 1.1e-85;gbkey=misc_feature;gene=atpG
BX072543.1	EMBL	gene	374908	376332	.	+	.	ID=gene323;Name=atpD;gbkey=Gene;gene=atpD;gene_biotype=protein_coding;locus_tag=TW344
BX072543.1	EMBL	CDS	374908	376332	.	+	0	ID=cds323;Parent=gene323;Dbxref=GOA:Q83HY0,InterPro:IPR000194,InterPro:IPR000793,InterPro:IPR003593,InterPro:IPR004100,InterPro:IPR005722,InterPro:IPR020003,InterPro:IPR024034,InterPro:IPR027417,NCBI_GP:CAD67016.1;Name=CAD67016.1;Note=Similar to Streptomyces lividans ATP synthase beta chain AtpD SWALL:ATPB_STRCO (SWALL:P50004) (477 aa) fasta scores: E(): 1.2e-122%2C 72.89%25 id in 476 aa;gbkey=CDS;gene=atpD;product=ATP synthase beta chain;protein_id=CAD67016.1;transl_table=11
BX072543.1	EMBL	sequence_feature	374932	375145	.	+	.	ID=id677;Note=ATP synthase alpha/beta family%2C beta-barrel domain Score %3D 94.3 E-value %3D 1.7e-25;gbkey=misc_feature;gene=atpD
BX072543.1	EMBL	sequence_feature	375154	375976	.	+	.	ID=id678;Note=ATP synthase alpha/beta family%2C nucleotide-binding domain Score %3D 454.9 E-value %3D 4.9e-134;gbkey=misc_feature;gene=atpD
BX072543.1	EMBL	sequence_feature	375379	375402	.	+	.	ID=id679;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=atpD
BX072543.1	EMBL	sequence_feature	375931	375960	.	+	.	ID=id680;Note=PS00152 ATP synthase alpha and beta subunits signature.;gbkey=misc_feature;gene=atpD
BX072543.1	EMBL	sequence_feature	375985	376318	.	+	.	ID=id681;Note=ATP synthase alpha/beta chain%2C C terminal domain Score %3D 152.0 E-value %3D 7.5e-43;gbkey=misc_feature;gene=atpD
BX072543.1	EMBL	gene	376334	376618	.	+	.	ID=gene324;Name=atpC;gbkey=Gene;gene=atpC;gene_biotype=protein_coding;locus_tag=TW345
BX072543.1	EMBL	CDS	376334	376618	.	+	0	ID=cds324;Parent=gene324;Dbxref=GOA:Q83HX9,InterPro:IPR020546,UniProtKB/TrEMBL:Q83HX9,NCBI_GP:CAD67017.1;Name=CAD67017.1;Note=Similar to Streptomyces lividans ATP synthase epsilon chain AtpC SWALL:ATPE_STRCO (SWALL:P50011) (123 aa) fasta scores: E(): 7.2e-05%2C 35.48%25 id in 93 aa;gbkey=CDS;gene=atpC;product=ATP synthase epsilon chain;protein_id=CAD67017.1;transl_table=11
BX072543.1	EMBL	sequence_feature	376340	376586	.	+	.	ID=id682;Note=ATP synthase%2C Delta/Epsilon chain%2C beta-sandwich domain Score %3D 24.1 E-value %3D 6.8e-06;gbkey=misc_feature;gene=atpC
BX072543.1	EMBL	sequence_feature	376676	376744	.	+	.	ID=id683;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 15-37;gbkey=misc_feature
BX072543.1	EMBL	gene	376790	377062	.	+	.	ID=gene325;Name=rpsO;gbkey=Gene;gene=rpsO;gene_biotype=protein_coding;locus_tag=TW346
BX072543.1	EMBL	CDS	376790	377062	.	+	0	ID=cds325;Parent=gene325;Dbxref=GOA:Q83HX8,InterPro:IPR000589,InterPro:IPR005290,InterPro:IPR009068,NCBI_GP:CAD67018.1;Name=CAD67018.1;Note=Similar to Escherichia coli 30s ribosomal protein S15 RpsO or SecC or b3165 SWALL:RS15_ECOLI (SWALL:P02371) (88 aa) fasta scores: E(): 7.7e-15%2C 58.22%25 id in 79 aa;gbkey=CDS;gene=rpsO;product=30s ribosomal protein S15;protein_id=CAD67018.1;transl_table=11
BX072543.1	EMBL	sequence_feature	376796	377054	.	+	.	ID=id684;Note=Ribosomal protein S15 Score %3D 122.3 E-value %3D 6.2e-34;gbkey=misc_feature;gene=rpsO
BX072543.1	EMBL	sequence_feature	376907	376999	.	+	.	ID=id685;Note=PS00362 Ribosomal protein S15 signature.;gbkey=misc_feature;gene=rpsO
BX072543.1	EMBL	gene	377107	379314	.	+	.	ID=gene326;Name=pnp;gbkey=Gene;gene=pnp;gene_biotype=protein_coding;locus_tag=TW347
BX072543.1	EMBL	CDS	377107	379314	.	+	0	ID=cds326;Parent=gene326;Dbxref=GOA:Q820Y9,InterPro:IPR001247,InterPro:IPR003029,InterPro:IPR004087,InterPro:IPR004088,InterPro:IPR012162,InterPro:IPR012340,InterPro:IPR014069,InterPro:IPR015847,InterPro:IPR015848,InterPro:IPR020568,InterPro:IPR022967,InterPro:IPR027408,NCBI_GP:CAD67019.1;Name=CAD67019.1;Note=Similar to Streptomyces antibioticus guanosine pentaphosphate synthetase GpsI SWALL:Q53597 (EMBL:U19858) (740 aa) fasta scores: E(): 1.3e-101%2C 60.97%25 id in 738 aa%2C and to Yersinia enterocolitica polyribonucleotide nucleotidyltransferase Pnp SWALL:PNP_YEREN (SWALL:O34275) (706 aa) fasta scores: E(): 1.7e-59%2C 42.11%25 id in 729 aa;gbkey=CDS;gene=pnp;product=mRNA processing exonuclease;protein_id=CAD67019.1;transl_table=11
BX072543.1	EMBL	sequence_feature	377146	377545	.	+	.	ID=id686;Note=3' exoribonuclease family%2C domain 1 Score %3D 111.4 E-value %3D 1.2e-30;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	377554	377719	.	+	.	ID=id687;Note=3' exoribonuclease family%2C domain 2 Score %3D 20.7 E-value %3D 1.3e-05;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	377908	378169	.	+	.	ID=id688;Note=Polyribonucleotide nucleotidyltransferase%2C RNA binding domain Score %3D 7.5 E-value %3D 0.00036;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	378178	378577	.	+	.	ID=id689;Note=3' exoribonuclease family%2C domain 1 Score %3D 162.4 E-value %3D 5.4e-46;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	378586	378808	.	+	.	ID=id690;Note=3' exoribonuclease family%2C domain 2 Score %3D 82.4 E-value %3D 6.5e-22;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	378889	379015	.	+	.	ID=id691;Note=KH domain Score %3D 41.9 E-value %3D 1e-09;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	sequence_feature	379078	379309	.	+	.	ID=id692;Note=S1 RNA binding domain Score %3D 39.9 E-value %3D 4.1e-09;gbkey=misc_feature;gene=pnp
BX072543.1	EMBL	gene	379342	380280	.	+	.	ID=gene327;Name=TW348;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW348
BX072543.1	EMBL	CDS	379342	380280	.	+	0	ID=cds327;Parent=gene327;Dbxref=GOA:Q83NM5,InterPro:IPR002524,InterPro:IPR027469,UniProtKB/TrEMBL:Q83NM5,NCBI_GP:CAD67020.1;Name=CAD67020.1;Note=Similar to Alcaligenes eutrophus cobalt-zinc-cadmium resistance protein CzcD SWALL:CZCD_ALCEU (SWALL:P13512) (316 aa) fasta scores: E(): 8e-25%2C 34.72%25 id in 288 aa%2C and to Escherichia coli zinc transporter ZitB or b0752 SWALL:ZITB_ECOLI (SWALL:P75757) (313 aa) fasta scores: E(): 1.6e-24%2C 31.92%25 id in 307 aa;gbkey=CDS;product=putative cation efflux protein;protein_id=CAD67020.1;transl_table=11
BX072543.1	EMBL	sequence_feature	379417	380239	.	+	.	ID=id693;Note=Cation efflux family Score %3D 222.9 E-value %3D 3.3e-64;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	379417	379485	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	379513	379572	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	379609	379677	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	379720	379788	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	379807	379875	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	379888	379956	.	+	.	ID=id694;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 58-77%2C 90-112%2C 127-149%2C 156-178 and 183-205;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	gene	380264	381343	.	-	.	ID=gene328;Name=TW349;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW349
BX072543.1	EMBL	CDS	380264	381343	.	-	0	ID=cds328;Parent=gene328;Dbxref=InterPro:IPR002549,UniProtKB/TrEMBL:Q83HX7,NCBI_GP:CAD67021.1;Name=CAD67021.1;Note=Similar to Clostridium acetobutylicum predicted permease cac1677 SWALL:Q97IG4 (EMBL:AE007677) (341 aa) fasta scores: E(): 4.9e-14%2C 25.91%25 id in 328 aa;gbkey=CDS;product=conserved hypothetical integral membrane protein;protein_id=CAD67021.1;transl_table=11
BX072543.1	EMBL	sequence_feature	380281	381244	.	-	.	ID=id695;Note=Domain of unknown function DUF20 Score %3D 138.3 E-value %3D 9.5e-39;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	381218	381286	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	381131	381199	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	381035	381103	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	380795	380863	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	380606	380674	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	380519	380587	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	380423	380491	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	380291	380386	.	-	.	ID=id696;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-71%2C 81-103%2C 161-183%2C 224-246%2C 253-275%2C 285-307 and 320-351;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	gene	381354	383045	.	-	.	ID=gene329;Name=TW350;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW350
BX072543.1	EMBL	CDS	381354	383045	.	-	0	ID=cds329;Parent=gene329;Dbxref=InterPro:IPR007793,UniProtKB/TrEMBL:Q83NM4,NCBI_GP:CAD67022.1;Name=CAD67022.1;Note=N-terminal region similar to that of Streptomyces reticuli AbpS protein SWALL:O07481 (EMBL:Z97071) (311 aa) fasta scores: E(): 3.2e-06%2C 26.68%25 id in 296 aa;gbkey=CDS;product=putative low complexity hydrophilic protein;protein_id=CAD67022.1;transl_table=11
BX072543.1	EMBL	gene	383069	384745	.	+	.	ID=gene330;Name=TW351;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW351
BX072543.1	EMBL	CDS	383069	384745	.	+	0	ID=cds330;Parent=gene330;Dbxref=UniProtKB/TrEMBL:Q83NM3,NCBI_GP:CAD67023.1;Name=CAD67023.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67023.1;transl_table=11
BX072543.1	EMBL	sequence_feature	383069	383173	.	+	.	ID=id697;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.811) with cleavage site probability 0.388 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	383129	383197	.	+	.	ID=id698;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 184-206 and 232-254;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	383618	383686	.	+	.	ID=id698;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 184-206 and 232-254;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	383762	383830	.	+	.	ID=id698;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 184-206 and 232-254;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	384742	385893	.	+	.	ID=gene331;Name=TW352;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW352
BX072543.1	EMBL	CDS	384742	385893	.	+	0	ID=cds331;Parent=gene331;Dbxref=GOA:Q83HX6,InterPro:IPR000192,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,InterPro:IPR016454,UniProtKB/TrEMBL:Q83HX6,NCBI_GP:CAD67024.1;Name=CAD67024.1;Note=Similar to Rhodobacter sphaeroides cysteine desulfurase NifS SWALL:NIFS_RHOSH (SWALL:Q01179) (387 aa) fasta scores: E(): 6.7e-25%2C 31.34%25 id in 386 aa%2C and to Methanosarcina thermophila probable cysteine desulfurase IscS or NifS SWALL:ISCS_METTE (SWALL:P57795) (404 aa) fasta scores: E(): 1.2e-19%2C 32.29%25 id in 387 aa;gbkey=CDS;product=putative aminotransferase;protein_id=CAD67024.1;transl_table=11
BX072543.1	EMBL	sequence_feature	384784	385843	.	+	.	ID=id699;Note=Aminotransferase class-V Score %3D 100.2 E-value %3D 2.8e-27;gbkey=misc_feature
BX072543.1	EMBL	gene	385916	386995	.	+	.	ID=gene332;Name=trmU;gbkey=Gene;gene=trmU;gene_biotype=protein_coding;locus_tag=TW353
BX072543.1	EMBL	CDS	385916	386995	.	+	0	ID=cds332;Parent=gene332;Dbxref=GOA:Q83HX5,InterPro:IPR004506,InterPro:IPR014729,InterPro:IPR023382,NCBI_GP:CAD67025.1;Name=CAD67025.1;Note=Similar to Streptomyces coelicolor probable t TrmU or SCO5488 or SC2A11.22 SWALL:TRMU_STRCO (SWALL:O86583) (376 aa) fasta scores: E(): 6.8e-81%2C 57.45%25 id in 362 aa;gbkey=CDS;gene=trmU;product=probable tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;protein_id=CAD67025.1;transl_table=11
BX072543.1	EMBL	sequence_feature	385916	386963	.	+	.	ID=id700;Note=tRNA methyl transferase Score %3D 490.6 E-value %3D 8.4e-145;gbkey=misc_feature;gene=trmU
BX072543.1	EMBL	gene	386982	388868	.	+	.	ID=gene333;Name=ligA;gbkey=Gene;gene=ligA;gene_biotype=protein_coding;locus_tag=TW354
BX072543.1	EMBL	CDS	386982	388868	.	+	0	ID=cds333;Parent=gene333;Dbxref=GOA:Q83HX4,InterPro:IPR001679,InterPro:IPR003583,InterPro:IPR004149,InterPro:IPR004150,InterPro:IPR010994,InterPro:IPR012340,InterPro:IPR013839,InterPro:IPR013840,InterPro:IPR018239,NCBI_GP:CAD67026.1;Name=CAD67026.1;Note=Similar to Rhodothermus marinus DNA ligase LigA or Lig SWALL:DNLJ_RHOMR (SWALL:P49421) (712 aa) fasta scores: E(): 2.1e-36%2C 35.52%25 id in 625 aa;gbkey=CDS;gene=ligA;product=DNA ligase;protein_id=CAD67026.1;transl_table=11
BX072543.1	EMBL	sequence_feature	386997	387990	.	+	.	ID=id701;Note=NAD-dependent DNA ligase adenylation domain Score %3D 285.4 E-value %3D 5e-83;gbkey=misc_feature;gene=ligA
BX072543.1	EMBL	sequence_feature	387996	388242	.	+	.	ID=id702;Note=NAD-dependent DNA ligase OB-fold domain Score %3D 143.6 E-value %3D 2.4e-40;gbkey=misc_feature;gene=ligA
BX072543.1	EMBL	sequence_feature	388254	388341	.	+	.	ID=id703;Note=NAD-dependent DNA ligase C4 zinc finger domain Score %3D 28.3 E-value %3D 1.3e-05;gbkey=misc_feature;gene=ligA
BX072543.1	EMBL	gene	389007	389309	.	+	.	ID=gene334;Name=gatC;gbkey=Gene;gene=gatC;gene_biotype=protein_coding;locus_tag=TW355
BX072543.1	EMBL	CDS	389007	389309	.	+	0	ID=cds334;Parent=gene334;Dbxref=GOA:Q83HX3,UniProtKB/TrEMBL:Q83HX3,NCBI_GP:CAD67027.1;Name=CAD67027.1;Note=Similar to Bacillus subtilis glutamyl-tRNA(gln) amidotransferase subunit C GatC SWALL:GATC_BACSU (SWALL:O06492) (96 aa) fasta scores: E(): 0.43%2C 28.86%25 id in 97 aa;gbkey=CDS;gene=gatC;product=glutamyl-tRNA(gln) amidotransferase subunit C;protein_id=CAD67027.1;transl_table=11
BX072543.1	EMBL	gene	389299	390780	.	+	.	ID=gene335;Name=gatA;gbkey=Gene;gene=gatA;gene_biotype=protein_coding;locus_tag=TW356
BX072543.1	EMBL	CDS	389299	390780	.	+	0	ID=cds335;Parent=gene335;Dbxref=GOA:Q83HX2,InterPro:IPR000120,InterPro:IPR004412,InterPro:IPR020556,InterPro:IPR023631,NCBI_GP:CAD67028.1;Name=CAD67028.1;Note=Similar to Bacillus subtilis glutamyl-tRNA (gln) amidotransferase subunit A GatA SWALL:GATA_BACSU (SWALL:O06491) (485 aa) fasta scores: E(): 3.1e-69%2C 44.44%25 id in 477 aa;gbkey=CDS;gene=gatA;product=glutamyl-tRNA (gln) amidotransferase subunit A;protein_id=CAD67028.1;transl_table=11
BX072543.1	EMBL	sequence_feature	389365	390694	.	+	.	ID=id704;Note=Amidase Score %3D 549.4 E-value %3D 1.7e-162;gbkey=misc_feature;gene=gatA
BX072543.1	EMBL	gene	390777	392291	.	+	.	ID=gene336;Name=gatB;gbkey=Gene;gene=gatB;gene_biotype=protein_coding;locus_tag=TW357
BX072543.1	EMBL	CDS	390777	392291	.	+	0	ID=cds336;Parent=gene336;Dbxref=GOA:Q83HX1,InterPro:IPR003789,InterPro:IPR004413,InterPro:IPR006075,InterPro:IPR017958,InterPro:IPR017959,InterPro:IPR018027,NCBI_GP:CAD67029.1;Name=CAD67029.1;Note=Similar to Streptomyces coelicolor glutamyl-tRNA (gln) amidotransferase subunit B GatB or SCO5501 or SC8D9.13 SWALL:GATB_STRCO (SWALL:Q9Z578) (504 aa) fasta scores: E(): 4.3e-90%2C 47.02%25 id in 504 aa;gbkey=CDS;gene=gatB;product=glutamyl-tRNA (gln) amidotransferase subunit B;protein_id=CAD67029.1;transl_table=11
BX072543.1	EMBL	sequence_feature	390810	391584	.	+	.	ID=id705;Note=PET112 family%2C N terminal region Score %3D 431.1 E-value %3D 7.1e-127;gbkey=misc_feature;gene=gatB
BX072543.1	EMBL	sequence_feature	391275	391322	.	+	.	ID=id706;Note=PS01234 PET112 family signature.;gbkey=misc_feature;gene=gatB
BX072543.1	EMBL	sequence_feature	391635	391839	.	+	.	ID=id707;Note=PET112 family%2C C terminal region Score %3D 52.0 E-value %3D 9.3e-13;gbkey=misc_feature;gene=gatB
BX072543.1	EMBL	sequence_feature	391842	392277	.	+	.	ID=id708;Note=GatB/Yqey domain Score %3D 83.8 E-value %3D 2.4e-22;gbkey=misc_feature;gene=gatB
BX072543.1	EMBL	gene	392340	393296	.	-	.	ID=gene337;Name=TW358;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW358
BX072543.1	EMBL	CDS	392340	393296	.	-	0	ID=cds337;Parent=gene337;Dbxref=InterPro:IPR005135,UniProtKB/TrEMBL:Q83NM2,NCBI_GP:CAD67030.1;Name=CAD67030.1;Note=Weakly similar to Streptomyces coelicolor putative membrane protein SCO7017 or SC1H10.06c SWALL:Q9L038 (EMBL:AL352956) (301 aa) fasta scores: E(): 0.034%2C 23.64%25 id in 313 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67030.1;transl_table=11
BX072543.1	EMBL	sequence_feature	393237	393284	.	-	.	ID=id709;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-20 and 35-57;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	393126	393194	.	-	.	ID=id709;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-20 and 35-57;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	393207	393296	.	-	.	ID=id710;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.993) with cleavage site probability 0.381 between residues 30 and 31;gbkey=misc_feature
BX072543.1	EMBL	gene	393620	394174	.	+	.	ID=gene338;Name=TW360;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW360
BX072543.1	EMBL	CDS	393620	394174	.	+	0	ID=cds338;Parent=gene338;Dbxref=InterPro:IPR017195,UniProtKB/TrEMBL:Q83NM1,NCBI_GP:CAD67031.1;Name=CAD67031.1;Note=Similar to Corynebacterium glutamicum ABC-type transporter%2C permease components cgl1078 SWALL:BAB98471 (EMBL:AP005277) (196 aa) fasta scores: E(): 4.9e-17%2C 37.12%25 id in 167 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67031.1;transl_table=11
BX072543.1	EMBL	sequence_feature	393665	393733	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	393743	393802	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	393815	393883	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	393893	393946	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	393965	394033	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	394046	394114	.	+	.	ID=id711;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 3-25%2C 29-48%2C 53-75%2C 79-96%2C 103-125 and 130-152;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	gene	394242	395789	.	+	.	ID=gene339;Name=TW361;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW361
BX072543.1	EMBL	CDS	394242	395789	.	+	0	ID=cds339;Parent=gene339;Dbxref=GOA:Q83HX0,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HX0,NCBI_GP:CAD67032.1;Name=CAD67032.1;Note=Similar to Staphylococcus aureus Mw0959 protein SWALL:BAB94824 (EMBL:AP004825) (466 aa) fasta scores: E(): 1.1e-17%2C 29.5%25 id in 505 aa%2C and to Escherichia coli taurine transport ATP-binding protein TauB or SsiB or b0366 SWALL:TAUB_ECOLI (SWALL:Q47538) (255 aa) fasta scores: E(): 2e-10%2C 30.73%25 id in 218 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD67032.1;transl_table=11
BX072543.1	EMBL	sequence_feature	394365	394908	.	+	.	ID=id712;Note=ABC transporter Score %3D 111.0 E-value %3D 1.6e-30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	394386	394409	.	+	.	ID=id713;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	394668	394712	.	+	.	ID=id714;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	395130	395769	.	+	.	ID=id715;Note=ABC transporter Score %3D 113.0 E-value %3D 4e-31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	395151	395174	.	+	.	ID=id716;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	395780	396508	.	+	.	ID=gene340;Name=TW362;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW362
BX072543.1	EMBL	CDS	395780	396508	.	+	0	ID=cds340;Parent=gene340;Dbxref=InterPro:IPR003339,UniProtKB/TrEMBL:Q83NM0,NCBI_GP:CAD67033.1;Name=CAD67033.1;Note=Similar to Corynebacterium glutamicum ABC-type transporter%2C permease components cgl1080 SWALL:BAB98473 (EMBL:AP005277) (251 aa) fasta scores: E(): 1.9e-14%2C 28.8%25 id in 243 aa;gbkey=CDS;product=putative ABC transporter integral membrane subunit;protein_id=CAD67033.1;transl_table=11
BX072543.1	EMBL	sequence_feature	395822	395881	.	+	.	ID=id717;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 55-77%2C 102-124 and 218-240;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	395942	396010	.	+	.	ID=id717;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 55-77%2C 102-124 and 218-240;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	396083	396151	.	+	.	ID=id717;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 55-77%2C 102-124 and 218-240;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	396431	396499	.	+	.	ID=id717;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 55-77%2C 102-124 and 218-240;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	tRNA	396563	396635	.	-	.	ID=rna16;Note=tRNA Arg anticodon TCT%2C Cove score 75.85;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	exon	396563	396635	.	-	.	ID=id718;Parent=rna16;Note=tRNA Arg anticodon TCT%2C Cove score 75.85;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	gene	396636	396851	.	-	.	ID=gene341;Name=TW363;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW363
BX072543.1	EMBL	CDS	396636	396851	.	-	0	ID=cds341;Parent=gene341;Dbxref=UniProtKB/TrEMBL:Q83NL9,NCBI_GP:CAD67034.1;Name=CAD67034.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO4848 or SC5G8.16 SWALL:Q9KZ98 (EMBL:AL353872) (79 aa) fasta scores: E(): 1.2%2C 31.74%25 id in 63 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67034.1;transl_table=11
BX072543.1	EMBL	sequence_feature	396771	396839	.	-	.	ID=id719;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27 and 48-70;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	396642	396710	.	-	.	ID=id719;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27 and 48-70;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	396883	397437	.	+	.	ID=gene342;Name=orn;gbkey=Gene;gene=orn;gene_biotype=protein_coding;locus_tag=TW364
BX072543.1	EMBL	CDS	396883	397437	.	+	0	ID=cds342;Parent=gene342;Dbxref=GOA:Q83HW9,InterPro:IPR006055,InterPro:IPR012337,InterPro:IPR013520,InterPro:IPR022894,NCBI_GP:CAD67035.1;Name=CAD67035.1;Note=Similar to Streptomyces coelicolor oligoribonuclease Orn or OrnA or SCO2793 or 2SCC13.01 SWALL:ORN_STRCO (SWALL:P57666) (200 aa) fasta scores: E(): 8.3e-30%2C 51.76%25 id in 170 aa;gbkey=CDS;gene=orn;product=oligoribonuclease;protein_id=CAD67035.1;transl_table=11
BX072543.1	EMBL	sequence_feature	396910	397420	.	+	.	ID=id720;Note=Exonuclease Score %3D 87.7 E-value %3D 1.6e-23;gbkey=misc_feature;gene=orn
BX072543.1	EMBL	tRNA	397480	397552	.	+	.	ID=rna17;Note=tRNA His anticodon GTG%2C Cove score 79.87;gbkey=tRNA;product=tRNA-His
BX072543.1	EMBL	exon	397480	397552	.	+	.	ID=id721;Parent=rna17;Note=tRNA His anticodon GTG%2C Cove score 79.87;gbkey=tRNA;product=tRNA-His
BX072543.1	EMBL	gene	397571	398386	.	+	.	ID=gene343;Name=nadE;gbkey=Gene;gene=nadE;gene_biotype=protein_coding;locus_tag=TW365
BX072543.1	EMBL	CDS	397571	398386	.	+	0	ID=cds343;Parent=gene343;Dbxref=GOA:Q83HW8,InterPro:IPR003694,InterPro:IPR014729,InterPro:IPR022310,InterPro:IPR022926,NCBI_GP:CAD67036.1;Name=CAD67036.1;Note=Similar to Bacillus subtilis NH(3)-dependent NAD(+) synthetase NadE or OutB SWALL:NADE_BACSU (SWALL:P08164) (271 aa) fasta scores: E(): 1.1e-55%2C 55.26%25 id in 266 aa;gbkey=CDS;gene=nadE;product=NH(3)-dependent NAD(+) synthetase;protein_id=CAD67036.1;transl_table=11
BX072543.1	EMBL	sequence_feature	397802	398363	.	+	.	ID=id722;Note=NAD synthase Score %3D 170.5 E-value %3D 2e-48;gbkey=misc_feature;gene=nadE
BX072543.1	EMBL	gene	398438	399064	.	-	.	ID=gene344;Name=TW366;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW366
BX072543.1	EMBL	CDS	398438	399064	.	-	0	ID=cds344;Parent=gene344;Dbxref=UniProtKB/TrEMBL:Q83NL8,NCBI_GP:CAD67037.1;Name=CAD67037.1;gbkey=CDS;product=putative membrane protein;protein_id=CAD67037.1;transl_table=11
BX072543.1	EMBL	sequence_feature	399014	399064	.	-	.	ID=id723;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 15-37;gbkey=misc_feature
BX072543.1	EMBL	gene	399273	399719	.	+	.	ID=gene345;Name=ssb2;gbkey=Gene;gene=ssb2;gene_biotype=protein_coding;locus_tag=TW367
BX072543.1	EMBL	CDS	399273	399719	.	+	0	ID=cds345;Parent=gene345;Dbxref=GOA:P66857,InterPro:IPR000424,InterPro:IPR011344,InterPro:IPR012340,NCBI_GP:CAD67038.1;Name=CAD67038.1;Note=Similar to Streptomyces coelicolor putative single-strand DNA binding protein SCO2683 or SCC61A.04c SWALL:Q9KYI9 (EMBL:AL356595) (156 aa) fasta scores: E(): 2.4e-10%2C 41.07%25 id in 112 aa%2C and to Mycobacterium tuberculosis single-strand binding protein Ssb or rv0054 or mt0060 or mtcy21d4.17 SWALL:SSB_MYCTU (SWALL:P71711) (164 aa) fasta scores: E(): 1.6e-07%2C 30.08%25 id in 113 aa;gbkey=CDS;gene=ssb2;product=single-strand DNA binding protein;protein_id=CAD67038.1;transl_table=11
BX072543.1	EMBL	sequence_feature	399288	399606	.	+	.	ID=id724;Note=Single-strand binding protein family Score %3D 20.5 E-value %3D 2.7e-06;gbkey=misc_feature;gene=ssb2
BX072543.1	EMBL	gene	399868	400374	.	+	.	ID=gene346;Name=TW368;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW368
BX072543.1	EMBL	CDS	399868	400374	.	+	0	ID=cds346;Parent=gene346;Dbxref=UniProtKB/TrEMBL:Q83NL6,NCBI_GP:CAD67039.1;Name=CAD67039.1;Note=No significant database matches. Note possible alternative downstream start codons;gbkey=CDS;product=putative secreted protein;protein_id=CAD67039.1;transl_table=11
BX072543.1	EMBL	sequence_feature	399895	400005	.	+	.	ID=id725;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.973) with cleavage site probability 0.654 between residues 50 and 51;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	399916	399984	.	+	.	ID=id726;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-43;gbkey=misc_feature
BX072543.1	EMBL	gene	400381	402051	.	+	.	ID=gene347;Name=TW369;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW369
BX072543.1	EMBL	CDS	400381	402051	.	+	0	ID=cds347;Parent=gene347;Dbxref=GOA:Q83HW7,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR022374,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HW7,NCBI_GP:CAD67040.1;Name=CAD67040.1;Note=Strongly conserved. Similar to Streptomyces coelicolor putative ABC transpoter ATP-binding protein SCO2677 or SC6D10.20c SWALL:Q9L244 (EMBL:AL138538) (547 aa) fasta scores: E(): 2.2e-112%2C 66.23%25 id in 545 aa%2C and to Escherichia coli O157:H7 ABC transporter ATP-binding protein YjjK or b4391 or z5993 or ecs5349 SWALL:YJJK_ECOLI (SWALL:P37797) (554 aa) fasta scores: E(): 5.3e-84%2C 50.82%25 id in 547 aa;gbkey=CDS;product=putative ABC transporter ATP-binding protein;protein_id=CAD67040.1;transl_table=11
BX072543.1	EMBL	sequence_feature	400471	401080	.	+	.	ID=id727;Note=ABC transporter Score %3D 175.2 E-value %3D 7.6e-50;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	400492	400515	.	+	.	ID=id728;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	400864	400908	.	+	.	ID=id729;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	401425	401929	.	+	.	ID=id730;Note=ABC transporter Score %3D 121.8 E-value %3D 9.2e-34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	401446	401469	.	+	.	ID=id731;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	401713	401757	.	+	.	ID=id732;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	402051	402527	.	+	.	ID=gene348;Name=TW370;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW370
BX072543.1	EMBL	CDS	402051	402527	.	+	0	ID=cds348;Parent=gene348;Dbxref=InterPro:IPR029069,UniProtKB/TrEMBL:Q83HW6,NCBI_GP:CAD67041.1;Name=CAD67041.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2676 or SC6D10.19c SWALL:Q9L245 (EMBL:AL138538) (136 aa) fasta scores: E(): 3.1e-05%2C 34.64%25 id in 153 aa;gbkey=CDS;product=hypothetical protein;protein_id=CAD67041.1;transl_table=11
BX072543.1	EMBL	gene	402731	405247	.	-	.	ID=gene349;Name=pepN;gbkey=Gene;gene=pepN;gene_biotype=protein_coding;locus_tag=TW371
BX072543.1	EMBL	CDS	402731	405247	.	-	0	ID=cds349;Parent=gene349;Dbxref=GOA:Q83HW5,InterPro:IPR001930,InterPro:IPR012778,InterPro:IPR014782,InterPro:IPR024571,UniProtKB/TrEMBL:Q83HW5,NCBI_GP:CAD67042.1;Name=CAD67042.1;Note=Similar to Streptomyces lividans aminopeptidase N PepN SWALL:AMPN_STRLI (SWALL:Q11010) (857 aa) fasta scores: E(): 8.4e-69%2C 39.86%25 id in 858 aa;gbkey=CDS;gene=pepN;product=aminopeptidase N;protein_id=CAD67042.1;transl_table=11
BX072543.1	EMBL	sequence_feature	404065	405208	.	-	.	ID=id733;Note=Peptidase family M1 Score %3D 279.5 E-value %3D 3e-81;gbkey=misc_feature;gene=pepN
BX072543.1	EMBL	sequence_feature	404312	404341	.	-	.	ID=id734;Note=PS00142 Neutral zinc metallopeptidases%2C zinc-binding region signature.;gbkey=misc_feature;gene=pepN
BX072543.1	EMBL	gene	405395	406006	.	+	.	ID=gene350;Name=TW372;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW372
BX072543.1	EMBL	CDS	405395	406006	.	+	0	ID=cds350;Parent=gene350;Dbxref=InterPro:IPR012336,UniProtKB/TrEMBL:Q83HW4,NCBI_GP:CAD67043.1;Name=CAD67043.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2466c or mtv008.22C SWALL:O53193 (EMBL:AL021246) (207 aa) fasta scores: E(): 1e-25%2C 41.91%25 id in 198 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67043.1;transl_table=11
BX072543.1	EMBL	gene	406008	406475	.	+	.	ID=gene351;Name=rpiB;gbkey=Gene;gene=rpiB;gene_biotype=protein_coding;locus_tag=TW373
BX072543.1	EMBL	CDS	406008	406475	.	+	0	ID=cds351;Parent=gene351;Dbxref=GOA:Q83HW3,InterPro:IPR003500,InterPro:IPR011860,UniProtKB/TrEMBL:Q83HW3,NCBI_GP:CAD67044.1;Name=CAD67044.1;Note=Similar to Escherichia coli ribose 5-phosphate isomerase B RpiB or b4090 SWALL:RPIB_ECOLI (SWALL:P37351) (149 aa) fasta scores: E(): 1e-09%2C 32.21%25 id in 149 aa%2C and to Streptomyces coelicolor putative isomerase SCO2627 or SC8E4.02c SWALL:Q9L206 (EMBL:AL138661) (159 aa) fasta scores: E(): 1.8e-28%2C 57.43%25 id in 148 aa;gbkey=CDS;gene=rpiB;product=ribose 5-phosphate isomerase B;protein_id=CAD67044.1;transl_table=11
BX072543.1	EMBL	sequence_feature	406209	406452	.	+	.	ID=id735;Note=Ribose/Galactose Isomerase Score %3D 127.6 E-value %3D 1.6e-35;gbkey=misc_feature;gene=rpiB
BX072543.1	EMBL	gene	406503	407387	.	+	.	ID=gene352;Name=nei;gbkey=Gene;gene=nei;gene_biotype=protein_coding;locus_tag=TW374
BX072543.1	EMBL	CDS	406503	407387	.	+	0	ID=cds352;Parent=gene352;Dbxref=GOA:Q83HW2,InterPro:IPR000214,InterPro:IPR010979,InterPro:IPR012319,InterPro:IPR015886,UniProtKB/TrEMBL:Q83HW2,NCBI_GP:CAD67045.1;Name=CAD67045.1;Note=Similar to Escherichia coli endonuclease VIII Nei or b0714 SWALL:END8_ECOLI (SWALL:P50465) (262 aa) fasta scores: E(): 6.4e-06%2C 24.34%25 id in 304 aa%2C and to Streptomyces coelicolor putative DNA repair hydrolase SCC80.11c or SCO2626 SWALL:Q9F308 (EMBL:AL442143) (306 aa) fasta scores: E(): 7.3e-12%2C 31.26%25 id in 323 aa;gbkey=CDS;gene=nei;product=endonuclease VIII;protein_id=CAD67045.1;transl_table=11
BX072543.1	EMBL	sequence_feature	406503	407379	.	+	.	ID=id736;Note=Formamidopyrimidine-DNA glycosylase Score %3D 88.0 E-value %3D 1.3e-23;gbkey=misc_feature;gene=nei
BX072543.1	EMBL	gene	407389	407862	.	-	.	ID=gene353;Name=TW375;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW375
BX072543.1	EMBL	CDS	407389	407862	.	-	0	ID=cds353;Parent=gene353;Dbxref=GOA:Q83HW1,InterPro:IPR002177,InterPro:IPR008331,InterPro:IPR009078,InterPro:IPR012347,InterPro:IPR023188,UniProtKB/TrEMBL:Q83HW1,NCBI_GP:CAD67046.1;Name=CAD67046.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5756 or SC7C7.11 SWALL:O86816 (EMBL:AL031031) (156 aa) fasta scores: E(): 3.8e-12%2C 37.68%25 id in 138 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67046.1;transl_table=11
BX072543.1	EMBL	sequence_feature	407400	407820	.	-	.	ID=id737;Note=Ferritin-like domain Score %3D 20.1 E-value %3D 0.00014;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	407704	407754	.	-	.	ID=id738;Note=PS00818 Dps protein family signature 1.;gbkey=misc_feature
BX072543.1	EMBL	gene	407992	409074	.	-	.	ID=gene354;Name=TW376;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW376
BX072543.1	EMBL	CDS	407992	409074	.	-	0	ID=cds354;Parent=gene354;Dbxref=GOA:Q83NL5,InterPro:IPR002121,InterPro:IPR002562,InterPro:IPR010997,InterPro:IPR012337,UniProtKB/TrEMBL:Q83NL5,NCBI_GP:CAD67047.1;Name=CAD67047.1;Note=Similar to Corynebacterium glutamicum ribonuclease D cgl1901 SWALL:BAB99294 (EMBL:AP005280) (421 aa) fasta scores: E(): 2.8e-23%2C 33.97%25 id in 365 aa%2C and to Escherichia coli ribonuclease D Rnd or b1804 SWALL:RND_ECOLI (SWALL:P09155) (375 aa) fasta scores: E(): 0.003%2C 25.5%25 id in 247 aa;gbkey=CDS;product=putative ribonuclease;protein_id=CAD67047.1;transl_table=11
BX072543.1	EMBL	sequence_feature	408258	408510	.	-	.	ID=id739;Note=HRDC domain Score %3D 26.1 E-value %3D 1.9e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	408621	409074	.	-	.	ID=id740;Note=3'-5' exonuclease Score %3D 69.7 E-value %3D 4.4e-18;gbkey=misc_feature
BX072543.1	EMBL	gene	409148	409699	.	-	.	ID=gene355;Name=TW377;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW377
BX072543.1	EMBL	CDS	409148	409699	.	-	0	ID=cds355;Parent=gene355;Dbxref=InterPro:IPR021555,UniProtKB/TrEMBL:Q83HW0,NCBI_GP:CAD67048.1;Name=CAD67048.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO6030 or SC1C3.18c SWALL:O69860 (EMBL:AL023702) (238 aa) fasta scores: E(): 7.3e-15%2C 34.1%25 id in 173 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67048.1;transl_table=11
BX072543.1	EMBL	gene	409719	410414	.	-	.	ID=gene356;Name=TW378;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW378
BX072543.1	EMBL	CDS	409719	410414	.	-	0	ID=cds356;Parent=gene356;Dbxref=GOA:Q83HV9,InterPro:IPR002734,InterPro:IPR024072,UniProtKB/TrEMBL:Q83HV9,NCBI_GP:CAD67049.1;Name=CAD67049.1;Note=Weakly similar to Sulfolobus tokodaii hypothetical protein St0285 SWALL:Q975Z3 (EMBL:AP000982) (213 aa) fasta scores: E(): 0.001%2C 29.19%25 id in 161 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67049.1;transl_table=11
BX072543.1	EMBL	sequence_feature	409799	410357	.	-	.	ID=id741;Note=RibD C-terminal domain Score %3D -30.5 E-value %3D 4.5e-06;gbkey=misc_feature
BX072543.1	EMBL	gene	410411	410809	.	-	.	ID=gene357;Name=TW379;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW379
BX072543.1	EMBL	CDS	410411	410809	.	-	0	ID=cds357;Parent=gene357;Dbxref=InterPro:IPR003808,UniProtKB/TrEMBL:Q83HV8,NCBI_GP:CAD67050.1;Name=CAD67050.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv3284 or mt3383 or mtcy71.24 SWALL:YW84_MYCTU (SWALL:P96889) (143 aa) fasta scores: E(): 7.6e-19%2C 45.86%25 id in 133 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67050.1;transl_table=11
BX072543.1	EMBL	sequence_feature	410416	410788	.	-	.	ID=id742;Note=Domain of unknown function DUF Score %3D 60.8 E-value %3D 2.1e-15;gbkey=misc_feature
BX072543.1	EMBL	gene	410908	411816	.	-	.	ID=gene358;Name=TW380;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW380
BX072543.1	EMBL	CDS	410908	411816	.	-	0	ID=cds358;Parent=gene358;Dbxref=GOA:Q83HV7,InterPro:IPR001763,UniProtKB/TrEMBL:Q83HV7,NCBI_GP:CAD67051.1;Name=CAD67051.1;Note=Similar to Mycobacterium tuberculosis putative thiosulfate sulfurtransferase SseA or Rv3283 or mt3382 or mtcy71.23 SWALL:THT2_MYCTU (SWALL:P96888) (297 aa) fasta scores: E(): 2.1e-65%2C 56.33%25 id in 284 aa%2C and to Saccharopolyspora erythraea putative thiosulfate sulfurtransferase CysA SWALL:THTR_SACER (SWALL:P16385) (281 aa) fasta scores: E(): 3.2e-54%2C 51.67%25 id in 269 aa;gbkey=CDS;product=putative thiosulfate sulfurtransferase;protein_id=CAD67051.1;transl_table=11
BX072543.1	EMBL	sequence_feature	410946	411309	.	-	.	ID=id743;Note=Rhodanese-like domain Score %3D 82.2 E-value %3D 7.5e-22;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	411396	411720	.	-	.	ID=id744;Note=Rhodanese-like domain Score %3D 72.4 E-value %3D 6.6e-19;gbkey=misc_feature
BX072543.1	EMBL	tRNA	412019	412090	.	-	.	ID=rna18;Note=tRNA Val anticodon CAC%2C Cove score 84.28;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	exon	412019	412090	.	-	.	ID=id745;Parent=rna18;Note=tRNA Val anticodon CAC%2C Cove score 84.28;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	tRNA	412138	412209	.	-	.	ID=rna19;Note=tRNA Val anticodon GAC%2C Cove score 84.77;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	exon	412138	412209	.	-	.	ID=id746;Parent=rna19;Note=tRNA Val anticodon GAC%2C Cove score 84.77;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	tRNA	412225	412295	.	-	.	ID=rna20;Note=tRNA Cys anticodon GCA%2C Cove score 64.78;gbkey=tRNA;product=tRNA-Cys
BX072543.1	EMBL	exon	412225	412295	.	-	.	ID=id747;Parent=rna20;Note=tRNA Cys anticodon GCA%2C Cove score 64.78;gbkey=tRNA;product=tRNA-Cys
BX072543.1	EMBL	tRNA	412340	412411	.	-	.	ID=rna21;Note=tRNA Gly anticodon GCC%2C Cove score 81.94;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	exon	412340	412411	.	-	.	ID=id748;Parent=rna21;Note=tRNA Gly anticodon GCC%2C Cove score 81.94;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	gene	412536	413744	.	-	.	ID=gene359;Name=TW381;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW381
BX072543.1	EMBL	CDS	412536	413744	.	-	0	ID=cds359;Parent=gene359;Dbxref=InterPro:IPR023346,UniProtKB/TrEMBL:Q83NL4,NCBI_GP:CAD67052.1;Name=CAD67052.1;Note=Short C-terminal region similar to that of Streptomyces coelicolor hypothetical protein SCO2326 or SCC53.17 SWALL:Q9KXJ4 (EMBL:AL357591) (154 aa) fasta scores: E(): 1.6e-13%2C 51.54%25 id in 97 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67052.1;transl_table=11
BX072543.1	EMBL	sequence_feature	413649	413744	.	-	.	ID=id749;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.995 between residues 32 and 33;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	413649	413708	.	-	.	ID=id750;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-32;gbkey=misc_feature
BX072543.1	EMBL	gene	413741	414856	.	-	.	ID=gene360;Name=TW382;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW382
BX072543.1	EMBL	CDS	413741	414856	.	-	0	ID=cds360;Parent=gene360;Dbxref=UniProtKB/TrEMBL:Q83NL3,NCBI_GP:CAD67053.1;Name=CAD67053.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO0796 or SCF43.07 SWALL:Q9RD81 (EMBL:AL136502) (419 aa) fasta scores: E(): 6.6e-08%2C 22%25 id in 359 aa;gbkey=CDS;product=putative integral membrane protein.;protein_id=CAD67053.1;transl_table=11
BX072543.1	EMBL	sequence_feature	414689	414757	.	-	.	ID=id751;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 34-56%2C 71-93%2C 100-117%2C 122-144 and 151-170;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	414578	414646	.	-	.	ID=id751;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 34-56%2C 71-93%2C 100-117%2C 122-144 and 151-170;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	414506	414559	.	-	.	ID=id751;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 34-56%2C 71-93%2C 100-117%2C 122-144 and 151-170;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	414425	414493	.	-	.	ID=id751;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 34-56%2C 71-93%2C 100-117%2C 122-144 and 151-170;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	414347	414406	.	-	.	ID=id751;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 34-56%2C 71-93%2C 100-117%2C 122-144 and 151-170;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	414883	416610	.	-	.	ID=gene361;Name=TW383;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW383
BX072543.1	EMBL	CDS	414883	416610	.	-	0	ID=cds361;Parent=gene361;Dbxref=InterPro:IPR015414,InterPro:IPR019236,UniProtKB/TrEMBL:Q83NL2,NCBI_GP:CAD67054.1;Name=CAD67054.1;Note=C-terminal region similar to Corynebacterium glutamicum hypothetical protein Cgl2257 SWALL:BAB99650 (EMBL:AP005281) (344 aa) fasta scores: E(): 5.7e-32%2C 38.72%25 id in 315 aa. N-terminal region similar to Escherichia coli DedA protein or b2317 or z3579 or ecs3201 SWALL:DEDA_ECOLI (SWALL:P09548) (219 aa) fasta scores: E(): 1.4e-09%2C 28.65%25 id in 178 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67054.1;transl_table=11
BX072543.1	EMBL	sequence_feature	416494	416562	.	-	.	ID=id752;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 17-39%2C 59-81%2C 113-135%2C 140-162 and 175-194;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	416368	416436	.	-	.	ID=id752;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 17-39%2C 59-81%2C 113-135%2C 140-162 and 175-194;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	416206	416274	.	-	.	ID=id752;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 17-39%2C 59-81%2C 113-135%2C 140-162 and 175-194;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	416125	416193	.	-	.	ID=id752;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 17-39%2C 59-81%2C 113-135%2C 140-162 and 175-194;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	416029	416088	.	-	.	ID=id752;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 17-39%2C 59-81%2C 113-135%2C 140-162 and 175-194;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	sequence_feature	416070	416547	.	-	.	ID=id753;Note=DedA family Score %3D 53.6 E-value %3D 3e-13;gbkey=misc_feature
BX072543.1	EMBL	gene	416640	418070	.	+	.	ID=gene362;Name=trpE;gbkey=Gene;gene=trpE;gene_biotype=protein_coding;locus_tag=TW384
BX072543.1	EMBL	CDS	416640	418070	.	+	0	ID=cds362;Parent=gene362;Dbxref=GOA:Q83HV6,InterPro:IPR005801,InterPro:IPR015890,InterPro:IPR019999,UniProtKB/TrEMBL:Q83HV6,NCBI_GP:CAD67055.1;Name=CAD67055.1;Note=Similar to Sulfolobus solfataricus anthranilate synthase component I TrpE or Sso0893 SWALL:TRPE_SULSO (SWALL:Q06128) (421 aa) fasta scores: E(): 5.8e-35%2C 42.96%25 id in 263 aa%2C and to Streptomyces coelicolor anthranilate synthase component I TrpE or SCO3214 or SCE8.07c SWALL:TRPE_STRCO (SWALL:Q9Z4W7) (511 aa) fasta scores: E(): 5.1e-33%2C 32.27%25 id in 474 aa;gbkey=CDS;gene=trpE;product=anthranilate synthase component I;protein_id=CAD67055.1;transl_table=11
BX072543.1	EMBL	sequence_feature	417267	418056	.	+	.	ID=id754;Note=chorismate binding enzyme Score %3D 354.4 E-value %3D 8.6e-104;gbkey=misc_feature;gene=trpE
BX072543.1	EMBL	gene	418111	420531	.	+	.	ID=gene363;Name=leuS;gbkey=Gene;gene=leuS;gene_biotype=protein_coding;locus_tag=TW385
BX072543.1	EMBL	CDS	418111	420531	.	+	0	ID=cds363;Parent=gene363;Dbxref=GOA:Q83HV5,InterPro:IPR001412,InterPro:IPR002300,InterPro:IPR002302,InterPro:IPR009008,InterPro:IPR009080,InterPro:IPR013155,InterPro:IPR014729,InterPro:IPR025709,NCBI_GP:CAD67056.1;Name=CAD67056.1;Note=Similar to Escherichia coli leucyl-tRNA synthetase LeuS or b0642 SWALL:SYL_ECOLI (SWALL:P07813) (860 aa) fasta scores: E(): 2.5e-64%2C 37.77%25 id in 863 aa;gbkey=CDS;gene=leuS;product=leucyl-tRNA synthetase;protein_id=CAD67056.1;transl_table=11
BX072543.1	EMBL	sequence_feature	418180	419941	.	+	.	ID=id755;Note=tRNA synthetases class I (I%2C L%2C M and V) Score %3D 369.9 E-value %3D 1.9e-108;gbkey=misc_feature;gene=leuS
BX072543.1	EMBL	sequence_feature	418276	418305	.	+	.	ID=id756;Note=PS00178 Aminoacyl-transfer RNA synthetases class-I signature.;gbkey=misc_feature;gene=leuS
BX072543.1	EMBL	gene	420613	421194	.	+	.	ID=gene364;Name=TW386;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW386
BX072543.1	EMBL	CDS	420613	421194	.	+	0	ID=cds364;Parent=gene364;Dbxref=GOA:Q83NL1,InterPro:IPR003583,InterPro:IPR004509,InterPro:IPR010994,InterPro:IPR019554,UniProtKB/TrEMBL:Q83NL1,NCBI_GP:CAD67057.1;Name=CAD67057.1;Note=Similar to Thermoanaerobacter tengcongensis DNA uptake protein and related DNA-binding proteins ComEA or tte0926 SWALL:Q8RB96 (EMBL:AE013058) (196 aa) fasta scores: E(): 8.4e-06%2C 42.64%25 id in 136 aa%2C and to Bacillus subtilis ComE operon protein 1 ComEA or ComE1 SWALL:CME1_BACSU (SWALL:P39694) (205 aa) fasta scores: E(): 0.00054%2C 33.5%25 id in 197 aa;gbkey=CDS;product=putative DNA uptake protein;protein_id=CAD67057.1;transl_table=11
BX072543.1	EMBL	sequence_feature	420613	420723	.	+	.	ID=id757;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.948) with cleavage site probability 0.625 between residues 37 and 38;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	420649	420708	.	+	.	ID=id758;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-32;gbkey=misc_feature
BX072543.1	EMBL	gene	421191	422609	.	+	.	ID=gene365;Name=TW387;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW387
BX072543.1	EMBL	CDS	421191	422609	.	+	0	ID=cds365;Parent=gene365;Dbxref=InterPro:IPR004477,UniProtKB/TrEMBL:Q83NL0,NCBI_GP:CAD67058.1;Name=CAD67058.1;Note=Similar to N-terminal portion of Bacillus subtilis ComE operon protein 3 ComEC or ComE3 SWALL:CME3_BACSU (SWALL:P39695) (776 aa) fasta scores: E(): 4.4e-06%2C 24.23%25 id in 487 aa;gbkey=CDS;product=putative DNA uptake protein;protein_id=CAD67058.1;transl_table=11
BX072543.1	EMBL	sequence_feature	421209	421277	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=1/10;partial=true
BX072543.1	EMBL	sequence_feature	421320	421379	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=2/10;partial=true
BX072543.1	EMBL	sequence_feature	421833	421901	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=3/10;partial=true
BX072543.1	EMBL	sequence_feature	421929	421997	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=4/10;partial=true
BX072543.1	EMBL	sequence_feature	422031	422099	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=5/10;partial=true
BX072543.1	EMBL	sequence_feature	422109	422168	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=6/10;partial=true
BX072543.1	EMBL	sequence_feature	422205	422273	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=7/10;partial=true
BX072543.1	EMBL	sequence_feature	422316	422384	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=8/10;partial=true
BX072543.1	EMBL	sequence_feature	422403	422462	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=9/10;partial=true
BX072543.1	EMBL	sequence_feature	422490	422558	.	+	.	ID=id759;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-63%2C 215-237%2C 247-269%2C 281-303%2C 307-326%2C 339-361%2C 376-398%2C 405-424 and 434-456;gbkey=misc_feature;is_ordered=true;part=10/10;partial=true
BX072543.1	EMBL	sequence_feature	421770	422568	.	+	.	ID=id760;Note=Competence protein Score %3D 118.4 E-value %3D 9.7e-33;gbkey=misc_feature
BX072543.1	EMBL	gene	422606	423442	.	+	.	ID=gene366;Name=TW388;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW388
BX072543.1	EMBL	CDS	422606	423442	.	+	0	ID=cds366;Parent=gene366;Dbxref=InterPro:IPR001279,UniProtKB/TrEMBL:Q83NK9,NCBI_GP:CAD67059.1;Name=CAD67059.1;Note=Similar to C-terminal portion of Bacillus subtilis comE operon protein 3 ComEC or ComE3 SWALL:CME3_BACSU (SWALL:P39695) (776 aa) fasta scores: E(): 2e-10%2C 24.83%25 id in 298 aa;gbkey=CDS;product=putative DNA uptake protein;protein_id=CAD67059.1;transl_table=11
BX072543.1	EMBL	sequence_feature	422639	422707	.	+	.	ID=id761;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature
BX072543.1	EMBL	gene	423503	424432	.	+	.	ID=gene367;Name=TW389;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW389
BX072543.1	EMBL	CDS	423503	424432	.	+	0	ID=cds367;Parent=gene367;Dbxref=GOA:Q83HV4,InterPro:IPR008921,InterPro:IPR010372,UniProtKB/TrEMBL:Q83HV4,NCBI_GP:CAD67060.1;Name=CAD67060.1;Note=Weakly similar to Corynebacterium glutamicum predicted DNA polymerase III delta subunit cgl2346 SWALL:BAB99739 (EMBL:AP005281) (325 aa) fasta scores: E(): 4.6e-15%2C 25.23%25 id in 325 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67060.1;transl_table=11
BX072543.1	EMBL	gene	424690	425814	.	-	.	ID=gene368;Name=TW390;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW390
BX072543.1	EMBL	CDS	424690	425814	.	-	0	ID=cds368;Parent=gene368;Dbxref=UniProtKB/TrEMBL:Q83HV3,NCBI_GP:CAD67061.1;Name=CAD67061.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67061.1;transl_table=11
BX072543.1	EMBL	gene	425857	427077	.	-	.	ID=gene369;Name=TW391;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW391
BX072543.1	EMBL	CDS	425857	427077	.	-	0	ID=cds369;Parent=gene369;Dbxref=InterPro:IPR007139,UniProtKB/TrEMBL:Q83HV2,NCBI_GP:CAD67062.1;Name=CAD67062.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67062.1;transl_table=11
BX072543.1	EMBL	gene	427160	427777	.	+	.	ID=gene370;Name=rpsD;gbkey=Gene;gene=rpsD;gene_biotype=protein_coding;locus_tag=TW392
BX072543.1	EMBL	CDS	427160	427777	.	+	0	ID=cds370;Parent=gene370;Dbxref=GOA:Q83HV1,InterPro:IPR001912,InterPro:IPR002942,InterPro:IPR005709,InterPro:IPR018079,InterPro:IPR022801,NCBI_GP:CAD67063.1;Name=CAD67063.1;Note=Similar to Bacillus stearothermophilus 30s ribosomal protein S4 RpsD SWALL:RS4_BACST (SWALL:P81288) (198 aa) fasta scores: E(): 4.9e-25%2C 45.4%25 id in 196 aa;gbkey=CDS;gene=rpsD;product=30s ribosomal protein S4;protein_id=CAD67063.1;transl_table=11
BX072543.1	EMBL	sequence_feature	427172	427427	.	+	.	ID=id762;Note=Ribosomal protein S4/S9 N-terminal domain Score %3D 51.1 E-value %3D 1.7e-12;gbkey=misc_feature;gene=rpsD
BX072543.1	EMBL	sequence_feature	427430	427571	.	+	.	ID=id763;Note=S4 domain Score %3D 69.1 E-value %3D 6.6e-18;gbkey=misc_feature;gene=rpsD
BX072543.1	EMBL	gene	427986	430628	.	+	.	ID=gene371;Name=alaS;gbkey=Gene;gene=alaS;gene_biotype=protein_coding;locus_tag=TW393
BX072543.1	EMBL	CDS	427986	430628	.	+	0	ID=cds371;Parent=gene371;Dbxref=GOA:Q83HV0,InterPro:IPR002318,InterPro:IPR009000,InterPro:IPR012947,InterPro:IPR018162,InterPro:IPR018163,InterPro:IPR018164,InterPro:IPR018165,InterPro:IPR023033,NCBI_GP:CAD67064.1;Name=CAD67064.1;Note=Similar to Escherichia coli alanyl-tRNA synthetase AlaS or LovB or b2697 SWALL:SYA_ECOLI (SWALL:P00957) (876 aa) fasta scores: E(): 2.3e-77%2C 36.58%25 id in 902 aa;gbkey=CDS;gene=alaS;product=alanyl-tRNA synthetase;protein_id=CAD67064.1;transl_table=11
BX072543.1	EMBL	sequence_feature	427998	430053	.	+	.	ID=id764;Note=tRNA synthetases class II (A) Score %3D 912.9 E-value %3D 6.3e-272;gbkey=misc_feature;gene=alaS
BX072543.1	EMBL	sequence_feature	428631	428660	.	+	.	ID=id765;Note=PS00339 Aminoacyl-transfer RNA synthetases class-II signature 2.;gbkey=misc_feature;gene=alaS
BX072543.1	EMBL	sequence_feature	430464	430596	.	+	.	ID=id766;Note=DHHA1 domain Score %3D 18.1 E-value %3D 4.6e-05;gbkey=misc_feature;gene=alaS
BX072543.1	EMBL	gene	430659	431096	.	+	.	ID=gene372;Name=TW394;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW394
BX072543.1	EMBL	CDS	430659	431096	.	+	0	ID=cds372;Parent=gene372;Dbxref=GOA:Q83HU9,InterPro:IPR005227,InterPro:IPR006641,InterPro:IPR012337,NCBI_GP:CAD67065.1;Name=CAD67065.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1500 or SC9C5.24c SWALL:Q9KXQ0 (EMBL:AL357523) (167 aa) fasta scores: E(): 1.3e-08%2C 38.06%25 id in 134 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67065.1;transl_table=11
BX072543.1	EMBL	sequence_feature	430680	431058	.	+	.	ID=id767;Note=Uncharacterised protein family (UPF0081) Score %3D 73.3 E-value %3D 3.7e-19;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	431270	432248	.	+	.	ID=id768;Note=Uncharacterized BCR%2C YceG family COG1559 Score %3D 231.6 E-value %3D 8.2e-67;gbkey=misc_feature
BX072543.1	EMBL	gene	431279	432280	.	+	.	ID=gene373;Name=TW395;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW395
BX072543.1	EMBL	CDS	431279	432280	.	+	0	ID=cds373;Parent=gene373;Dbxref=GOA:Q83HU8,InterPro:IPR003770,InterPro:IPR013087,UniProtKB/TrEMBL:Q83HU8,NCBI_GP:CAD67066.1;Name=CAD67066.1;Note=Similar to Neisseria meningitidis hypothetical protein Nmb0669 SWALL:Q9K0E0 (EMBL:AE002421) (331 aa) fasta scores: E(): 7e-21%2C 30.97%25 id in 339 aa;gbkey=CDS;product=conserved hypothetical protein (possibly secreted);protein_id=CAD67066.1;transl_table=11
BX072543.1	EMBL	sequence_feature	431279	431347	.	+	.	ID=id769;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 63-85;gbkey=misc_feature
BX072543.1	EMBL	gene	432281	433228	.	+	.	ID=gene374;Name=aroE;gbkey=Gene;gene=aroE;gene_biotype=protein_coding;locus_tag=TW396
BX072543.1	EMBL	CDS	432281	433228	.	+	0	ID=cds374;Parent=gene374;Dbxref=GOA:Q83HU7,InterPro:IPR013708,InterPro:IPR016040,UniProtKB/TrEMBL:Q83HU7,NCBI_GP:CAD67067.1;Name=CAD67067.1;Note=Similar to Neisseria polysaccharea shikimate 5-dehydrogenase AroE SWALL:AROE_NEIPO (SWALL:P95399) (269 aa) fasta scores: E(): 0.0029%2C 36.73%25 id in 98 aa%2C and to Xylella fastidiosa shikimate 5-dehydrogenase xf0624 SWALL:Q9PFN3 (EMBL:AE003908) (282 aa) fasta scores: E(): 2e-05%2C 34.14%25 id in 123 aa;gbkey=CDS;gene=aroE;product=shikimate 5-dehydrogenase;protein_id=CAD67067.1;transl_table=11
BX072543.1	EMBL	sequence_feature	432338	433160	.	+	.	ID=id770;Note=Shikimate / quinate 5-dehydrogenase Score %3D 81.6 E-value %3D 1.1e-21;gbkey=misc_feature;gene=aroE
BX072543.1	EMBL	gene	433349	434551	.	+	.	ID=gene375;Name=aroC;gbkey=Gene;gene=aroC;gene_biotype=protein_coding;locus_tag=TW397
BX072543.1	EMBL	CDS	433349	434551	.	+	0	ID=cds375;Parent=gene375;Dbxref=GOA:Q83HU6,InterPro:IPR000453,InterPro:IPR020541,NCBI_GP:CAD67068.1;Name=CAD67068.1;Note=Similar to Staphylococcus aureus chorismate synthase AroC SWALL:AROC_STAAU (SWALL:Q59803) (388 aa) fasta scores: E(): 8.8e-59%2C 43.04%25 id in 381 aa;gbkey=CDS;gene=aroC;product=chorismate synthase;protein_id=CAD67068.1;transl_table=11
BX072543.1	EMBL	sequence_feature	433352	434459	.	+	.	ID=id771;Note=Chorismate synthase Score %3D 497.9 E-value %3D 5.6e-147;gbkey=misc_feature;gene=aroC
BX072543.1	EMBL	sequence_feature	433370	433417	.	+	.	ID=id772;Note=PS00787 Chorismate synthase signature 1.;gbkey=misc_feature;gene=aroC
BX072543.1	EMBL	sequence_feature	433748	433792	.	+	.	ID=id773;Note=PS00788 Chorismate synthase signature 2.;gbkey=misc_feature;gene=aroC
BX072543.1	EMBL	gene	434582	435082	.	+	.	ID=gene376;Name=aroK;gbkey=Gene;gene=aroK;gene_biotype=protein_coding;locus_tag=TW398
BX072543.1	EMBL	CDS	434582	435082	.	+	0	ID=cds376;Parent=gene376;Dbxref=GOA:Q83HU5,InterPro:IPR000623,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HU5,NCBI_GP:CAD67069.1;Name=CAD67069.1;Note=Similar to Lactococcus lactis shikimate kinase AroK SWALL:AROK_LACLC (SWALL:P43906) (162 aa) fasta scores: E(): 2.1e-08%2C 30.81%25 id in 159 aa;gbkey=CDS;gene=aroK;product=shikimate kinase;protein_id=CAD67069.1;transl_table=11
BX072543.1	EMBL	sequence_feature	434582	435053	.	+	.	ID=id774;Note=Shikimate kinase Score %3D 64.5 E-value %3D 1.7e-16;gbkey=misc_feature;gene=aroK
BX072543.1	EMBL	sequence_feature	434600	434623	.	+	.	ID=id775;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=aroK
BX072543.1	EMBL	gene	435142	436284	.	+	.	ID=gene377;Name=aroB;gbkey=Gene;gene=aroB;gene_biotype=protein_coding;locus_tag=TW399
BX072543.1	EMBL	CDS	435142	436284	.	+	0	ID=cds377;Parent=gene377;Dbxref=GOA:Q83HU4,InterPro:IPR016037,NCBI_GP:CAD67070.1;Name=CAD67070.1;Note=Similar to Escherichia coli 3-dehydroquinate synthase AroB or b3389 SWALL:AROB_ECOLI (SWALL:P07639) (362 aa) fasta scores: E(): 1e-23%2C 37.93%25 id in 290 aa%2C and to Corynebacterium glutamicum 3-dehydroquinate synthase AroB or cgl1621 SWALL:AROB_CORGL (SWALL:Q9X5D2) (366 aa) fasta scores: E(): 1.4e-40%2C 40.51%25 id in 311 aa;gbkey=CDS;gene=aroB;product=3-dehydroquinate synthase;protein_id=CAD67070.1;transl_table=11
BX072543.1	EMBL	sequence_feature	435199	436264	.	+	.	ID=id776;Note=3-dehydroquinate synthase Score %3D 341.6 E-value %3D 6.3e-100;gbkey=misc_feature;gene=aroB
BX072543.1	EMBL	gene	436368	436817	.	+	.	ID=gene378;Name=aroQ;gbkey=Gene;gene=aroQ;gene_biotype=protein_coding;locus_tag=TW400
BX072543.1	EMBL	CDS	436368	436817	.	+	0	ID=cds378;Parent=gene378;Dbxref=GOA:Q83HU3,InterPro:IPR001874,InterPro:IPR018509,UniProtKB/TrEMBL:Q83HU3,NCBI_GP:CAD67071.1;Name=CAD67071.1;Note=Similar to Actinobacillus pleuropneumoniae 3-dehydroquinate dehydratase AroQ SWALL:AROQ_ACTPL (SWALL:P43877) (154 aa) fasta scores: E(): 5.2e-19%2C 45.51%25 id in 145 aa;gbkey=CDS;gene=aroQ;product=3-dehydroquinate dehydratase;protein_id=CAD67071.1;transl_table=11
BX072543.1	EMBL	sequence_feature	436377	436812	.	+	.	ID=id777;Note=Dehydroquinase class II Score %3D 197.0 E-value %3D 2e-56;gbkey=misc_feature;gene=aroQ
BX072543.1	EMBL	sequence_feature	436392	436445	.	+	.	ID=id778;Note=PS01029 Dehydroquinase class II signature.;gbkey=misc_feature;gene=aroQ
BX072543.1	EMBL	gene	436842	437399	.	+	.	ID=gene379;Name=efp;gbkey=Gene;gene=efp;gene_biotype=protein_coding;locus_tag=TW401
BX072543.1	EMBL	CDS	436842	437399	.	+	0	ID=cds379;Parent=gene379;Dbxref=GOA:Q83NK8,InterPro:IPR001059,InterPro:IPR008991,InterPro:IPR011768,InterPro:IPR012340,InterPro:IPR013185,InterPro:IPR013852,InterPro:IPR014722,InterPro:IPR015365,InterPro:IPR020599,NCBI_GP:CAD67072.1;Name=CAD67072.1;Note=Similar to Escherichia coli elongation factor P Efp or b4147 or z5752 or ecs5128 SWALL:EFP_ECOLI (SWALL:P33398) (187 aa) fasta scores: E(): 9.8e-21%2C 37.01%25 id in 181 aa%2C and to Corynebacterium glutamicum elongation factor P Efp or cgl1619 SWALL:EFP_CORGL (SWALL:Q45288) (187 aa) fasta scores: E(): 2.1e-37%2C 54.89%25 id in 184 aa;gbkey=CDS;gene=efp;product=elongation factor P;protein_id=CAD67072.1;transl_table=11
BX072543.1	EMBL	sequence_feature	436842	437394	.	+	.	ID=id779;Note=Elongation factor P (EF-P) Score %3D 334.1 E-value %3D 1.1e-97;gbkey=misc_feature;gene=efp
BX072543.1	EMBL	sequence_feature	437289	437348	.	+	.	ID=id780;Note=PS01275 Elongation factor P signature.;gbkey=misc_feature;gene=efp
BX072543.1	EMBL	gene	437412	438698	.	+	.	ID=gene380;Name=pyrC;gbkey=Gene;gene=pyrC;gene_biotype=protein_coding;locus_tag=TW402
BX072543.1	EMBL	CDS	437412	438698	.	+	0	ID=cds380;Parent=gene380;Dbxref=GOA:Q83HU2,InterPro:IPR004722,InterPro:IPR011059,UniProtKB/TrEMBL:Q83HU2,NCBI_GP:CAD67073.1;Name=CAD67073.1;Note=Similar to Bacillus caldolyticus dihydroorotase PyrC SWALL:PYRC_BACCL (SWALL:P46538) (427 aa) fasta scores: E(): 1.7e-44%2C 37.46%25 id in 387 aa;gbkey=CDS;gene=pyrC;product=dihydroorotase;protein_id=CAD67073.1;transl_table=11
BX072543.1	EMBL	sequence_feature	437568	438684	.	+	.	ID=id781;Note=Dihydroorotase-like Score %3D 247.0 E-value %3D 1.8e-71;gbkey=misc_feature;gene=pyrC
BX072543.1	EMBL	gene	438740	439885	.	+	.	ID=gene381;Name=carA;gbkey=Gene;gene=carA;gene_biotype=protein_coding;locus_tag=TW403
BX072543.1	EMBL	CDS	438740	439885	.	+	0	ID=cds381;Parent=gene381;Dbxref=GOA:Q83HU1,InterPro:IPR002474,InterPro:IPR006274,InterPro:IPR017926,InterPro:IPR029062,UniProtKB/TrEMBL:Q83HU1,NCBI_GP:CAD67074.1;Name=CAD67074.1;Note=Similar to Sulfolobus solfataricus carbamoyl-phosphate synthase small chain CarA or Sso0640 SWALL:CARA_SULSO (SWALL:Q59968) (367 aa) fasta scores: E(): 1.2e-37%2C 34.21%25 id in 380 aa%2C and to Streptomyces coelicolor carbamoyl-phosphate synthase small chain CarA or PyrAa or SCO1484 or SC9C5.08c SWALL:CARA_STRCO (SWALL:Q9KXR5) (380 aa) fasta scores: E(): 3.4e-74%2C 52.29%25 id in 371 aa;gbkey=CDS;gene=carA;product=carbamoyl-phosphate synthase small chain;protein_id=CAD67074.1;transl_table=11
BX072543.1	EMBL	sequence_feature	438752	439196	.	+	.	ID=id782;Note=Carbamoyl-phosphate synthase small chain%2C CPSase domain Score %3D 205.4 E-value %3D 6e-59;gbkey=misc_feature;gene=carA
BX072543.1	EMBL	sequence_feature	439283	439841	.	+	.	ID=id783;Note=Glutamine amidotransferase class-I Score %3D 152.0 E-value %3D 7.3e-43;gbkey=misc_feature;gene=carA
BX072543.1	EMBL	sequence_feature	439490	439525	.	+	.	ID=id784;Note=PS00442 Glutamine amidotransferases class-I active site.;gbkey=misc_feature;gene=carA
BX072543.1	EMBL	gene	439872	443183	.	+	.	ID=gene382;Name=carB;gbkey=Gene;gene=carB;gene_biotype=protein_coding;locus_tag=TW404
BX072543.1	EMBL	CDS	439872	443183	.	+	0	ID=cds382;Parent=gene382;Dbxref=GOA:Q83HU0,InterPro:IPR005479,InterPro:IPR005480,InterPro:IPR005481,InterPro:IPR005483,InterPro:IPR006275,InterPro:IPR011607,InterPro:IPR011761,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,UniProtKB/TrEMBL:Q83HU0,NCBI_GP:CAD67075.1;Name=CAD67075.1;Note=Similar to Escherichia coli carbamoyl-phosphate synthase large chain CarB or PyrA or b0033 SWALL:CARB_ECOLI (SWALL:P00968) (1072 aa) fasta scores: E(): 9.4e-176%2C 49.22%25 id in 1099 aa;gbkey=CDS;gene=carB;product=carbamoyl-phosphate synthase large chain;protein_id=CAD67075.1;transl_table=11
BX072543.1	EMBL	sequence_feature	439887	440247	.	+	.	ID=id785;Note=Carbamoyl-phosphate synthase L chain%2C N-terminal domain Score %3D 175.9 E-value %3D 4.8e-50;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	440253	440958	.	+	.	ID=id786;Note=Carbamoyl-phosphate synthase L chain%2C ATP binding domain Score %3D 360.7 E-value %3D 1.1e-105;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	440361	440405	.	+	.	ID=id787;Note=PS00866 Carbamoyl-phosphate synthase subdomain signature 1.;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	440760	440783	.	+	.	ID=id788;Note=PS00867 Carbamoyl-phosphate synthase subdomain signature 2.;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	441162	441516	.	+	.	ID=id789;Note=Carbamoyl-phosphate synthetase large chain%2C oligomerisation domain Score %3D 177.0 E-value %3D 2.1e-50;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	441546	441900	.	+	.	ID=id790;Note=Carbamoyl-phosphate synthase L chain%2C N-terminal domain Score %3D 72.6 E-value %3D 5.7e-19;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	441906	442530	.	+	.	ID=id791;Note=Carbamoyl-phosphate synthase L chain%2C ATP binding domain Score %3D 68.4 E-value %3D 1.1e-17;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	442014	442058	.	+	.	ID=id792;Note=PS00866 Carbamoyl-phosphate synthase subdomain signature 1.;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	442401	442424	.	+	.	ID=id793;Note=PS00867 Carbamoyl-phosphate synthase subdomain signature 2.;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	sequence_feature	442761	443064	.	+	.	ID=id794;Note=MGS-like domain Score %3D 97.1 E-value %3D 2.4e-26;gbkey=misc_feature;gene=carB
BX072543.1	EMBL	gene	443180	444091	.	+	.	ID=gene383;Name=pyrF;gbkey=Gene;gene=pyrF;gene_biotype=protein_coding;locus_tag=TW405
BX072543.1	EMBL	CDS	443180	444091	.	+	0	ID=cds383;Parent=gene383;Dbxref=GOA:Q83HT9,InterPro:IPR001754,InterPro:IPR011060,InterPro:IPR011995,InterPro:IPR013785,UniProtKB/TrEMBL:Q83HT9,NCBI_GP:CAD67076.1;Name=CAD67076.1;Note=Similar to Mycobacterium smegmatis orotidine 5'-phosphate decarboxylase PyrF SWALL:PYRF_MYCSM (SWALL:O08323) (276 aa) fasta scores: E(): 4.1e-22%2C 38.79%25 id in 281 aa%2C and to Myxococcus xanthus orotidine 5'-phosphate decarboxylase PyrF or UraA SWALL:PYRF_MYXXA (SWALL:P24220) (288 aa) fasta scores: E(): 3.4e-16%2C 30.43%25 id in 276 aa;gbkey=CDS;gene=pyrF;product=orotidine 5'-phosphate decarboxylase;protein_id=CAD67076.1;transl_table=11
BX072543.1	EMBL	sequence_feature	443225	444017	.	+	.	ID=id795;Note=Orotidine 5'-phosphate decarboxylase / HUMPS family Score %3D 52.7 E-value %3D 5.5e-13;gbkey=misc_feature;gene=pyrF
BX072543.1	EMBL	gene	444443	445024	.	+	.	ID=gene384;Name=gmk;gbkey=Gene;gene=gmk;gene_biotype=protein_coding;locus_tag=TW406
BX072543.1	EMBL	CDS	444443	445024	.	+	0	ID=cds384;Parent=gene384;Dbxref=GOA:Q83HT8,InterPro:IPR008144,InterPro:IPR008145,InterPro:IPR017665,InterPro:IPR020590,InterPro:IPR027417,NCBI_GP:CAD67077.1;Name=CAD67077.1;Note=Similar to Escherichia coli guanylate kinase Gmk or SpoR or b3648 SWALL:KGUA_ECOLI (SWALL:P24234) (207 aa) fasta scores: E(): 4.2e-19%2C 39.42%25 id in 175 aa%2C and to Streptomyces coelicolor guanylate kinase Gmk or SCO1479 or SC9C5.03c SWALL:KGUA_STRCO (SWALL:Q9KXS0) (197 aa) fasta scores: E(): 2e-31%2C 50.55%25 id in 180 aa. Note possible alternative upstream translational start sites.;gbkey=CDS;gene=gmk;product=guanylate kinase;protein_id=CAD67077.1;transl_table=11
BX072543.1	EMBL	sequence_feature	444578	444631	.	+	.	ID=id796;Note=PS00856 Guanylate kinase signature.;gbkey=misc_feature;gene=gmk
BX072543.1	EMBL	sequence_feature	444581	444896	.	+	.	ID=id797;Note=Guanylate kinase Score %3D 89.2 E-value %3D 6e-24;gbkey=misc_feature;gene=gmk
BX072543.1	EMBL	gene	445147	445404	.	+	.	ID=gene385;Name=rpoZ;gbkey=Gene;gene=rpoZ;gene_biotype=protein_coding;locus_tag=TW407
BX072543.1	EMBL	CDS	445147	445404	.	+	0	ID=cds385;Parent=gene385;Dbxref=GOA:Q820D7,InterPro:IPR003716,InterPro:IPR006110,InterPro:IPR012293,NCBI_GP:CAD67078.1;Name=CAD67078.1;Note=Similar to Thermus aquaticus DNA-directed RNA polymerase omega chain RpoZ SWALL:RPOZ_THEAQ (SWALL:Q9EVV4) (98 aa) fasta scores: E(): 2.9%2C 29.16%25 id in 72 aa%2C and to Streptomyces coelicolor probable DNA-directed RNA polymerase omega chain RpoZ or SCO1478 or SC9C5.02c SWALL:RPOZ_STRCO (SWALL:Q9KXS1) (90 aa) fasta scores: E(): 3e-10%2C 56.71%25 id in 67 aa;gbkey=CDS;gene=rpoZ;product=DNA-directed RNA polymerase omega chain;protein_id=CAD67078.1;transl_table=11
BX072543.1	EMBL	sequence_feature	445198	445393	.	+	.	ID=id798;Note=RNA polymerase Rpb6 Score %3D 46.6 E-value %3D 3.8e-11;gbkey=misc_feature;gene=rpoZ
BX072543.1	EMBL	gene	445401	446633	.	+	.	ID=gene386;Name=TW408;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW408
BX072543.1	EMBL	CDS	445401	446633	.	+	0	ID=cds386;Parent=gene386;Dbxref=GOA:Q83NK7,InterPro:IPR003382,InterPro:IPR005252,InterPro:IPR007085,UniProtKB/TrEMBL:Q83NK7,NCBI_GP:CAD67079.1;Name=CAD67079.1;Note=Similar to many predicted flavoproteins eg. Mycobacterium tuberculosis DNA/pantothenate metabolism flavoprotein homolog Dfp or rv1391 or mt1436 or mtcy21b4.08 SWALL:DFP_MYCTU (SWALL:P71661) (418 aa) fasta scores: E(): 7.4e-51%2C 42.05%25 id in 409 aa;gbkey=CDS;product=putative flavoprotein;protein_id=CAD67079.1;transl_table=11
BX072543.1	EMBL	sequence_feature	445419	445755	.	+	.	ID=id799;Note=Flavoprotein Score %3D 110.4 E-value %3D 2.5e-30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	445947	446517	.	+	.	ID=id800;Note=DNA / pantothenate metabolism flavoprotein Score %3D 114.7 E-value %3D 1.2e-31;gbkey=misc_feature
BX072543.1	EMBL	gene	446643	447830	.	+	.	ID=gene387;Name=metK;gbkey=Gene;gene=metK;gene_biotype=protein_coding;locus_tag=TW409
BX072543.1	EMBL	CDS	446643	447830	.	+	0	ID=cds387;Parent=gene387;Dbxref=GOA:Q83HT7,InterPro:IPR002133,InterPro:IPR022628,InterPro:IPR022629,InterPro:IPR022630,InterPro:IPR022631,InterPro:IPR022636,NCBI_GP:CAD67080.1;Name=CAD67080.1;Note=Similar to Bacillus subtilis S-adenosylmethionine synthetase MetK or MetE SWALL:METK_BACSU (SWALL:P54419) (400 aa) fasta scores: E(): 1.3e-77%2C 52.8%25 id in 392 aa;gbkey=CDS;gene=metK;product=S-adenosylmethionine synthetase;protein_id=CAD67080.1;transl_table=11
BX072543.1	EMBL	sequence_feature	446643	446937	.	+	.	ID=id801;Note=S-adenosylmethionine synthetase%2C N-terminal domain Score %3D 125.2 E-value %3D 8.5e-35;gbkey=misc_feature;gene=metK
BX072543.1	EMBL	sequence_feature	447009	447369	.	+	.	ID=id802;Note=S-adenosylmethionine synthetase%2C central domain Score %3D 174.5 E-value %3D 1.2e-49;gbkey=misc_feature;gene=metK
BX072543.1	EMBL	sequence_feature	447375	447822	.	+	.	ID=id803;Note=S-adenosylmethionine synthetase%2C C-terminal domain Score %3D 227.1 E-value %3D 1.8e-65;gbkey=misc_feature;gene=metK
BX072543.1	EMBL	gene	447831	449705	.	+	.	ID=gene388;Name=TW410;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW410
BX072543.1	EMBL	CDS	447831	449705	.	+	0	ID=cds388;Parent=gene388;Dbxref=UniProtKB/TrEMBL:Q83HT6,NCBI_GP:CAD67081.1;Name=CAD67081.1;Note=Similar to Mycobacterium tuberculosis putative primosomal protein N' PriA or Rv1402 or mt1446 or mtcy21b4.19 SWALL:PRIA_MYCTU (SWALL:P71670) (655 aa) fasta scores: E(): 2.5e-18%2C 30.1%25 id in 598 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67081.1;transl_table=11
BX072543.1	EMBL	gene	449695	450654	.	+	.	ID=gene389;Name=fmt;gbkey=Gene;gene=fmt;gene_biotype=protein_coding;locus_tag=TW411
BX072543.1	EMBL	CDS	449695	450654	.	+	0	ID=cds389;Parent=gene389;Dbxref=GOA:Q83HT5,InterPro:IPR002376,InterPro:IPR005793,InterPro:IPR011034,InterPro:IPR015518,UniProtKB/TrEMBL:Q83HT5,NCBI_GP:CAD67082.1;Name=CAD67082.1;Note=Similar to Escherichia coli methionyl-tRNA formyltransferase Fmt or b3288 SWALL:FMT_ECOLI (SWALL:P23882) (314 aa) fasta scores: E(): 1.9e-19%2C 32.57%25 id in 307 aa%2C and to Streptomyces coelicolor methionyl-trna formyltransferase fmt or sco1473 or scl6.30C SWALL:Q9L0Y6 (EMBL:AL159139) (310 aa) fasta scores: E(): 4e-26%2C 34.81%25 id in 316 aa;gbkey=CDS;gene=fmt;product=methionyl-tRNA formyltransferase;protein_id=CAD67082.1;transl_table=11
BX072543.1	EMBL	sequence_feature	449707	450277	.	+	.	ID=id804;Note=Formyl transferase Score %3D 53.1 E-value %3D 4.3e-13;gbkey=misc_feature;gene=fmt
BX072543.1	EMBL	sequence_feature	450346	450640	.	+	.	ID=id805;Note=Formyl transferase%2C C-terminal domain Score %3D 50.7 E-value %3D 2.3e-12;gbkey=misc_feature;gene=fmt
BX072543.1	EMBL	gene	450954	451613	.	+	.	ID=gene390;Name=rpe;gbkey=Gene;gene=rpe;gene_biotype=protein_coding;locus_tag=TW413
BX072543.1	EMBL	CDS	450954	451613	.	+	0	ID=cds390;Parent=gene390;Dbxref=GOA:Q83HT4,InterPro:IPR000056,InterPro:IPR011060,InterPro:IPR013785,InterPro:IPR026019,UniProtKB/TrEMBL:Q83HT4,NCBI_GP:CAD67083.1;Name=CAD67083.1;Note=Similar to Streptomyces coelicolor ribulose-phosphate 3-epimerase Rpe or SCO1464 or SCl6.21c SWALL:RPE_STRCO (SWALL:Q9L0Z5) (228 aa) fasta scores: E(): 3.3e-32%2C 44.97%25 id in 209 aa%2C and to Oryza sativa D-ribulose-5-phosphate 3-epimerase SWALL:Q9SE42 (EMBL:AF189365) (228 aa) fasta scores: E(): 8.5e-23%2C 36.57%25 id in 216 aa;gbkey=CDS;gene=rpe;product=D-ribulose-5-phosphate 3-epimerase;protein_id=CAD67083.1;transl_table=11
BX072543.1	EMBL	sequence_feature	450981	451548	.	+	.	ID=id806;Note=Ribulose-phosphate 3 epimerase family Score %3D 217.1 E-value %3D 1.8e-62;gbkey=misc_feature;gene=rpe
BX072543.1	EMBL	sequence_feature	451041	451085	.	+	.	ID=id807;Note=PS01085 Ribulose-phosphate 3-epimerase family signature 1.;gbkey=misc_feature;gene=rpe
BX072543.1	EMBL	gene	451660	452754	.	-	.	ID=gene391;Name=TW414;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW414
BX072543.1	EMBL	CDS	451660	452754	.	-	0	ID=cds391;Parent=gene391;Dbxref=GOA:Q83HT3,InterPro:IPR001538,InterPro:IPR005835,InterPro:IPR029044,UniProtKB/TrEMBL:Q83HT3,NCBI_GP:CAD67084.1;Name=CAD67084.1;Note=Similar to Escherichia coli mannose-1-phosphate guanylyltransferase ManC or RfbM SWALL:RFM7_ECOLI (SWALL:P37741) (464 aa) fasta scores: E(): 2.1e-32%2C 33.51%25 id in 367 aa%2C and to Deinococcus radiodurans mannose-1-phosphate guanylyltransferase dra0032 SWALL:Q9RZC2 (EMBL:AE001862) (372 aa) fasta scores: E(): 2.4e-38%2C 35.09%25 id in 359 aa;gbkey=CDS;product=putative sugar-1-phosphate nucleotidyltransferase;protein_id=CAD67084.1;transl_table=11
BX072543.1	EMBL	sequence_feature	451674	451806	.	-	.	ID=id808;Note=Mannose-6-phosphate isomerase Score %3D 34.0 E-value %3D 6.3e-09;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	451878	452736	.	-	.	ID=id809;Note=Nucleotidyl transferase Score %3D 156.0 E-value %3D 4.6e-44;gbkey=misc_feature
BX072543.1	EMBL	gene	452949	454019	.	+	.	ID=gene392;Name=pstS;gbkey=Gene;gene=pstS;gene_biotype=protein_coding;locus_tag=TW415
BX072543.1	EMBL	CDS	452949	454019	.	+	0	ID=cds392;Parent=gene392;Dbxref=GOA:Q83HT2,InterPro:IPR005673,InterPro:IPR024370,UniProtKB/TrEMBL:Q83HT2,NCBI_GP:CAD67085.1;Name=CAD67085.1;Note=Similar to Mycobacterium tuberculosis phosphate-binding protein 2 precursor PstS2 or rv0932c or mt0959 or mtcy08d9.07 SWALL:PST2_MYCTU (SWALL:O05870) (370 aa) fasta scores: E(): 2.1e-28%2C 32.94%25 id in 340 aa;gbkey=CDS;gene=pstS;product=ABC transporter phosphate-binding lipoprotein;protein_id=CAD67085.1;transl_table=11
BX072543.1	EMBL	sequence_feature	452949	453074	.	+	.	ID=id810;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.256 between residues 42 and 43;gbkey=misc_feature;gene=pstS
BX072543.1	EMBL	sequence_feature	452985	453017	.	+	.	ID=id811;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature;gene=pstS
BX072543.1	EMBL	sequence_feature	453042	453975	.	+	.	ID=id812;Note=Phosphate-binding protein Score %3D 249.1 E-value %3D 4.3e-72;gbkey=misc_feature;gene=pstS
BX072543.1	EMBL	gene	454102	455001	.	+	.	ID=gene393;Name=pstC;gbkey=Gene;gene=pstC;gene_biotype=protein_coding;locus_tag=TW416
BX072543.1	EMBL	CDS	454102	455001	.	+	0	ID=cds393;Parent=gene393;Dbxref=GOA:Q83NK6,InterPro:IPR000515,InterPro:IPR011864,UniProtKB/TrEMBL:Q83NK6,NCBI_GP:CAD67086.1;Name=CAD67086.1;Note=Similar to Mycobacterium tuberculosis phosphate transport system permease protein PstC-2 or Rv0929 or mt0956 or mtcy21c12.23 SWALL:PSC2_MYCTU (SWALL:O86344) (324 aa) fasta scores: E(): 2.8e-30%2C 40.83%25 id in 289 aa%2C and to Escherichia coli phosphate transport system permease protein PstC or PhoW or b3727 or z5218 or ecs4663 SWALL:PSTC_ECOLI (SWALL:P07653) (319 aa) fasta scores: E(): 6.4e-25%2C 34.01%25 id in 294 aa;gbkey=CDS;gene=pstC;product=phosphate ABC transporter permease;protein_id=CAD67086.1;transl_table=11
BX072543.1	EMBL	sequence_feature	454102	454212	.	+	.	ID=id813;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.362 between residues 37 and 38;gbkey=misc_feature;gene=pstC
BX072543.1	EMBL	sequence_feature	454114	454182	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	454276	454344	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	454402	454470	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	454540	454608	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	454777	454845	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	454888	454956	.	+	.	ID=id814;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 59-81%2C 101-123%2C 147-169%2C 226-248 and 263-285;gbkey=misc_feature;gene=pstC;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	454615	454837	.	+	.	ID=id815;Note=Binding-protein-dependent transport systems inner membrane component Score %3D 40.2 E-value %3D 3.3e-09;gbkey=misc_feature;gene=pstC
BX072543.1	EMBL	sequence_feature	454618	454704	.	+	.	ID=id816;Note=PS00402 Binding-protein-dependent transport systems inner membrane comp. sign.;gbkey=misc_feature;gene=pstC
BX072543.1	EMBL	gene	455068	455961	.	+	.	ID=gene394;Name=pstA;gbkey=Gene;gene=pstA;gene_biotype=protein_coding;locus_tag=TW417
BX072543.1	EMBL	CDS	455068	455961	.	+	0	ID=cds394;Parent=gene394;Dbxref=GOA:Q83NK5,InterPro:IPR000515,InterPro:IPR005672,UniProtKB/TrEMBL:Q83NK5,NCBI_GP:CAD67087.1;Name=CAD67087.1;Note=Similar to Mycobacterium tuberculosis phosphate transport system permease protein PstA-1 or Rv0930 or mt0957 or mtcy21c12.24 SWALL:PSA1_MYCTU (SWALL:O86345) (305 aa) fasta scores: E(): 6.3e-39%2C 43.35%25 id in 286 aa%2C and to Escherichia coli phosphate transport system permease protein PstA or PhoT or b3726 SWALL:PSTA_ECOLI (SWALL:P07654) (296 aa) fasta scores: E(): 1.7e-29%2C 37.5%25 id in 280 aa;gbkey=CDS;gene=pstA;product=phosphate ABC transporter permease;protein_id=CAD67087.1;transl_table=11
BX072543.1	EMBL	sequence_feature	455068	455205	.	+	.	ID=id817;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.390 between residues 46 and 47;gbkey=misc_feature;gene=pstA
BX072543.1	EMBL	sequence_feature	455128	455196	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	455296	455364	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	455398	455466	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	455494	455553	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	455635	455703	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	455860	455928	.	+	.	ID=id818;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 77-99%2C 111-133%2C 143-162%2C 190-212 and 265-287;gbkey=misc_feature;gene=pstA;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	455569	455815	.	+	.	ID=id819;Note=Binding-protein-dependent transport systems inner membrane component Score %3D 67.2 E-value %3D 2.5e-17;gbkey=misc_feature;gene=pstA
BX072543.1	EMBL	sequence_feature	455572	455658	.	+	.	ID=id820;Note=PS00402 Binding-protein-dependent transport systems inner membrane comp. sign.;gbkey=misc_feature;gene=pstA
BX072543.1	EMBL	gene	455972	456745	.	+	.	ID=gene395;Name=TW418;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW418
BX072543.1	EMBL	CDS	455972	456745	.	+	0	ID=cds395;Parent=gene395;Dbxref=GOA:Q83HT1,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR015850,InterPro:IPR017871,InterPro:IPR027417,NCBI_GP:CAD67088.1;Name=CAD67088.1;Note=Similar to Mycobacterium smegmatis putative ABC transporter nucleotide binding subunit Mtp1 SWALL:O68469 (EMBL:AF045938) (258 aa) fasta scores: E(): 4.9e-48%2C 57.52%25 id in 259 aa%2C and to Bacillus subtilis hypothetical ABC transporter ATP-binding protein YqgJ yqgJ SWALL:YQGJ_BACSU (SWALL:P46341) (269 aa) fasta scores: E(): 7.5e-40%2C 50.78%25 id in 256 aa;gbkey=CDS;product=phosphate ABC transporter ATP-binding protein;protein_id=CAD67088.1;transl_table=11
BX072543.1	EMBL	sequence_feature	456059	456629	.	+	.	ID=id821;Note=ABC transporter Score %3D 208.9 E-value %3D 5.3e-60;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	456080	456103	.	+	.	ID=id822;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	456413	456457	.	+	.	ID=id823;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	tRNA	456763	456838	.	-	.	ID=rna22;Note=tRNA Arg anticodon CCG%2C Cove score 73.51;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	exon	456763	456838	.	-	.	ID=id824;Parent=rna22;Note=tRNA Arg anticodon CCG%2C Cove score 73.51;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	gene	456981	458633	.	+	.	ID=gene396;Name=argS;gbkey=Gene;gene=argS;gene_biotype=protein_coding;locus_tag=TW419
BX072543.1	EMBL	CDS	456981	458633	.	+	0	ID=cds396;Parent=gene396;Dbxref=GOA:Q83HT0,InterPro:IPR001278,InterPro:IPR005148,InterPro:IPR008909,InterPro:IPR009080,InterPro:IPR014729,NCBI_GP:CAD67089.1;Name=CAD67089.1;Note=Similar to Corynebacterium glutamicum arginyl-tRNA synthetase ArgS or cgl1179 SWALL:SYR_CORGL (SWALL:P35868) (550 aa) fasta scores: E(): 1.2e-80%2C 40.61%25 id in 554 aa;gbkey=CDS;gene=argS;product=arginyl-tRNA synthetase;protein_id=CAD67089.1;transl_table=11
BX072543.1	EMBL	sequence_feature	456984	457233	.	+	.	ID=id825;Note=Arginyl tRNA synthetase N terminal domain Score %3D 52.6 E-value %3D 6.1e-13;gbkey=misc_feature;gene=argS
BX072543.1	EMBL	sequence_feature	457239	458211	.	+	.	ID=id826;Note=tRNA synthetases class I (R) Score %3D 236.7 E-value %3D 2.3e-68;gbkey=misc_feature;gene=argS
BX072543.1	EMBL	gene	458872	459096	.	+	.	ID=gene397;Name=TW420;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW420
BX072543.1	EMBL	CDS	458872	459096	.	+	0	ID=cds397;Parent=gene397;Dbxref=UniProtKB/TrEMBL:Q83HS9,NCBI_GP:CAD67090.1;Name=CAD67090.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67090.1;transl_table=11
BX072543.1	EMBL	gene	459221	459703	.	+	.	ID=gene398;Name=TW421;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW421
BX072543.1	EMBL	CDS	459221	459703	.	+	0	ID=cds398;Parent=gene398;Dbxref=InterPro:IPR003711,UniProtKB/TrEMBL:Q83NK4,NCBI_GP:CAD67091.1;Name=CAD67091.1;Note=Similar to Streptomyces coelicolor putative transcriptional factor regulator SCO4232 or SCD8A.05 SWALL:Q9L0Q9 (EMBL:AL160331) (160 aa) fasta scores: E(): 4.3e-32%2C 66.03%25 id in 159 aa%2C and to Myxococcus xanthus CarD protein SWALL:Q50887 (EMBL:Z56280) (316 aa) fasta scores: E(): 1.1e-09%2C 28.48%25 id in 158 aa;gbkey=CDS;product=putative CarD-family transcriptional regulator;protein_id=CAD67091.1;transl_table=11
BX072543.1	EMBL	sequence_feature	459224	459680	.	+	.	ID=id827;Note=CarD-like transcriptional regulator Score %3D 192.9 E-value %3D 3.6e-55;gbkey=misc_feature
BX072543.1	EMBL	gene	459710	460978	.	+	.	ID=gene399;Name=TW422;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW422
BX072543.1	EMBL	CDS	459710	460978	.	+	0	ID=cds399;Parent=gene399;Dbxref=GOA:Q83NK3,InterPro:IPR001228,InterPro:IPR003526,InterPro:IPR020555,InterPro:IPR026596,InterPro:IPR029044,NCBI_GP:CAD67092.1;Name=CAD67092.1;Note=Fusion protein. N-terminal region similar to Streptomyces coelicolor 2-c-methyl-D-erythritol 4-phosphate cytidylyltransferase IspD or SCO4233 or SCD8A.06 SWALL:ISPD_STRCO (SWALL:Q9L0Q8) (270 aa) fasta scores: E(): 1.5e-12%2C 36.05%25 id in 233 aa Full length similarity to Rhizobium meliloti IspD/IspF bifunctional enzyme [includes: 2-c-methyl-D-erythritol 4- phosphate cytidylyltransferase ispdf or r01456 or smc01040 SWALL:ISDF_RHIME (SWALL:Q92Q90) (434 aa) fasta scores: E(): 5.7e-11%2C 28.7%25 id in 425 aa. C-terminal region similar to Escherichia coli 2-c-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase IspF or MecS or b2746 or z4054 or ecs3600 SWALL:ISPF_ECOLI (SWALL:P36663) (159 aa) fasta scores: E(): 3.9e-10%2C 35.52%25 id in 152 aa;gbkey=CDS;product=putative terpenoid biosynthesis bifunctional enzyme;protein_id=CAD67092.1;transl_table=11
BX072543.1	EMBL	sequence_feature	459710	459784	.	+	.	ID=id828;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.925) with cleavage site probability 0.894 between residues 25 and 26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	459716	460433	.	+	.	ID=id829;Note=Uncharacterized protein family UPF0007 Score %3D 103.3 E-value %3D 3.4e-28;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	460508	460973	.	+	.	ID=id830;Note=YgbB family Score %3D 130.0 E-value %3D 3.2e-36;gbkey=misc_feature
BX072543.1	EMBL	gene	461063	462463	.	+	.	ID=gene400;Name=cysS1;gbkey=Gene;gene=cysS1;gene_biotype=protein_coding;locus_tag=TW423
BX072543.1	EMBL	CDS	461063	462463	.	+	0	ID=cds400;Parent=gene400;Dbxref=GOA:Q83HS8,InterPro:IPR009080,InterPro:IPR014729,InterPro:IPR015273,InterPro:IPR015803,InterPro:IPR024909,NCBI_GP:CAD67093.1;Name=CAD67093.1;Note=Similar to Escherichia coli cysteinyl-tRNA synthetase CysS or b0526 SWALL:SYC_ECOLI (SWALL:P21888) (461 aa) fasta scores: E(): 7.6e-57%2C 38.75%25 id in 467 aa;gbkey=CDS;gene=cysS1;product=cysteinyl-tRNA synthetase;protein_id=CAD67093.1;transl_table=11
BX072543.1	EMBL	sequence_feature	461126	462416	.	+	.	ID=id831;Note=tRNA synthetases class I (C) Score %3D 452.2 E-value %3D 3.2e-133;gbkey=misc_feature;gene=cysS1
BX072543.1	EMBL	gene	462460	463251	.	+	.	ID=gene401;Name=TW424;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW424
BX072543.1	EMBL	CDS	462460	463251	.	+	0	ID=cds401;Parent=gene401;Dbxref=GOA:Q83HS7,InterPro:IPR001537,InterPro:IPR004441,InterPro:IPR013123,InterPro:IPR029026,InterPro:IPR029028,InterPro:IPR029064,UniProtKB/TrEMBL:Q83HS7,NCBI_GP:CAD67094.1;Name=CAD67094.1;Note=Similar to Mycobacterium leprae putative methyltransferase Ml0324 SWALL:Q9CCW4 (EMBL:AL583918) (278 aa) fasta scores: E(): 2.3e-30%2C 41.29%25 id in 247 aa%2C and to Bacillus subtilis hypothetical tRNA/rRNA methyltransferase YacO SWALL:YACO_BACSU (SWALL:Q06753) (249 aa) fasta scores: E(): 2.1e-23%2C 33.19%25 id in 244 aa;gbkey=CDS;product=putative rRNA methyltransferase;protein_id=CAD67094.1;transl_table=11
BX072543.1	EMBL	sequence_feature	462796	463234	.	+	.	ID=id832;Note=SpoU rRNA Methylase family Score %3D 136.3 E-value %3D 4e-38;gbkey=misc_feature
BX072543.1	EMBL	gene	463366	464247	.	+	.	ID=gene402;Name=TW425;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW425
BX072543.1	EMBL	CDS	463366	464247	.	+	0	ID=cds402;Parent=gene402;Dbxref=InterPro:IPR012336,UniProtKB/TrEMBL:Q83NK2,NCBI_GP:CAD67095.1;Name=CAD67095.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2969c or mt3047 or mtcy349.18 SWALL:O33272 (EMBL:Z83018) (261 aa) fasta scores: E(): 8.8e-05%2C 29.31%25 id in 249 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67095.1;transl_table=11
BX072543.1	EMBL	sequence_feature	463366	463548	.	+	.	ID=id833;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.996 between residues 61 and 62;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	463459	463527	.	+	.	ID=id834;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 32-54;gbkey=misc_feature
BX072543.1	EMBL	tRNA	464292	464364	.	+	.	ID=rna23;Note=tRNA Thr anticodon TGT%2C Cove score 83.11;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	exon	464292	464364	.	+	.	ID=id835;Parent=rna23;Note=tRNA Thr anticodon TGT%2C Cove score 83.11;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	gene	464516	464956	.	+	.	ID=gene403;Name=TW426;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW426
BX072543.1	EMBL	CDS	464516	464956	.	+	0	ID=cds403;Parent=gene403;Dbxref=UniProtKB/TrEMBL:Q83NK1,NCBI_GP:CAD67096.1;Name=CAD67096.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67096.1;transl_table=11
BX072543.1	EMBL	sequence_feature	464573	464629	.	+	.	ID=id836;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-38%2C 45-67 and 94-116;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	464648	464716	.	+	.	ID=id836;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-38%2C 45-67 and 94-116;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	464795	464863	.	+	.	ID=id836;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-38%2C 45-67 and 94-116;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	465159	466622	.	-	.	ID=gene404;Name=zwf;gbkey=Gene;gene=zwf;gene_biotype=protein_coding;locus_tag=TW428
BX072543.1	EMBL	CDS	465159	466622	.	-	0	ID=cds404;Parent=gene404;Dbxref=GOA:Q83HS6,InterPro:IPR001282,InterPro:IPR016040,InterPro:IPR019796,InterPro:IPR022674,InterPro:IPR022675,UniProtKB/TrEMBL:Q83HS6,NCBI_GP:CAD67097.1;Name=CAD67097.1;Note=Similar to Actinobacillus actinomycetemcomitans glucose-6-phosphate 1-dehydrogenase Zwf SWALL:G6PD_ACTAC (SWALL:P77809) (494 aa) fasta scores: E(): 8e-67%2C 37.96%25 id in 482 aa%2C and to Homo sapiens glucose-6-phosphate dehydrogenase G6pD SWALL:Q96PQ2 (EMBL:AF277315) (515 aa) fasta scores: E(): 2.2e-58%2C 36.67%25 id in 469 aa;gbkey=CDS;gene=zwf;product=glucose-6-phosphate 1-dehydrogenase;protein_id=CAD67097.1;transl_table=11
BX072543.1	EMBL	sequence_feature	465164	466034	.	-	.	ID=id837;Note=Glucose-6-phosphate dehydrogenase%2C C-terminal domain Score %3D 417.0 E-value %3D 1.3e-122;gbkey=misc_feature;gene=zwf
BX072543.1	EMBL	sequence_feature	466040	466595	.	-	.	ID=id838;Note=Glucose-6-phosphate dehydrogenase%2C NAD binding domain Score %3D 128.8 E-value %3D 6.9e-36;gbkey=misc_feature;gene=zwf
BX072543.1	EMBL	sequence_feature	466050	466070	.	-	.	ID=id839;Note=PS00069 Glucose-6-phosphate dehydrogenase active site.;gbkey=misc_feature;gene=zwf
BX072543.1	EMBL	gene	466665	468308	.	-	.	ID=gene405;Name=pgi;gbkey=Gene;gene=pgi;gene_biotype=protein_coding;gene_synonym=slr1349;locus_tag=TW429
BX072543.1	EMBL	CDS	466665	468308	.	-	0	ID=cds405;Parent=gene405;Dbxref=GOA:Q83HS5,InterPro:IPR001672,UniProtKB/TrEMBL:Q83HS5,NCBI_GP:CAD67098.1;Name=CAD67098.1;Note=Similar to Synechocystis sp. glucose-6-phosphate isomerase pgi or slr1349 SWALL:G6PI_SYNY3 (SWALL:P52983) (531 aa) fasta scores: E(): 4.8e-07%2C 26.91%25 id in 353 aa;gbkey=CDS;gene=pgi;product=glucose-6-phosphate isomerase;protein_id=CAD67098.1;transl_table=11
BX072543.1	EMBL	sequence_feature	467102	468299	.	-	.	ID=id840;Note=Phosphoglucose isomerase Score %3D -117.8 E-value %3D 6.2e-08;gbkey=misc_feature;gene=pgi
BX072543.1	EMBL	gene	468325	469419	.	-	.	ID=gene406;Name=tal;gbkey=Gene;gene=tal;gene_biotype=protein_coding;locus_tag=TW430
BX072543.1	EMBL	CDS	468325	469419	.	-	0	ID=cds406;Parent=gene406;Dbxref=GOA:Q83HS4,InterPro:IPR001585,InterPro:IPR004732,InterPro:IPR013785,InterPro:IPR018225,UniProtKB/TrEMBL:Q83HS4,NCBI_GP:CAD67099.1;Name=CAD67099.1;Note=Similar to Mycobacterium tuberculosis transaldolase Tal or Rv1448c or mt1495 or mtcy493.06 SWALL:TAL_MYCTU (SWALL:O06812) (373 aa) fasta scores: E(): 2.6e-72%2C 54.14%25 id in 362 aa%2C and to Solanum tuberosum transaldolase pottal1 SWALL:O04894 (EMBL:U95923) (438 aa) fasta scores: E(): 5.1e-49%2C 44.22%25 id in 355 aa;gbkey=CDS;gene=tal;product=transaldolase;protein_id=CAD67099.1;transl_table=11
BX072543.1	EMBL	sequence_feature	468342	469380	.	-	.	ID=id841;Note=Transaldolase Score %3D 289.2 E-value %3D 3.7e-84;gbkey=misc_feature;gene=tal
BX072543.1	EMBL	sequence_feature	469273	469299	.	-	.	ID=id842;Note=PS01054 Transaldolase signature 1.;gbkey=misc_feature;gene=tal
BX072543.1	EMBL	gene	469409	471505	.	-	.	ID=gene407;Name=tkt;gbkey=Gene;gene=tkt;gene_biotype=protein_coding;locus_tag=TW431
BX072543.1	EMBL	CDS	469409	471505	.	-	0	ID=cds407;Parent=gene407;Dbxref=GOA:Q83HS3,InterPro:IPR005474,InterPro:IPR005475,InterPro:IPR005476,InterPro:IPR005478,InterPro:IPR009014,InterPro:IPR029061,UniProtKB/TrEMBL:Q83HS3,NCBI_GP:CAD67100.1;Name=CAD67100.1;Note=Similar to Mycobacterium tuberculosis transketolase Tkt or Rv1449c or mt1496 or mtcy493.05 SWALL:TKT_MYCTU (SWALL:O06811) (700 aa) fasta scores: E(): 4.7e-157%2C 59.42%25 id in 690 aa%2C and to Saccharomyces cerevisiae transketolase 1 Tkl1 or ypr074c or yp9499.29C SWALL:TKT1_YEAST (SWALL:P23254) (679 aa) fasta scores: E(): 1.2e-97%2C 43.34%25 id in 676 aa;gbkey=CDS;gene=tkt;product=transketolase;protein_id=CAD67100.1;transl_table=11
BX072543.1	EMBL	sequence_feature	469453	469798	.	-	.	ID=id843;Note=Transketolase%2C C-terminal domain Score %3D 14.2 E-value %3D 5.4e-05;gbkey=misc_feature;gene=tkt
BX072543.1	EMBL	sequence_feature	469846	470389	.	-	.	ID=id844;Note=Transketolase%2C pyridine binding domain Score %3D 233.3 E-value %3D 2.5e-67;gbkey=misc_feature;gene=tkt
BX072543.1	EMBL	sequence_feature	470431	471442	.	-	.	ID=id845;Note=Transketolase%2C thiamine diphosphate binding domain Score %3D 544.9 E-value %3D 3.9e-161;gbkey=misc_feature;gene=tkt
BX072543.1	EMBL	sequence_feature	471353	471415	.	-	.	ID=id846;Note=PS00801 Transketolase signature 1.;gbkey=misc_feature;gene=tkt
BX072543.1	EMBL	gene	471644	472546	.	+	.	ID=gene408;Name=TW432;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW432
BX072543.1	EMBL	CDS	471644	472546	.	+	0	ID=cds408;Parent=gene408;Dbxref=GOA:Q83NK0,InterPro:IPR000537,InterPro:IPR006369,NCBI_GP:CAD67101.1;Name=CAD67101.1;Note=Similar to Streptomyces coelicolor putative cytochrome oxidase assembly factor SCO1934 or SCC22.16c SWALL:Q9XAC2 (EMBL:AL096839) (340 aa) fasta scores: E(): 5.1e-53%2C 48.11%25 id in 291 aa%2C and to Bradyrhizobium japonicum putative heme O synthase CoxE SWALL:Q9RM98 (EMBL:AJ242592) (314 aa) fasta scores: E(): 8.3e-35%2C 37.01%25 id in 281 aa. Note considerable overlap with downstream converging CDS.;gbkey=CDS;product=putative cytochrome synthase;protein_id=CAD67101.1;transl_table=11
BX072543.1	EMBL	sequence_feature	471644	471826	.	+	.	ID=id847;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.934) with cleavage site probability 0.599 between residues 61 and 62;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	471704	471772	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	471782	471850	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	471911	471979	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	471989	472057	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	472076	472144	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	472154	472222	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	472280	472348	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	472361	472429	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	472466	472534	.	+	.	ID=id848;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 47-69%2C 90-112%2C 116-138%2C 145-167%2C 171-193%2C 213-235%2C 240-262 and 275-297;gbkey=misc_feature;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	471713	472523	.	+	.	ID=id849;Note=UbiA prenyltransferase family Score %3D 210.5 E-value %3D 1.8e-60;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	471839	471907	.	+	.	ID=id850;Note=PS00943 UbiA prenyltransferase family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	472470	473525	.	-	.	ID=gene409;Name=TW433;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW433
BX072543.1	EMBL	CDS	472470	473525	.	-	0	ID=cds409;Parent=gene409;Dbxref=GOA:Q83NJ9,InterPro:IPR003780,UniProtKB/TrEMBL:Q83NJ9,NCBI_GP:CAD67102.1;Name=CAD67102.1;Note=Similar to Bacillus stearothermophilus heme O oxygenase CtaA SWALL:P94346 (EMBL:D70843) (320 aa) fasta scores: E(): 0.00037%2C 26.71%25 id in 146 aa%2C and to Bacillus subtilis cytochrome aa3 controlling protein CtaA SWALL:CTAA_BACSU (SWALL:P12946) (306 aa) fasta scores: E(): 0.031%2C 20.94%25 id in 296 aa;gbkey=CDS;product=putative cytochrome synthase;protein_id=CAD67102.1;transl_table=11
BX072543.1	EMBL	sequence_feature	472571	473414	.	-	.	ID=id851;Note=Cytochrome oxidase assembly protein Score %3D -15.1 E-value %3D 5.3e-06;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	473316	473384	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	473160	473213	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	473073	473141	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	472977	473045	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	472875	472943	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	472749	472817	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	472653	472712	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	472581	472640	.	-	.	ID=id852;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 105-122%2C 129-151%2C 161-183%2C 195-217%2C 237-259%2C 272-291 and 296-315;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	gene	473664	475085	.	+	.	ID=gene410;Name=TW434;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW434
BX072543.1	EMBL	CDS	473664	475085	.	+	0	ID=cds410;Parent=gene410;Dbxref=GOA:Q83HS2,InterPro:IPR000825,InterPro:IPR010231,UniProtKB/TrEMBL:Q83HS2,NCBI_GP:CAD67103.1;Name=CAD67103.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1925 or scc22.07C SWALL:Q9XAD1 (EMBL:AL096839) (473 aa) fasta scores: E(): 3.4e-141%2C 74.13%25 id in 464 aa%2C and to Escherichia coli SufB protein or b1683 SWALL:SUFB_ECOLI (SWALL:P77522) (495 aa) fasta scores: E(): 3.1e-61%2C 38.7%25 id in 478 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67103.1;transl_table=11
BX072543.1	EMBL	sequence_feature	474246	475005	.	+	.	ID=id853;Note=Uncharacterized protein family (UPF0051) Score %3D 450.0 E-value %3D 1.4e-132;gbkey=misc_feature
BX072543.1	EMBL	gene	475078	476226	.	+	.	ID=gene411;Name=TW435;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW435
BX072543.1	EMBL	CDS	475078	476226	.	+	0	ID=cds411;Parent=gene411;Dbxref=GOA:Q83HS1,InterPro:IPR000825,UniProtKB/TrEMBL:Q83HS1,NCBI_GP:CAD67104.1;Name=CAD67104.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1924 or SCC22.06c SWALL:Q9XAD2 (EMBL:AL096839) (394 aa) fasta scores: E(): 1.5e-45%2C 37.46%25 id in 379 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67104.1;transl_table=11
BX072543.1	EMBL	sequence_feature	475387	476131	.	+	.	ID=id854;Note=Uncharacterized protein family (UPF0051) Score %3D 148.0 E-value %3D 1.2e-41;gbkey=misc_feature
BX072543.1	EMBL	gene	476251	476553	.	+	.	ID=gene412;Name=TW436;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW436
BX072543.1	EMBL	CDS	476251	476553	.	+	0	ID=cds412;Parent=gene412;Dbxref=GOA:Q83HS0,InterPro:IPR017941,UniProtKB/TrEMBL:Q83HS0,NCBI_GP:CAD67105.1;Name=CAD67105.1;Note=Similar to Escherichia coli 3-phenylpropionate dioxygenase ferredoxin subunit HcaC or PhdB or HcaA3 or b2540 or z3811 or ecs3406 SWALL:HCAC_ECOLI (SWALL:P77266) (106 aa) fasta scores: E(): 3.4e-14%2C 45.91%25 id in 98 aa%2C and to Pseudomonas putida benzene 1%2C2-dioxygenase system ferredoxin component BedB SWALL:BEDB_PSEPU (SWALL:Q07947) (107 aa) fasta scores: E(): 7.7e-11%2C 39.78%25 id in 93 aa;gbkey=CDS;product=putative dioxygenase 2Fe-2S ferredoxin subunit;protein_id=CAD67105.1;transl_table=11
BX072543.1	EMBL	sequence_feature	476251	476527	.	+	.	ID=id855;Note=Rieske [2Fe-2S] domain Score %3D 65.5 E-value %3D 8.2e-17;gbkey=misc_feature
BX072543.1	EMBL	gene	476687	477436	.	+	.	ID=gene413;Name=TW437;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW437
BX072543.1	EMBL	CDS	476687	477436	.	+	0	ID=cds413;Parent=gene413;Dbxref=GOA:Q83HR9,InterPro:IPR003439,InterPro:IPR010230,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HR9,NCBI_GP:CAD67106.1;Name=CAD67106.1;Note=Similar to Streptomyces coelicolor putative ABC transporter ATP-binding subunit SCO1922 or SCC22.04c SWALL:Q9XAD4 (EMBL:AL096839) (254 aa) fasta scores: E(): 2.5e-55%2C 70.04%25 id in 247 aa%2C and to Cyanidium caldarium probable ATP-dependent transporter Ycf16 or Ycf33 SWALL:ABCX_CYACA (SWALL:Q9TLX1) (254 aa) fasta scores: E(): 8e-32%2C 48.19%25 id in 249 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD67106.1;transl_table=11
BX072543.1	EMBL	sequence_feature	476783	477359	.	+	.	ID=id856;Note=ABC transporter Score %3D 101.6 E-value %3D 1.1e-27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	476804	476827	.	+	.	ID=id857;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	477461	477811	.	+	.	ID=gene414;Name=TW438;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW438
BX072543.1	EMBL	CDS	477461	477811	.	+	0	ID=cds414;Parent=gene414;Dbxref=InterPro:IPR002744,UniProtKB/TrEMBL:Q83HR8,NCBI_GP:CAD67107.1;Name=CAD67107.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv1466 or mtv007.13 or mt1513 SWALL:O53157 (EMBL:AL021184) (115 aa) fasta scores: E(): 3.6e-18%2C 52.52%25 id in 99 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67107.1;transl_table=11
BX072543.1	EMBL	sequence_feature	477509	477728	.	+	.	ID=id858;Note=Domain of unknown function DUF59 Score %3D 85.9 E-value %3D 5.7e-23;gbkey=misc_feature
BX072543.1	EMBL	gene	477896	478753	.	-	.	ID=gene415;Name=TW439;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW439
BX072543.1	EMBL	CDS	477896	478753	.	-	0	ID=cds415;Parent=gene415;Dbxref=GOA:Q83NJ8,InterPro:IPR002994,UniProtKB/TrEMBL:Q83NJ8,NCBI_GP:CAD67108.1;Name=CAD67108.1;Note=Weakly similar to Streptomyces coelicolor putative membrane protein SCO1829 or SCI8.14 SWALL:Q9RJ39 (EMBL:AL132644) (290 aa) fasta scores: E(): 5.4e-10%2C 27.75%25 id in 263 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67108.1;transl_table=11
BX072543.1	EMBL	sequence_feature	478625	478693	.	-	.	ID=id859;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43 and 230-252;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	477998	478066	.	-	.	ID=id859;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43 and 230-252;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	478616	478753	.	-	.	ID=id860;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.899) with cleavage site probability 0.455 between residues 46 and 47;gbkey=misc_feature
BX072543.1	EMBL	tRNA	479104	479177	.	+	.	ID=rna24;Note=tRNA Met anticodon CAT%2C Cove score 85.31;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	exon	479104	479177	.	+	.	ID=id861;Parent=rna24;Note=tRNA Met anticodon CAT%2C Cove score 85.31;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	gene	479180	479956	.	-	.	ID=gene416;Name=uppS1;gbkey=Gene;gene=uppS1;gene_biotype=protein_coding;locus_tag=TW440
BX072543.1	EMBL	CDS	479180	479956	.	-	0	ID=cds416;Parent=gene416;Dbxref=GOA:Q83HR7,InterPro:IPR001441,InterPro:IPR018520,NCBI_GP:CAD67109.1;Name=CAD67109.1;Note=Similar to Micrococcus luteus undecaprenyl pyrophosphate synthetase UppS SWALL:UPPS_MICLU (SWALL:O82827) (249 aa) fasta scores: E(): 1.8e-23%2C 33.47%25 id in 239 aa%2C and to Mycobacterium leprae possible undecaprenyl pyrophosphate synthetase ml2467 SWALL:Q9CB36 (EMBL:AL583925) (262 aa) fasta scores: E(): 9e-36%2C 43.24%25 id in 259 aa;gbkey=CDS;gene=uppS1;product=undecaprenyl pyrophosphate synthetase;protein_id=CAD67109.1;transl_table=11
BX072543.1	EMBL	sequence_feature	479185	479848	.	-	.	ID=id862;Note=Putative undecaprenyl diphosphate synthase Score %3D 189.7 E-value %3D 3.4e-54;gbkey=misc_feature;gene=uppS1
BX072543.1	EMBL	sequence_feature	479297	479350	.	-	.	ID=id863;Note=PS01066 Undecaprenyl pyrophosphate synthetase family signature.;gbkey=misc_feature;gene=uppS1
BX072543.1	EMBL	gene	480076	481632	.	+	.	ID=gene417;Name=TW441;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW441
BX072543.1	EMBL	CDS	480076	481632	.	+	0	ID=cds417;Parent=gene417;Dbxref=GOA:Q83HR6,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HR6,NCBI_GP:CAD67110.1;Name=CAD67110.1;Note=Similar to Bacillus stearothermophilus L-arabinose transport ATP-binding protein AraG SWALL:ARAG_BACST (SWALL:Q9S472) (513 aa) fasta scores: E(): 5e-88%2C 55.07%25 id in 512 aa%2C and to Escherichia coli D-allose transport ATP-binding protein AlsA or b4087 SWALL:ALSA_ECOLI (SWALL:P32721) (510 aa) fasta scores: E(): 3.8e-48%2C 36.54%25 id in 509 aa;gbkey=CDS;product=putative sugar ABC transporter ATP-binding subunit;protein_id=CAD67110.1;transl_table=11
BX072543.1	EMBL	sequence_feature	480175	480751	.	+	.	ID=id864;Note=ABC transporter Score %3D 154.1 E-value %3D 1.7e-43;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	480196	480219	.	+	.	ID=id865;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	480958	481543	.	+	.	ID=id866;Note=ABC transporter Score %3D 68.9 E-value %3D 7.5e-18;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	481318	481362	.	+	.	ID=id867;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	481622	482845	.	+	.	ID=gene418;Name=TW442;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW442
BX072543.1	EMBL	CDS	481622	482845	.	+	0	ID=cds418;Parent=gene418;Dbxref=GOA:Q83NJ7,InterPro:IPR001851,UniProtKB/TrEMBL:Q83NJ7,NCBI_GP:CAD67111.1;Name=CAD67111.1;Note=Similar to Bacillus stearothermophilus L-arabinose membrane permease AraH SWALL:Q9S471 (EMBL:AF160811) (407 aa) fasta scores: E(): 3.6e-55%2C 42.32%25 id in 378 aa%2C and to Bacillus subtilis ribose transport system permease protein RbsC SWALL:RBSC_BACSU (SWALL:P36948) (322 aa) fasta scores: E(): 2.6e-15%2C 29.34%25 id in 368 aa;gbkey=CDS;product=putative sugar ABC transporter permease subunit;protein_id=CAD67111.1;transl_table=11
BX072543.1	EMBL	sequence_feature	481622	481699	.	+	.	ID=id868;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.414 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	481634	481702	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=1/11;partial=true
BX072543.1	EMBL	sequence_feature	481730	481798	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=2/11;partial=true
BX072543.1	EMBL	sequence_feature	481817	481870	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=3/11;partial=true
BX072543.1	EMBL	sequence_feature	481883	481942	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=4/11;partial=true
BX072543.1	EMBL	sequence_feature	481946	482014	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=5/11;partial=true
BX072543.1	EMBL	sequence_feature	482102	482170	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=6/11;partial=true
BX072543.1	EMBL	sequence_feature	482231	482299	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=7/11;partial=true
BX072543.1	EMBL	sequence_feature	482312	482371	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=8/11;partial=true
BX072543.1	EMBL	sequence_feature	482456	482515	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=9/11;partial=true
BX072543.1	EMBL	sequence_feature	482573	482641	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=10/11;partial=true
BX072543.1	EMBL	sequence_feature	482675	482743	.	+	.	ID=id869;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 66-83%2C 88-107%2C 109-131%2C 161-183%2C 204-226%2C 231-250%2C 279-298%2C 318-340 and 352-374;gbkey=misc_feature;is_ordered=true;part=11/11;partial=true
BX072543.1	EMBL	gene	482886	483956	.	+	.	ID=gene419;Name=TW443;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW443
BX072543.1	EMBL	CDS	482886	483956	.	+	0	ID=cds419;Parent=gene419;Dbxref=InterPro:IPR025997,InterPro:IPR028082,UniProtKB/TrEMBL:Q83HR5,NCBI_GP:CAD67112.1;Name=CAD67112.1;Note=Similar to Agrobacterium tumefaciens multiple sugar-binding periplasmic receptor ChvE precursor or atu2348 or agr_c_4267 SWALL:CHVE_AGRT5 (SWALL:P25548) (354 aa) fasta scores: E(): 4.6e-43%2C 42.68%25 id in 328 aa%2C and to Escherichia coli D-xylose-binding periplasmic protein precursor XylF or XylT or b3566 SWALL:XYLF_ECOLI (SWALL:P37387) (330 aa) fasta scores: E(): 1.8e-10%2C 34.19%25 id in 310 aa;gbkey=CDS;product=putative sugar ABC transporter substrate-binding lipoprotein subunit;protein_id=CAD67112.1;transl_table=11
BX072543.1	EMBL	sequence_feature	482886	482972	.	+	.	ID=id870;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.459 between residues 34 and 35;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	482925	482957	.	+	.	ID=id871;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	483018	483927	.	+	.	ID=id872;Note=Periplasmic binding proteins and sugar binding domain of the LacI family Score %3D -36.0 E-value %3D 0.0031;gbkey=misc_feature
BX072543.1	EMBL	gene	484012	484953	.	+	.	ID=gene420;Name=TW444;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW444
BX072543.1	EMBL	CDS	484012	484953	.	+	0	ID=cds420;Parent=gene420;Dbxref=GOA:Q83HR4,InterPro:IPR001967,InterPro:IPR012338,UniProtKB/TrEMBL:Q83HR4,NCBI_GP:CAD67113.1;Name=CAD67113.1;Note=Similar to Streptomyces clavuligerus Pbp2 protein or PbpA SWALL:O54201 (EMBL:AJ001743) (696 aa) fasta scores: E(): 7.8e-10%2C 32.36%25 id in 207 aa%2C and to Bacillus subtilis penicillin-binding protein DacF precursor SWALL:DACF_BACSU (SWALL:P38422) (389 aa) fasta scores: E(): 0.0009%2C 23.07%25 id in 299 aa;gbkey=CDS;product=putative carboxypeptidase;protein_id=CAD67113.1;transl_table=11
BX072543.1	EMBL	sequence_feature	484012	484089	.	+	.	ID=id873;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.788) with cleavage site probability 0.466 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	484030	484089	.	+	.	ID=id874;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	484141	484921	.	+	.	ID=id875;Note=D-alanyl-D-alanine carboxypeptidase Score %3D -22.6 E-value %3D 5.3e-09;gbkey=misc_feature
BX072543.1	EMBL	gene	485059	486129	.	-	.	ID=gene421;Name=adh;gbkey=Gene;gene=adh;gene_biotype=protein_coding;locus_tag=TW445
BX072543.1	EMBL	CDS	485059	486129	.	-	0	ID=cds421;Parent=gene421;Dbxref=GOA:Q83HR3,InterPro:IPR002085,InterPro:IPR002328,InterPro:IPR011032,InterPro:IPR013149,InterPro:IPR013154,InterPro:IPR016040,UniProtKB/TrEMBL:Q83HR3,NCBI_GP:CAD67114.1;Name=CAD67114.1;Note=Similar to Alcaligenes eutrophus alcohol dehydrogenase Adh SWALL:ADH_ALCEU (SWALL:P14940) (366 aa) fasta scores: E(): 3.4e-24%2C 35.13%25 id in 370 aa;gbkey=CDS;gene=adh;product=alcohol dehydrogenase;protein_id=CAD67114.1;transl_table=11
BX072543.1	EMBL	sequence_feature	485067	486108	.	-	.	ID=id876;Note=Zinc-binding dehydrogenase Score %3D 238.1 E-value %3D 8.8e-69;gbkey=misc_feature;gene=adh
BX072543.1	EMBL	sequence_feature	485905	485949	.	-	.	ID=id877;Note=PS00059 Zinc-containing alcohol dehydrogenases signature.;gbkey=misc_feature;gene=adh
BX072543.1	EMBL	gene	486396	487262	.	+	.	ID=gene422;Name=TW446;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW446
BX072543.1	EMBL	CDS	486396	487262	.	+	0	ID=cds422;Parent=gene422;Dbxref=GOA:Q83NJ6,InterPro:IPR001130,UniProtKB/TrEMBL:Q83NJ6,NCBI_GP:CAD67115.1;Name=CAD67115.1;Note=Similar to Escherichia coli putative deoxyribonuclease YcfH or b1100 or z1739 or ecs1478 SWALL:YCFH_ECOLI (SWALL:P37346) (265 aa) fasta scores: E(): 5.3e-15%2C 30.38%25 id in 283 aa;gbkey=CDS;product=putative TatD-family DNase;protein_id=CAD67115.1;transl_table=11
BX072543.1	EMBL	sequence_feature	486435	487251	.	+	.	ID=id878;Note=TatD related DNase Score %3D 247.1 E-value %3D 1.7e-71;gbkey=misc_feature
BX072543.1	EMBL	gene	487545	487586	.	+	.	ID=gene423;Name=TW447;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW447;part=1/2
BX072543.1	EMBL	gene	487588	488229	.	+	.	ID=gene423;Name=TW447;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW447;part=2/2
BX072543.1	EMBL	CDS	487545	487586	.	+	0	ID=cds423;Parent=gene423;Dbxref=UniProtKB/TrEMBL:Q83NJ5,NCBI_GP:CAD67116.1;Name=CAD67116.1;Note=No significant database matches. Frameshifted at potentially variable G(11) tract after aa 14. Contain 6x PTT(S/V) repeat at residue 153-176.;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67116.1;transl_table=11
BX072543.1	EMBL	CDS	487588	488229	.	+	0	ID=cds423;Parent=gene423;Dbxref=UniProtKB/TrEMBL:Q83NJ5,NCBI_GP:CAD67116.1;Name=CAD67116.1;Note=No significant database matches. Frameshifted at potentially variable G(11) tract after aa 14. Contain 6x PTT(S/V) repeat at residue 153-176.;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67116.1;transl_table=11
BX072543.1	EMBL	sequence_feature	487591	487659	.	+	.	ID=id879;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37 and 200-222;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	488146	488214	.	+	.	ID=id879;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37 and 200-222;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	repeat_region	488002	488061	.	+	.	ID=id880;Note=(ccaactacatca)5;gbkey=repeat_region
BX072543.1	EMBL	sequence_feature	487549	487680	.	+	.	ID=id881;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.479 between residues 44 and 45;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	487583	487593	.	+	.	ID=id882;Note=(g)11;gbkey=repeat_region
BX072543.1	EMBL	gene	488391	488660	.	+	.	ID=gene424;Name=TW449;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW449
BX072543.1	EMBL	CDS	488391	488660	.	+	0	ID=cds424;Parent=gene424;Dbxref=InterPro:IPR021400,UniProtKB/TrEMBL:Q83HR2,NCBI_GP:CAD67117.1;Name=CAD67117.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2947 or SCE59.06c SWALL:Q9L1U7 (EMBL:AL138851) (97 aa) fasta scores: E(): 2.5e-08%2C 48.27%25 id in 58 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67117.1;transl_table=11
BX072543.1	EMBL	gene	488661	489437	.	-	.	ID=gene425;Name=TW450;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW450
BX072543.1	EMBL	CDS	488661	489437	.	-	0	ID=cds425;Parent=gene425;Dbxref=GOA:Q83NJ4,InterPro:IPR002198,InterPro:IPR002347,InterPro:IPR016040,UniProtKB/TrEMBL:Q83NJ4,NCBI_GP:CAD67118.1;Name=CAD67118.1;Note=Similar to Ralstonia solanacearum probable dehydrogenase oxidoreductase protein Rsp0305 or rs05466 SWALL:Q8XT12 (EMBL:AL646077) (255 aa) fasta scores: E(): 1.2e-07%2C 32.06%25 id in 237 aa%2C and to Escherichia coli 7-alpha-hydroxysteroid dehydrogenase HdhA or HsdA or b1619 or z2624 or ecs2327 SWALL:HDHA_ECOLI (SWALL:P25529) (255 aa) fasta scores: E(): 2.4e-05%2C 28.63%25 id in 234 aa;gbkey=CDS;product=putative oxidoreductase;protein_id=CAD67118.1;transl_table=11
BX072543.1	EMBL	sequence_feature	488693	489395	.	-	.	ID=id883;Note=short chain dehydrogenase Score %3D -3.1 E-value %3D 3e-07;gbkey=misc_feature
BX072543.1	EMBL	gene	489434	490156	.	-	.	ID=gene426;Name=tatC;gbkey=Gene;gene=tatC;gene_biotype=protein_coding;locus_tag=TW451
BX072543.1	EMBL	CDS	489434	490156	.	-	0	ID=cds426;Parent=gene426;Dbxref=GOA:Q83NJ3,InterPro:IPR002033,InterPro:IPR011532,UniProtKB/TrEMBL:Q83NJ3,NCBI_GP:CAD67119.1;Name=CAD67119.1;Note=Similar to Pseudomonas stutzeri TatC protein SWALL:Q9AKS0 (EMBL:AJ299712) (267 aa) fasta scores: E(): 8.5e-12%2C 31.12%25 id in 241 aa%2C and to Streptomyces lividans twin arginine translocation pathway TatC SWALL:Q9F2H3 (EMBL:AJ251149) (301 aa) fasta scores: E(): 5.9e-19%2C 35.1%25 id in 245 aa;gbkey=CDS;gene=tatC;product=sec-independent protein translocase protein TatC;protein_id=CAD67119.1;transl_table=11
BX072543.1	EMBL	sequence_feature	490061	490120	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	489881	489949	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	489788	489856	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	489629	489697	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	489542	489595	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	489464	489532	.	-	.	ID=id884;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 70-92%2C 101-123%2C 154-176%2C 188-205 and 209-231;gbkey=misc_feature;gene=tatC;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	489508	490117	.	-	.	ID=id885;Note=MttB family UPF0032 Score %3D 77.0 E-value %3D 2.8e-20;gbkey=misc_feature;gene=tatC
BX072543.1	EMBL	gene	490167	490448	.	-	.	ID=gene427;Name=tatA;gbkey=Gene;gene=tatA;gene_biotype=protein_coding;locus_tag=TW452
BX072543.1	EMBL	CDS	490167	490448	.	-	0	ID=cds427;Parent=gene427;Dbxref=GOA:Q83NJ2,InterPro:IPR003369,InterPro:IPR006312,NCBI_GP:CAD67120.1;Name=CAD67120.1;Note=Similar to Escherichia coli sec-independent protein translocase protein TatA or MttA1 or b3836 or z5358 or ecs4766 SWALL:TATA_ECOLI (SWALL:O65938) (89 aa) fasta scores: E(): 0.11%2C 28.57%25 id in 91 aa%2C and to Helicobacter pylori sec-independent protein translocase protein TatA/E homolog TatA or hp0320 SWALL:TATA_HELPY (SWALL:O25088) (79 aa) fasta scores: E(): 0.00039%2C 31.25%25 id in 80 aa;gbkey=CDS;gene=tatA;product=sec-independent protein translocase protein TatA;protein_id=CAD67120.1;transl_table=11
BX072543.1	EMBL	sequence_feature	490268	490436	.	-	.	ID=id886;Note=mttA/Hcf106 family Score %3D 34.0 E-value %3D 2.4e-07;gbkey=misc_feature;gene=tatA
BX072543.1	EMBL	sequence_feature	490383	490436	.	-	.	ID=id887;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 5-22;gbkey=misc_feature;gene=tatA
BX072543.1	EMBL	gene	490453	491337	.	-	.	ID=gene428;Name=TW453;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW453
BX072543.1	EMBL	CDS	490453	491337	.	-	0	ID=cds428;Parent=gene428;Dbxref=GOA:Q83HR1,InterPro:IPR001179,InterPro:IPR023566,UniProtKB/TrEMBL:Q83HR1,NCBI_GP:CAD67121.1;Name=CAD67121.1;Note=Similar to Streptomyces chrysomallus FKBP-33 precursor FkbB SWALL:Q53919 (EMBL:Z34523) (312 aa) fasta scores: E(): 1.8e-12%2C 36.29%25 id in 281 aa;gbkey=CDS;product=putative drug-binding lipoprotein;protein_id=CAD67121.1;transl_table=11
BX072543.1	EMBL	sequence_feature	490476	490746	.	-	.	ID=id888;Note=FKBP-type peptidyl-prolyl cis-trans isomerase Score %3D 108.2 E-value %3D 1.1e-29;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	490660	490707	.	-	.	ID=id889;Note=PS00453 FKBP-type peptidyl-prolyl cis-trans isomerase signature 1.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	491130	491172	.	-	.	ID=id890;Note=FKBP-type peptidyl-prolyl cis-trans isomerase Score %3D 0.2 E-value %3D 4.6;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	491257	491337	.	-	.	ID=id891;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.996) with cleavage site probability 0.759 between residues 27 and 28;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	491278	491310	.	-	.	ID=id892;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	491355	492323	.	-	.	ID=gene429;Name=TW454;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW454
BX072543.1	EMBL	CDS	491355	492323	.	-	0	ID=cds429;Parent=gene429;Dbxref=GOA:Q83HR0,InterPro:IPR014816,InterPro:IPR029063,UniProtKB/TrEMBL:Q83HR0,NCBI_GP:CAD67122.1;Name=CAD67122.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1651 or SCI41.34c SWALL:Q9RJ57 (EMBL:AL132648) (300 aa) fasta scores: E(): 7.6e-17%2C 35.97%25 id in 303 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67122.1;transl_table=11
BX072543.1	EMBL	gene	492381	493271	.	+	.	ID=gene430;Name=TW455;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW455
BX072543.1	EMBL	CDS	492381	493271	.	+	0	ID=cds430;Parent=gene430;Dbxref=InterPro:IPR008492,InterPro:IPR019151,UniProtKB/TrEMBL:Q83HQ9,NCBI_GP:CAD67123.1;Name=CAD67123.1;Note=Similar to Mycobacterium leprae hypothetical protein Ml1306 SWALL:Q9CC38 (EMBL:AL583921) (274 aa) fasta scores: E(): 1.7e-30%2C 36.36%25 id in 275 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67123.1;transl_table=11
BX072543.1	EMBL	gene	493213	494565	.	-	.	ID=gene431;Name=cysS2;gbkey=Gene;gene=cysS2;gene_biotype=protein_coding;locus_tag=TW456
BX072543.1	EMBL	CDS	493213	494565	.	-	0	ID=cds431;Parent=gene431;Dbxref=GOA:Q83HQ8,InterPro:IPR014729,InterPro:IPR024909,NCBI_GP:CAD67124.1;Name=CAD67124.1;Note=Similar to Escherichia coli cysteinyl-tRNA synthetase CysS or b0526 SWALL:SYC_ECOLI (SWALL:P21888) (461 aa) fasta scores: E(): 2e-23%2C 32.06%25 id in 315 aa%2C and to Streptomyces coelicolor putative cysteinyl-trna synthetase sco1663 or sci52.05C SWALL:Q9ADA4 (EMBL:AL590507) (409 aa) fasta scores: E(): 6e-44%2C 40.22%25 id in 348 aa;gbkey=CDS;gene=cysS2;product=cysteinyl-tRNA synthetase;protein_id=CAD67124.1;transl_table=11
BX072543.1	EMBL	sequence_feature	493275	494529	.	-	.	ID=id893;Note=tRNA synthetases class I (C) Score %3D 16.7 E-value %3D 1.1e-14;gbkey=misc_feature;gene=cysS2
BX072543.1	EMBL	gene	494619	495458	.	-	.	ID=gene432;Name=upk;gbkey=Gene;gene=upk;gene_biotype=protein_coding;locus_tag=TW457
BX072543.1	EMBL	CDS	494619	495458	.	-	0	ID=cds432;Parent=gene432;Dbxref=GOA:Q83HQ7,InterPro:IPR003824,NCBI_GP:CAD67125.1;Name=CAD67125.1;Note=Similar to Staphylococcus aureus putative undecaprenol kinase Upk or BacA or mw0645 SWALL:BAB94510 (EMBL:AP004824) (291 aa) fasta scores: E(): 6.4e-18%2C 27.93%25 id in 290 aa%2C and to Streptomyces coelicolor putative undecaprenol kinase 2 Upk2 or BacA2 or SCO1326 or 2SCG61.08 SWALL:UPK2_STRCO (SWALL:Q9K407) (291 aa) fasta scores: E(): 1.4e-25%2C 32.98%25 id in 285 aa;gbkey=CDS;gene=upk;product=putative undecaprenol kinase;protein_id=CAD67125.1;transl_table=11
BX072543.1	EMBL	sequence_feature	495378	495446	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=1/7;partial=true
BX072543.1	EMBL	sequence_feature	495282	495350	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=2/7;partial=true
BX072543.1	EMBL	sequence_feature	495111	495179	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=3/7;partial=true
BX072543.1	EMBL	sequence_feature	495015	495083	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=4/7;partial=true
BX072543.1	EMBL	sequence_feature	494802	494870	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=5/7;partial=true
BX072543.1	EMBL	sequence_feature	494706	494774	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=6/7;partial=true
BX072543.1	EMBL	sequence_feature	494628	494687	.	-	.	ID=id894;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 37-59%2C 94-116%2C 126-148%2C 197-219%2C 229-251 and 258-277;gbkey=misc_feature;gene=upk;is_ordered=true;part=7/7;partial=true
BX072543.1	EMBL	sequence_feature	494642	495449	.	-	.	ID=id895;Note=Bacitracin resistance protein BacA Score %3D 239.2 E-value %3D 4.1e-69;gbkey=misc_feature;gene=upk
BX072543.1	EMBL	tRNA	495533	495619	.	-	.	ID=rna25;Note=tRNA Leu anticodon GAG%2C Cove score 55.44;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	exon	495533	495619	.	-	.	ID=id896;Parent=rna25;Note=tRNA Leu anticodon GAG%2C Cove score 55.44;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	gene	495667	495918	.	-	.	ID=gene433;Name=rpmE;gbkey=Gene;gene=rpmE;gene_biotype=protein_coding;locus_tag=TW458
BX072543.1	EMBL	CDS	495667	495918	.	-	0	ID=cds433;Parent=gene433;Dbxref=GOA:Q83HQ6,InterPro:IPR002150,InterPro:IPR027493,NCBI_GP:CAD67126.1;Name=CAD67126.1;Note=Similar to Streptomyces coelicolor 50s ribosomal protein L31 type B-2 RpmE3 or SCO3427 or SCE9.34c SWALL:R31C_STRCO (SWALL:Q9X8K6) (84 aa) fasta scores: E(): 9.3e-17%2C 55.55%25 id in 81 aa%2C and to Guillardia theta chloroplast 50s ribosomal protein l31 rpl31 SWALL:RK31_GUITH (SWALL:O46917) (72 aa) fasta scores: E(): 0.00065%2C 35.06%25 id in 77 aa;gbkey=CDS;gene=rpmE;product=50s ribosomal protein L31;protein_id=CAD67126.1;transl_table=11
BX072543.1	EMBL	sequence_feature	495678	495918	.	-	.	ID=id897;Note=Ribosomal protein L31 Score %3D 74.1 E-value %3D 2.1e-19;gbkey=misc_feature;gene=rpmE
BX072543.1	EMBL	sequence_feature	495700	495756	.	-	.	ID=id898;Note=PS01143 Ribosomal protein L31 signature.;gbkey=misc_feature;gene=rpmE
BX072543.1	EMBL	gene	496060	496776	.	-	.	ID=gene434;Name=fabG;gbkey=Gene;gene=fabG;gene_biotype=protein_coding;locus_tag=TW459
BX072543.1	EMBL	CDS	496060	496776	.	-	0	ID=cds434;Parent=gene434;Dbxref=GOA:Q83HQ5,InterPro:IPR002198,InterPro:IPR002347,InterPro:IPR016040,UniProtKB/TrEMBL:Q83HQ5,NCBI_GP:CAD67127.1;Name=CAD67127.1;Note=Similar to Escherichia coli 3-oxoacyl-[acyl-carrier protein] reductase FabG or b1093 SWALL:FABG_ECOLI (SWALL:P25716) (244 aa) fasta scores: E(): 1.5e-33%2C 43.51%25 id in 239 aa%2C and to Streptomyces coelicolor probable 3-oxacyl- FabG or SCO1815 or SCI28.09c SWALL:Q9S274 (EMBL:AL096844) (234 aa) fasta scores: E(): 1.3e-42%2C 51.93%25 id in 233 aa;gbkey=CDS;gene=fabG;product=3-oxoacyl-[acyl-carrier protein] reductase;protein_id=CAD67127.1;transl_table=11
BX072543.1	EMBL	sequence_feature	496077	496770	.	-	.	ID=id899;Note=short chain dehydrogenase Score %3D 264.4 E-value %3D 1.1e-76;gbkey=misc_feature;gene=fabG
BX072543.1	EMBL	gene	496780	497955	.	-	.	ID=gene435;Name=TW460;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW460
BX072543.1	EMBL	CDS	496780	497955	.	-	0	ID=cds435;Parent=gene435;Dbxref=GOA:Q83HQ4,InterPro:IPR001296,InterPro:IPR028098,UniProtKB/TrEMBL:Q83HQ4,NCBI_GP:CAD67128.1;Name=CAD67128.1;Note=Similar to Methanosarcina mazei glycosyltransferase mm1142 SWALL:AAM30838 (EMBL:AE013343) (379 aa) fasta scores: E(): 3.6e-24%2C 29.59%25 id in 392 aa%2C and to Arabidopsis thaliana sulfolipid synthase Sqd2 SWALL:Q8S4F6 (EMBL:AF454354) (510 aa) fasta scores: E(): 2.8e-11%2C 27.91%25 id in 283 aa;gbkey=CDS;product=putative glycosyltransferase;protein_id=CAD67128.1;transl_table=11
BX072543.1	EMBL	sequence_feature	496860	497364	.	-	.	ID=id900;Note=Glycosyl transferases group 1 Score %3D 132.9 E-value %3D 4e-37;gbkey=misc_feature
BX072543.1	EMBL	gene	498160	498927	.	-	.	ID=gene436;Name=TW461;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW461
BX072543.1	EMBL	CDS	498160	498927	.	-	0	ID=cds436;Parent=gene436;Dbxref=UniProtKB/TrEMBL:Q83NJ1,NCBI_GP:CAD67129.1;Name=CAD67129.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO0973 or SCM11.28 SWALL:Q9RIT4 (EMBL:AL133278) (419 aa) fasta scores: E(): 2.9e-09%2C 28.63%25 id in 234 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67129.1;transl_table=11
BX072543.1	EMBL	sequence_feature	498832	498891	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	498751	498819	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	498631	498690	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	498550	498603	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	498463	498531	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	498382	498450	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	498277	498345	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	498181	498249	.	-	.	ID=id901;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-32%2C 37-59%2C 80-99%2C 109-126%2C 133-155%2C 160-182%2C 195-217 and 227-249;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	498772	498927	.	-	.	ID=id902;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.574 between residues 52 and 53;gbkey=misc_feature
BX072543.1	EMBL	gene	499172	499777	.	+	.	ID=gene437;Name=def;gbkey=Gene;gene=def;gene_biotype=protein_coding;locus_tag=TW462
BX072543.1	EMBL	CDS	499172	499777	.	+	0	ID=cds437;Parent=gene437;Dbxref=GOA:Q83HQ3,InterPro:IPR000181,InterPro:IPR023635,NCBI_GP:CAD67130.1;Name=CAD67130.1;Note=Similar to Thermus thermophilus peptide Deformylase Def SWALL:DEF_THETH (SWALL:P43522) (192 aa) fasta scores: E(): 6.4e-15%2C 38.69%25 id in 168 aa%2C and to Mycobacterium leprae peptide deformylase Def or ml1929 SWALL:DEF_MYCLE (SWALL:Q9CBI2) (197 aa) fasta scores: E(): 8.2e-20%2C 39.6%25 id in 202 aa;gbkey=CDS;gene=def;product=peptide deformylase;protein_id=CAD67130.1;transl_table=11
BX072543.1	EMBL	sequence_feature	499193	499709	.	+	.	ID=id903;Note=Polypeptide deformylase Score %3D 170.8 E-value %3D 1.6e-48;gbkey=misc_feature;gene=def
BX072543.1	EMBL	gene	499790	500608	.	-	.	ID=gene438;Name=TW463;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW463
BX072543.1	EMBL	CDS	499790	500608	.	-	0	ID=cds438;Parent=gene438;Dbxref=GOA:Q83HQ2,InterPro:IPR001640,NCBI_GP:CAD67131.1;Name=CAD67131.1;gbkey=CDS;product=probable prolipoprotein diacylglyceryl transferase.;protein_id=CAD67131.1;transl_table=11
BX072543.1	EMBL	sequence_feature	500504	500572	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=1/7;partial=true
BX072543.1	EMBL	sequence_feature	500390	500458	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=2/7;partial=true
BX072543.1	EMBL	sequence_feature	500279	500347	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=3/7;partial=true
BX072543.1	EMBL	sequence_feature	500192	500260	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=4/7;partial=true
BX072543.1	EMBL	sequence_feature	500024	500092	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=5/7;partial=true
BX072543.1	EMBL	sequence_feature	499931	499987	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=6/7;partial=true
BX072543.1	EMBL	sequence_feature	499820	499888	.	-	.	ID=id904;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 51-73%2C 88-110%2C 117-139%2C 173-195%2C 208-226 and 241-263;gbkey=misc_feature;is_ordered=true;part=7/7;partial=true
BX072543.1	EMBL	sequence_feature	499822	500590	.	-	.	ID=id905;Note=Prolipoprotein diacylglyceryl transferase Score %3D 103.0 E-value %3D 4.1e-28;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	499835	499867	.	-	.	ID=id906;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	500720	501478	.	+	.	ID=gene439;Name=pgl;gbkey=Gene;gene=pgl;gene_biotype=protein_coding;locus_tag=TW464
BX072543.1	EMBL	CDS	500720	501478	.	+	0	ID=cds439;Parent=gene439;Dbxref=GOA:Q83HQ1,InterPro:IPR005900,InterPro:IPR006148,UniProtKB/TrEMBL:Q83HQ1,NCBI_GP:CAD67132.1;Name=CAD67132.1;Note=Similar to Mycobacterium tuberculosis 6-phosphogluconolactonase Pgl or DevB or Rv1445c or mt1492 or mtcy493.09 SWALL:6PGL_MYCTU (SWALL:O06814) (247 aa) fasta scores: E(): 8.5e-26%2C 34.41%25 id in 247 aa%2C and to Actinobacillus actinomycetemcomitans 6-phosphogluconolactonase Pgl or DevB SWALL:6PGL_ACTAC (SWALL:P70715) (232 aa) fasta scores: E(): 6.4e-17%2C 31.93%25 id in 238 aa;gbkey=CDS;gene=pgl;product=6-phosphogluconolactonase;protein_id=CAD67132.1;transl_table=11
BX072543.1	EMBL	sequence_feature	500783	501455	.	+	.	ID=id907;Note=Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase Score %3D -62.5 E-value %3D 0.00057;gbkey=misc_feature;gene=pgl
BX072543.1	EMBL	gene	501475	501954	.	-	.	ID=gene440;Name=ppa1;gbkey=Gene;gene=ppa1;gene_biotype=protein_coding;locus_tag=TW465
BX072543.1	EMBL	CDS	501475	501954	.	-	0	ID=cds440;Parent=gene440;Dbxref=GOA:Q81ZK3,InterPro:IPR008162,UniProtKB/TrEMBL:Q81ZK3,NCBI_GP:CAD67133.1;Name=CAD67133.1;Note=Similar to Bacillus stearothermophilus inorganic pyrophosphatase Ppa or pmk2ppA SWALL:IPYR_BACST (SWALL:O05724) (164 aa) fasta scores: E(): 5.1e-27%2C 44.3%25 id in 158 aa;gbkey=CDS;gene=ppa1;product=inorganic pyrophosphatase;protein_id=CAD67133.1;transl_table=11
BX072543.1	EMBL	sequence_feature	501480	501942	.	-	.	ID=id908;Note=Inorganic pyrophosphatase Score %3D 199.5 E-value %3D 3.6e-57;gbkey=misc_feature;gene=ppa1
BX072543.1	EMBL	sequence_feature	501778	501798	.	-	.	ID=id909;Note=PS00387 Inorganic pyrophosphatase signature.;gbkey=misc_feature;gene=ppa1
BX072543.1	EMBL	gene	501957	502484	.	-	.	ID=gene441;Name=TW467;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW467
BX072543.1	EMBL	CDS	501957	502484	.	-	0	ID=cds441;Parent=gene441;Dbxref=UniProtKB/TrEMBL:Q81ZR0,NCBI_GP:CAD67134.1;Name=CAD67134.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67134.1;transl_table=11
BX072543.1	EMBL	sequence_feature	501972	502031	.	-	.	ID=id910;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 152-171;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	502416	502484	.	-	.	ID=id911;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.991 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	gene	502797	503162	.	-	.	ID=gene442;Name=TW468;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW468
BX072543.1	EMBL	CDS	502797	503162	.	-	0	ID=cds442;Parent=gene442;Dbxref=GOA:Q83HQ0,InterPro:IPR025182,UniProtKB/TrEMBL:Q83HQ0,NCBI_GP:CAD67135.1;Name=CAD67135.1;Note=Similar to Streptomyces coelicolor putative electron transport protein SCO1943 or SCC54.03c SWALL:Q9Z522 (EMBL:AL035591) (111 aa) fasta scores: E(): 3.2e-11%2C 44.34%25 id in 106 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67135.1;transl_table=11
BX072543.1	EMBL	gene	503234	503530	.	-	.	ID=gene443;Name=secG;gbkey=Gene;gene=secG;gene_biotype=protein_coding;locus_tag=TW469
BX072543.1	EMBL	CDS	503234	503530	.	-	0	ID=cds443;Parent=gene443;Dbxref=GOA:Q83NJ0,InterPro:IPR004692,UniProtKB/TrEMBL:Q83NJ0,NCBI_GP:CAD67136.1;Name=CAD67136.1;Note=Similar to Streptomyces coelicolor protein-export membrane protein SecG or SCO1944 or SCC54.04c SWALL:SECG_STRCO (SWALL:Q9Z521) (102 aa) fasta scores: E(): 7.6e-10%2C 50.66%25 id in 75 aa%2C and to Escherichia coli protein-export membrane protein SecG or b3175 or z4537 or ecs4054 SWALL:SECG_ECOLI (SWALL:P33582) (110 aa) fasta scores: E(): 0.22%2C 32.83%25 id in 67 aa;gbkey=CDS;gene=secG;product=protein-export membrane protein SecG;protein_id=CAD67136.1;transl_table=11
BX072543.1	EMBL	sequence_feature	503248	503467	.	-	.	ID=id912;Note=Preprotein translocase SecG subunit Score %3D 69.9 E-value %3D 3.7e-18;gbkey=misc_feature;gene=secG
BX072543.1	EMBL	sequence_feature	503405	503473	.	-	.	ID=id913;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42 and 75-94;gbkey=misc_feature;gene=secG;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	503249	503308	.	-	.	ID=id913;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42 and 75-94;gbkey=misc_feature;gene=secG;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	503561	504442	.	-	.	ID=gene444;Name=tpiA;gbkey=Gene;gene=tpiA;gene_biotype=protein_coding;locus_tag=TW470
BX072543.1	EMBL	CDS	503561	504442	.	-	0	ID=cds444;Parent=gene444;Dbxref=GOA:Q83HP9,InterPro:IPR000652,InterPro:IPR013785,InterPro:IPR020861,InterPro:IPR022896,NCBI_GP:CAD67137.1;Name=CAD67137.1;Note=Similar to Corynebacterium glutamicum triosephosphate isomerase TpiA or Tpi or cgl1586 SWALL:TPIS_CORGL (SWALL:P19583) (259 aa) fasta scores: E(): 1e-15%2C 35%25 id in 280 aa;gbkey=CDS;gene=tpiA;product=triosephosphate isomerase;protein_id=CAD67137.1;transl_table=11
BX072543.1	EMBL	sequence_feature	503575	504391	.	-	.	ID=id914;Note=Triosephosphate isomerase Score %3D 87.4 E-value %3D 2.1e-23;gbkey=misc_feature;gene=tpiA
BX072543.1	EMBL	gene	504444	505631	.	-	.	ID=gene445;Name=pgk;gbkey=Gene;gene=pgk;gene_biotype=protein_coding;locus_tag=TW471
BX072543.1	EMBL	CDS	504444	505631	.	-	0	ID=cds445;Parent=gene445;Dbxref=GOA:Q83HP8,InterPro:IPR001576,InterPro:IPR015824,InterPro:IPR015901,NCBI_GP:CAD67138.1;Name=CAD67138.1;Note=Similar to Streptomyces coelicolor phosphoglycerate kinase Pgk or SCO1946 or SCC54.06c SWALL:PGK_STRCO (SWALL:Q9Z519) (403 aa) fasta scores: E(): 2.7e-64%2C 47.81%25 id in 389 aa%2C and to Thermotoga maritima bifunctional Pgk/Tim [includes: phosphoglycerate kinase pgk/tpi or tm0689 SWALL:PGKT_THEMA (SWALL:P36204) (654 aa) fasta scores: E(): 1.3e-55%2C 45.47%25 id in 387 aa;gbkey=CDS;gene=pgk;product=phosphoglycerate kinase;protein_id=CAD67138.1;transl_table=11
BX072543.1	EMBL	sequence_feature	504449	505622	.	-	.	ID=id915;Note=Phosphoglycerate kinase Score %3D 483.6 E-value %3D 1.1e-142;gbkey=misc_feature;gene=pgk
BX072543.1	EMBL	gene	505638	506651	.	-	.	ID=gene446;Name=gap;gbkey=Gene;gene=gap;gene_biotype=protein_coding;locus_tag=TW472
BX072543.1	EMBL	CDS	505638	506651	.	-	0	ID=cds446;Parent=gene446;Dbxref=GOA:Q83HP7,InterPro:IPR006424,InterPro:IPR016040,InterPro:IPR020828,InterPro:IPR020829,InterPro:IPR020830,InterPro:IPR020831,UniProtKB/TrEMBL:Q83HP7,NCBI_GP:CAD67139.1;Name=CAD67139.1;Note=Similar to Corynebacterium glutamicum glyceraldehyde 3-phosphate dehydrogenase Gap or cgl1588 SWALL:G3P_CORGL (SWALL:Q01651) (336 aa) fasta scores: E(): 2.2e-80%2C 59.58%25 id in 339 aa;gbkey=CDS;gene=gap;product=glyceraldehyde 3-phosphate dehydrogenase;protein_id=CAD67139.1;transl_table=11
BX072543.1	EMBL	sequence_feature	505709	506186	.	-	.	ID=id916;Note=Glyceraldehyde 3-phosphate dehydrogenase%2C C-terminal domain Score %3D 324.2 E-value %3D 1.1e-94;gbkey=misc_feature;gene=gap
BX072543.1	EMBL	sequence_feature	506172	506195	.	-	.	ID=id917;Note=PS00071 Glyceraldehyde 3-phosphate dehydrogenase active site.;gbkey=misc_feature;gene=gap
BX072543.1	EMBL	sequence_feature	506189	506648	.	-	.	ID=id918;Note=Glyceraldehyde 3-phosphate dehydrogenase%2C NAD binding domain Score %3D 265.2 E-value %3D 6.3e-77;gbkey=misc_feature;gene=gap
BX072543.1	EMBL	gene	506673	507281	.	-	.	ID=gene447;Name=sodA;gbkey=Gene;gene=sodA;gene_biotype=protein_coding;locus_tag=TW473
BX072543.1	EMBL	CDS	506673	507281	.	-	0	ID=cds447;Parent=gene447;Dbxref=GOA:Q83HP6,InterPro:IPR001189,InterPro:IPR019831,InterPro:IPR019832,InterPro:IPR019833,UniProtKB/TrEMBL:Q83HP6,NCBI_GP:CAD67140.1;Name=CAD67140.1;Note=Similar to Propionibacterium freudenreichii shermanii superoxide dismutase [mn/fe] sodA SWALL:SODM_PROFR (SWALL:P80293) (201 aa) fasta scores: E(): 9.6e-47%2C 61.53%25 id in 195 aa;gbkey=CDS;gene=sodA;product=superoxide dismutase;protein_id=CAD67140.1;transl_table=11
BX072543.1	EMBL	sequence_feature	506699	507020	.	-	.	ID=id919;Note=Iron/manganese superoxide dismutases%2C C-terminal domain Score %3D 147.4 E-value %3D 1.8e-41;gbkey=misc_feature;gene=sodA
BX072543.1	EMBL	sequence_feature	506784	506807	.	-	.	ID=id920;Note=PS00088 Manganese and iron superoxide dismutases signature.;gbkey=misc_feature;gene=sodA
BX072543.1	EMBL	sequence_feature	507032	507278	.	-	.	ID=id921;Note=Iron/manganese superoxide dismutases%2C alpha-hairpin domain Score %3D 150.6 E-value %3D 2e-42;gbkey=misc_feature;gene=sodA
BX072543.1	EMBL	gene	507366	508325	.	-	.	ID=gene448;Name=TW474;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW474
BX072543.1	EMBL	CDS	507366	508325	.	-	0	ID=cds448;Parent=gene448;Dbxref=GOA:Q83HP5,InterPro:IPR003802,InterPro:IPR018478,InterPro:IPR023054,InterPro:IPR027434,NCBI_GP:CAD67141.1;Name=CAD67141.1;Note=Similar to Streptomyces coelicolor WhiA SWALL:Q9S4Y1 (EMBL:AF106003) (330 aa) fasta scores: E(): 5e-40%2C 42.71%25 id in 309 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67141.1;transl_table=11
BX072543.1	EMBL	sequence_feature	507410	508283	.	-	.	ID=id922;Note=Uncharacterized BCR%2C COG1481 Score %3D 107.9 E-value %3D 1.4e-29;gbkey=misc_feature
BX072543.1	EMBL	gene	508335	510158	.	-	.	ID=gene449;Name=uvrC;gbkey=Gene;gene=uvrC;gene_biotype=protein_coding;locus_tag=TW475
BX072543.1	EMBL	CDS	508335	510158	.	-	0	ID=cds449;Parent=gene449;Dbxref=GOA:Q83NI9,InterPro:IPR000305,InterPro:IPR001162,InterPro:IPR001943,InterPro:IPR003583,InterPro:IPR004791,InterPro:IPR010994,InterPro:IPR027299,NCBI_GP:CAD67142.1;Name=CAD67142.1;Note=Similar to Escherichia coli excinuclease ABC subunit C UvrC or b1913 SWALL:UVRC_ECOLI (SWALL:P07028) (610 aa) fasta scores: E(): 2.9e-48%2C 32.72%25 id in 608 aa%2C and to Streptomyces coelicolor excinuclease ABC subunit C UvrC or SCO1953 or SCC54.13c SWALL:UVRC_STRCO (SWALL:Q9Z512) (728 aa) fasta scores: E(): 5.2e-62%2C 36.6%25 id in 672 aa;gbkey=CDS;gene=uvrC;product=excinuclease ABC subunit C;protein_id=CAD67142.1;transl_table=11
BX072543.1	EMBL	sequence_feature	509453	509558	.	-	.	ID=id923;Note=UvrB/uvrC motif Score %3D 30.2 E-value %3D 3.4e-06;gbkey=misc_feature;gene=uvrC
BX072543.1	EMBL	sequence_feature	509873	510125	.	-	.	ID=id924;Note=Endo/excinuclease amino terminal domain Score %3D 75.6 E-value %3D 7.2e-20;gbkey=misc_feature;gene=uvrC
BX072543.1	EMBL	gene	510167	513013	.	-	.	ID=gene450;Name=uvrA;gbkey=Gene;gene=uvrA;gene_biotype=protein_coding;locus_tag=TW476
BX072543.1	EMBL	CDS	510167	513013	.	-	0	ID=cds450;Parent=gene450;Dbxref=GOA:Q83NI8,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR004602,InterPro:IPR013815,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NI8,NCBI_GP:CAD67143.1;Name=CAD67143.1;Note=Similar to Escherichia coli excinuclease ABC subunit A UvrA or DinE or b4058 SWALL:UVRA_ECOLI (SWALL:P07671) (940 aa) fasta scores: E(): 2e-109%2C 48.39%25 id in 965 aa;gbkey=CDS;gene=uvrA;product=excinuclease ABC subunit A;protein_id=CAD67143.1;transl_table=11
BX072543.1	EMBL	sequence_feature	510277	511165	.	-	.	ID=id925;Note=ABC transporter Score %3D 88.6 E-value %3D 9e-24;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	sequence_feature	510458	510502	.	-	.	ID=id926;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	sequence_feature	511121	511144	.	-	.	ID=id927;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	sequence_feature	511363	512932	.	-	.	ID=id928;Note=ABC transporter Score %3D 5.5 E-value %3D 1.4e-06;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	sequence_feature	511547	511591	.	-	.	ID=id929;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	sequence_feature	512888	512911	.	-	.	ID=id930;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=uvrA
BX072543.1	EMBL	gene	513025	515058	.	-	.	ID=gene451;Name=uvrB;gbkey=Gene;gene=uvrB;gene_biotype=protein_coding;locus_tag=TW477
BX072543.1	EMBL	CDS	513025	515058	.	-	0	ID=cds451;Parent=gene451;Dbxref=GOA:Q83NI7,InterPro:IPR001650,InterPro:IPR001943,InterPro:IPR004807,InterPro:IPR006935,InterPro:IPR014001,InterPro:IPR024759,InterPro:IPR027417,NCBI_GP:CAD67144.1;Name=CAD67144.1;Note=Similar to Escherichia coli excinuclease ABC subunit B UvrB or b0779 or z0998 or ecs0857 SWALL:UVRB_ECOLI (SWALL:P07025) (673 aa) fasta scores: E(): 3.1e-133%2C 55.19%25 id in 674 aa;gbkey=CDS;gene=uvrB;product=excinuclease ABC subunit B;protein_id=CAD67144.1;transl_table=11
BX072543.1	EMBL	sequence_feature	513069	513174	.	-	.	ID=id931;Note=UvrB/uvrC motif Score %3D 46.8 E-value %3D 3.3e-11;gbkey=misc_feature;gene=uvrB
BX072543.1	EMBL	sequence_feature	513414	513642	.	-	.	ID=id932;Note=Helicase conserved C-terminal domain Score %3D 68.8 E-value %3D 8.3e-18;gbkey=misc_feature;gene=uvrB
BX072543.1	EMBL	sequence_feature	514906	514929	.	-	.	ID=id933;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=uvrB
BX072543.1	EMBL	gene	515051	515791	.	-	.	ID=gene452;Name=coaE;gbkey=Gene;gene=coaE;gene_biotype=protein_coding;locus_tag=TW478
BX072543.1	EMBL	CDS	515051	515791	.	-	0	ID=cds452;Parent=gene452;Dbxref=GOA:Q83HP4,InterPro:IPR001977,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HP4,NCBI_GP:CAD67145.1;Name=CAD67145.1;Note=Similar to Bacillus subtilis dephospho-CoA kinase CoaE SWALL:COAE_BACSU (SWALL:O34932) (197 aa) fasta scores: E(): 1.3e-06%2C 30.15%25 id in 199 aa;gbkey=CDS;gene=coaE;product=dephospho-CoA kinase;protein_id=CAD67145.1;transl_table=11
BX072543.1	EMBL	sequence_feature	515224	515782	.	-	.	ID=id934;Note=Dephospho-CoA kinase Score %3D 26.4 E-value %3D 1.2e-13;gbkey=misc_feature;gene=coaE
BX072543.1	EMBL	sequence_feature	515741	515764	.	-	.	ID=id935;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=coaE
BX072543.1	EMBL	gene	515795	517216	.	-	.	ID=gene453;Name=rpsA;gbkey=Gene;gene=rpsA;gene_biotype=protein_coding;locus_tag=TW479
BX072543.1	EMBL	CDS	515795	517216	.	-	0	ID=cds453;Parent=gene453;Dbxref=GOA:Q83HP3,InterPro:IPR000110,InterPro:IPR003029,InterPro:IPR012340,InterPro:IPR022967,UniProtKB/TrEMBL:Q83HP3,NCBI_GP:CAD67146.1;Name=CAD67146.1;Note=Similar to Escherichia coli 30s ribosomal protein S1 RpsA or SsyF or b0911 or z1257 or ecs0994 SWALL:RS1_ECOLI (SWALL:P02349) (557 aa) fasta scores: E(): 2.4e-47%2C 42.69%25 id in 349 aa%2C and to Streptomyces coelicolor 30s ribosomal protein S1 RpsA or SCO1998 or SC7H2.12c SWALL:Q9S2K5 (EMBL:AL109732) (502 aa) fasta scores: E(): 3.1e-103%2C 58.33%25 id in 468 aa;gbkey=CDS;gene=rpsA;product=30s ribosomal protein S1;protein_id=CAD67146.1;transl_table=11
BX072543.1	EMBL	sequence_feature	516151	516370	.	-	.	ID=id936;Note=S1 RNA binding domain Score %3D 80.0 E-value %3D 3.3e-21;gbkey=misc_feature;gene=rpsA
BX072543.1	EMBL	sequence_feature	516409	516625	.	-	.	ID=id937;Note=S1 RNA binding domain Score %3D 116.2 E-value %3D 4.5e-32;gbkey=misc_feature;gene=rpsA
BX072543.1	EMBL	sequence_feature	516676	516883	.	-	.	ID=id938;Note=S1 RNA binding domain Score %3D 62.7 E-value %3D 5.5e-16;gbkey=misc_feature;gene=rpsA
BX072543.1	EMBL	sequence_feature	516925	517144	.	-	.	ID=id939;Note=S1 RNA binding domain Score %3D 60.0 E-value %3D 3.6e-15;gbkey=misc_feature;gene=rpsA
BX072543.1	EMBL	gene	517394	518464	.	-	.	ID=gene454;Name=polA;gbkey=Gene;gene=polA;gene_biotype=protein_coding;locus_tag=TW480
BX072543.1	EMBL	CDS	517394	518464	.	-	0	ID=cds454;Parent=gene454;Dbxref=GOA:Q83HP2,InterPro:IPR002421,InterPro:IPR008918,InterPro:IPR020045,InterPro:IPR020046,InterPro:IPR029060,UniProtKB/TrEMBL:Q83HP2,NCBI_GP:CAD67147.1;Name=CAD67147.1;Note=Similar to Mycobacterium tuberculosis DNA polymerase I PolA or Rv1629 or mt1665 or mtcy01b2.21 SWALL:DPO1_MYCTU (SWALL:Q07700) (904 aa) fasta scores: E(): 1.4e-36%2C 42.91%25 id in 268 aa;gbkey=CDS;gene=polA;product=DNA polymerase I;protein_id=CAD67147.1;transl_table=11
BX072543.1	EMBL	sequence_feature	517633	517930	.	-	.	ID=id940;Note=5'-3' exonuclease%2C C-terminal SAM fold Score %3D 85.8 E-value %3D 6.1e-23;gbkey=misc_feature;gene=polA
BX072543.1	EMBL	sequence_feature	517936	518440	.	-	.	ID=id941;Note=5'-3' exonuclease%2C N-terminal resolvase-like domain Score %3D 213.0 E-value %3D 3.2e-61;gbkey=misc_feature;gene=polA
BX072543.1	EMBL	gene	518480	519088	.	-	.	ID=gene455;Name=TW481;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW481
BX072543.1	EMBL	CDS	518480	519088	.	-	0	ID=cds455;Parent=gene455;Dbxref=GOA:Q83NI6,InterPro:IPR001789,InterPro:IPR005561,InterPro:IPR008327,InterPro:IPR011006,InterPro:IPR011991,UniProtKB/TrEMBL:Q83NI6,NCBI_GP:CAD67148.1;Name=CAD67148.1;Note=Similar to Streptomyces coelicolor putative response regulator SCO2013 or SC7H2.27c SWALL:Q9S2J0 (EMBL:AL109732) (218 aa) fasta scores: E(): 3.7e-35%2C 53.51%25 id in 185 aa%2C and to Streptomyces coelicolor AbsA2 or SCO3226 or SCE8.19 SWALL:Q53894 (EMBL:U51332) (222 aa) fasta scores: E(): 7.4e-11%2C 43.47%25 id in 115 aa%2C and to Bacillus subtilis chemotaxis protein CheY homolog or CheB SWALL:CHEY_BACSU (SWALL:P24072) (119 aa) fasta scores: E(): 1.2e-10%2C 38.59%25 id in 114 aa;gbkey=CDS;product=putative two-component system response regulator;protein_id=CAD67148.1;transl_table=11
BX072543.1	EMBL	sequence_feature	518503	518668	.	-	.	ID=id942;Note=ANTAR domain Score %3D 66.3 E-value %3D 4.7e-17;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	518692	519043	.	-	.	ID=id943;Note=Response regulator receiver domain Score %3D 108.9 E-value %3D 7.1e-30;gbkey=misc_feature
BX072543.1	EMBL	tRNA	519126	519211	.	+	.	ID=rna26;Note=tRNA Leu anticodon CAA%2C Cove score 62.38;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	exon	519126	519211	.	+	.	ID=id944;Parent=rna26;Note=tRNA Leu anticodon CAA%2C Cove score 62.38;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	gene	519320	520735	.	-	.	ID=gene456;Name=pyk;gbkey=Gene;gene=pyk;gene_biotype=protein_coding;locus_tag=TW482
BX072543.1	EMBL	CDS	519320	520735	.	-	0	ID=cds456;Parent=gene456;Dbxref=GOA:Q83HP1,InterPro:IPR001697,InterPro:IPR011037,InterPro:IPR015793,InterPro:IPR015794,InterPro:IPR015795,InterPro:IPR015806,InterPro:IPR015813,InterPro:IPR018209,UniProtKB/TrEMBL:Q83HP1,NCBI_GP:CAD67149.1;Name=CAD67149.1;Note=Similar to Corynebacterium glutamicum pyruvate kinase Pyk or cgl2089 SWALL:KPYK_CORGL (SWALL:Q46078) (475 aa) fasta scores: E(): 1.1e-83%2C 50.63%25 id in 470 aa;gbkey=CDS;gene=pyk;product=pyruvate kinase;protein_id=CAD67149.1;transl_table=11
BX072543.1	EMBL	sequence_feature	519340	519679	.	-	.	ID=id945;Note=Pyruvate kinase%2C alpha/beta domain Score %3D 28.6 E-value %3D 7.4e-08;gbkey=misc_feature;gene=pyk
BX072543.1	EMBL	sequence_feature	519709	520735	.	-	.	ID=id946;Note=Pyruvate kinase%2C barrel domain Score %3D 454.1 E-value %3D 8.5e-134;gbkey=misc_feature;gene=pyk
BX072543.1	EMBL	sequence_feature	520064	520102	.	-	.	ID=id947;Note=PS00110 Pyruvate kinase active site signature.;gbkey=misc_feature;gene=pyk
BX072543.1	EMBL	tRNA	520790	520861	.	-	.	ID=rna27;Note=tRNA Arg anticodon CCT%2C Cove score 64.16;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	exon	520790	520861	.	-	.	ID=id948;Parent=rna27;Note=tRNA Arg anticodon CCT%2C Cove score 64.16;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	gene	520865	521758	.	-	.	ID=gene457;Name=TW483;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW483
BX072543.1	EMBL	CDS	520865	521758	.	-	0	ID=cds457;Parent=gene457;Dbxref=InterPro:IPR000064,UniProtKB/TrEMBL:Q83NI5,NCBI_GP:CAD67150.1;Name=CAD67150.1;Note=C-terminal region similar to those from proteins of undefined function eg. Clostridium acetobutylicum starch degrading enzyme precursor SWALL:Q45834 (EMBL:X70334) (503 aa) fasta scores: E(): 2.7e-11%2C 38.51%25 id in 148 aa;gbkey=CDS;product=NLP/P60-family protein;protein_id=CAD67150.1;transl_table=11
BX072543.1	EMBL	sequence_feature	520876	521179	.	-	.	ID=id949;Note=NLP/P60 family Score %3D 123.3 E-value %3D 3.1e-34;gbkey=misc_feature
BX072543.1	EMBL	tRNA	521849	521921	.	-	.	ID=rna28;Note=tRNA Asn anticodon GTT%2C Cove score 73.50;gbkey=tRNA;product=tRNA-Asn
BX072543.1	EMBL	exon	521849	521921	.	-	.	ID=id950;Parent=rna28;Note=tRNA Asn anticodon GTT%2C Cove score 73.50;gbkey=tRNA;product=tRNA-Asn
BX072543.1	EMBL	gene	522062	523873	.	-	.	ID=gene458;Name=dnaG;gbkey=Gene;gene=dnaG;gene_biotype=protein_coding;locus_tag=TW484
BX072543.1	EMBL	CDS	522062	523873	.	-	0	ID=cds458;Parent=gene458;Dbxref=GOA:Q83HP0,InterPro:IPR002694,InterPro:IPR006171,InterPro:IPR006295,InterPro:IPR013264,InterPro:IPR019475,UniProtKB/TrEMBL:Q83HP0,NCBI_GP:CAD67151.1;Name=CAD67151.1;Note=Similar to Mycobacterium smegmatis DNA primase DnaG SWALL:PRIM_MYCSM (SWALL:O52200) (636 aa) fasta scores: E(): 1.1e-43%2C 36.34%25 id in 630 aa%2C and to Escherichia coli DNA primase DnaG or DnaP or ParB or b3066 or z4419 or ecs3949 SWALL:PRIM_ECOLI (SWALL:P02923) (581 aa) fasta scores: E(): 5.1e-37%2C 34.7%25 id in 438 aa;gbkey=CDS;gene=dnaG;product=DNA primase;protein_id=CAD67151.1;transl_table=11
BX072543.1	EMBL	sequence_feature	522880	523126	.	-	.	ID=id951;Note=Toprim domain Score %3D 49.3 E-value %3D 6e-12;gbkey=misc_feature;gene=dnaG
BX072543.1	EMBL	sequence_feature	523573	523864	.	-	.	ID=id952;Note=CHC2 zinc finger Score %3D 166.6 E-value %3D 2.9e-47;gbkey=misc_feature;gene=dnaG
BX072543.1	EMBL	gene	523870	525309	.	-	.	ID=gene459;Name=dgt;gbkey=Gene;gene=dgt;gene_biotype=protein_coding;locus_tag=TW485
BX072543.1	EMBL	CDS	523870	525309	.	-	0	ID=cds459;Parent=gene459;Dbxref=GOA:Q83HN9,InterPro:IPR003607,InterPro:IPR006261,InterPro:IPR006674,InterPro:IPR023293,InterPro:IPR026875,UniProtKB/TrEMBL:Q83HN9,NCBI_GP:CAD67152.1;Name=CAD67152.1;Note=Similar to Escherichia coli deoxyguanosinetriphosphate triphosphohydrolase Dgt or b0160 SWALL:DGTP_ECOLI (SWALL:P15723) (504 aa) fasta scores: E(): 0.016%2C 26.32%25 id in 452 aa%2C and to Mycobacterium smegmatis deoxyguanosinetriphosphate triphosphohydrolase-like protein Dgt SWALL:DGT1_MYCSM (SWALL:O52199) (428 aa) fasta scores: E(): 2.9e-33%2C 42.72%25 id in 440 aa;gbkey=CDS;gene=dgt;product=deoxyguanosinetriphosphate triphosphohydrolase;protein_id=CAD67152.1;transl_table=11
BX072543.1	EMBL	sequence_feature	524568	525075	.	-	.	ID=id953;Note=HD domain Score %3D 42.6 E-value %3D 6.1e-10;gbkey=misc_feature;gene=dgt
BX072543.1	EMBL	gene	525319	526068	.	-	.	ID=gene460;Name=uppS2;gbkey=Gene;gene=uppS2;gene_biotype=protein_coding;locus_tag=TW486
BX072543.1	EMBL	CDS	525319	526068	.	-	0	ID=cds460;Parent=gene460;Dbxref=GOA:Q83HN8,InterPro:IPR001441,InterPro:IPR018520,NCBI_GP:CAD67153.1;Name=CAD67153.1;Note=Similar to Mycobacterium tuberculosis undecaprenyl pyrophosphate synthetase UppS or Rv2361c or mt2430 or mtcy27.19 SWALL:UPPS_MYCTU (SWALL:O05837) (296 aa) fasta scores: E(): 2.8e-53%2C 54.89%25 id in 235 aa%2C and to Micrococcus luteus undecaprenyl pyrophosphate synthetase UppS SWALL:UPPS_MICLU (SWALL:O82827) (249 aa) fasta scores: E(): 1.8e-33%2C 38.03%25 id in 234 aa;gbkey=CDS;gene=uppS2;product=undecaprenyl pyrophosphate synthetase;protein_id=CAD67153.1;transl_table=11
BX072543.1	EMBL	sequence_feature	525324	525987	.	-	.	ID=id954;Note=Putative undecaprenyl diphosphate synthase Score %3D 348.9 E-value %3D 4e-102;gbkey=misc_feature;gene=uppS2
BX072543.1	EMBL	gene	526096	526839	.	-	.	ID=gene461;Name=recO;gbkey=Gene;gene=recO;gene_biotype=protein_coding;locus_tag=TW487
BX072543.1	EMBL	CDS	526096	526839	.	-	0	ID=cds461;Parent=gene461;Dbxref=GOA:Q83NI4,InterPro:IPR003717,InterPro:IPR012340,InterPro:IPR022572,UniProtKB/TrEMBL:Q83NI4,NCBI_GP:CAD67154.1;Name=CAD67154.1;Note=Similar to Escherichia coli DNA repair protein RecO or b2565 or z3846 or ecs3431 SWALL:RECO_ECOLI (SWALL:P15027) (242 aa) fasta scores: E(): 0.051%2C 26.27%25 id in 236 aa%2C and to Streptomyces coelicolor DNA repair protein RecO or SCO2510 or SCC121.13c SWALL:RECO_STRCO (SWALL:Q9L2H3) (251 aa) fasta scores: E(): 9.8e-24%2C 38.36%25 id in 245 aa;gbkey=CDS;gene=recO;product=DNA repair protein RecO;protein_id=CAD67154.1;transl_table=11
BX072543.1	EMBL	sequence_feature	526101	526818	.	-	.	ID=id955;Note=Recombination protein O Score %3D 69.2 E-value %3D 6.2e-18;gbkey=misc_feature;gene=recO
BX072543.1	EMBL	gene	526847	527752	.	-	.	ID=gene462;Name=era;gbkey=Gene;gene=era;gene_biotype=protein_coding;locus_tag=TW488
BX072543.1	EMBL	CDS	526847	527752	.	-	0	ID=cds462;Parent=gene462;Dbxref=GOA:Q83NI3,InterPro:IPR004044,InterPro:IPR005225,InterPro:IPR005662,InterPro:IPR006073,InterPro:IPR009019,InterPro:IPR015946,InterPro:IPR027417,NCBI_GP:CAD67155.1;Name=CAD67155.1;Note=Similar to Streptococcus gordonii Challis GTP-binding protein Era or Sgg SWALL:ERA_STRGC (SWALL:O24756) (299 aa) fasta scores: E(): 2e-31%2C 38.81%25 id in 286 aa;gbkey=CDS;gene=era;product=GTP-binding protein;protein_id=CAD67155.1;transl_table=11
BX072543.1	EMBL	sequence_feature	527675	527698	.	-	.	ID=id956;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=era
BX072543.1	EMBL	gene	527739	528254	.	-	.	ID=gene463;Name=TW489;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW489
BX072543.1	EMBL	CDS	527739	528254	.	-	0	ID=cds463;Parent=gene463;Dbxref=GOA:Q83HN7,InterPro:IPR002036,InterPro:IPR020549,InterPro:IPR023091,NCBI_GP:CAD67156.1;Name=CAD67156.1;Note=Similar to Mycobacterium leprae hypothetical protein Ml0628 or b1937_f1_21 SWALL:YN67_MYCLE (SWALL:Q49752) (178 aa) fasta scores: E(): 3.3e-15%2C 35.61%25 id in 146 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67156.1;transl_table=11
BX072543.1	EMBL	sequence_feature	527828	528125	.	-	.	ID=id957;Note=Uncharacterized protein family UPF0054 Score %3D 89.1 E-value %3D 6.4e-24;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	527880	527912	.	-	.	ID=id958;Note=PS01306 Uncharacterized protein family UPF0054 signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	528251	528574	.	-	.	ID=gene464;Name=TW490;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW490
BX072543.1	EMBL	CDS	528251	528574	.	-	0	ID=cds464;Parent=gene464;Dbxref=GOA:Q83HN6,InterPro:IPR001310,InterPro:IPR011146,UniProtKB/TrEMBL:Q83HN6,NCBI_GP:CAD67157.1;Name=CAD67157.1;Note=Similar to Synechocystis sp. hypothetical hit-like protein Slr1234 SWALL:YHIT_SYNY3 (SWALL:P73481) (114 aa) fasta scores: E(): 6.7e-15%2C 43.13%25 id in 102 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67157.1;transl_table=11
BX072543.1	EMBL	sequence_feature	528256	528574	.	-	.	ID=id959;Note=HIT family Score %3D 81.1 E-value %3D 1.6e-21;gbkey=misc_feature
BX072543.1	EMBL	gene	528610	529317	.	-	.	ID=gene465;Name=TW491;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW491
BX072543.1	EMBL	CDS	528610	529317	.	-	0	ID=cds465;Parent=gene465;Dbxref=GOA:Q83HN5,InterPro:IPR006700,InterPro:IPR015947,InterPro:IPR029026,InterPro:IPR029028,UniProtKB/TrEMBL:Q83HN5,NCBI_GP:CAD67158.1;Name=CAD67158.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2372c or mt2441 or mtcy27.08 SWALL:YN72_MYCTU (SWALL:O05826) (262 aa) fasta scores: E(): 9.5e-16%2C 30.24%25 id in 248 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67158.1;transl_table=11
BX072543.1	EMBL	sequence_feature	528633	528945	.	-	.	ID=id960;Note=Protein of unknown function (DUF558) Score %3D 66.2 E-value %3D 5e-17;gbkey=misc_feature
BX072543.1	EMBL	gene	529351	530397	.	-	.	ID=gene466;Name=dnaJ1;gbkey=Gene;gene=dnaJ1;gene_biotype=protein_coding;locus_tag=TW492
BX072543.1	EMBL	CDS	529351	530397	.	-	0	ID=cds466;Parent=gene466;Dbxref=GOA:Q83NI2,InterPro:IPR001305,InterPro:IPR001623,InterPro:IPR002939,InterPro:IPR008971,InterPro:IPR012724,InterPro:IPR018253,NCBI_GP:CAD67159.1;Name=CAD67159.1;Note=Similar to Escherichia coli chaperone protein DnaJ or GroP or b0015 SWALL:DNAJ_ECOLI (SWALL:P08622) (375 aa) fasta scores: E(): 1.7e-31%2C 34.85%25 id in 373 aa;gbkey=CDS;gene=dnaJ1;product=chaperone protein DnaJ;protein_id=CAD67159.1;transl_table=11
BX072543.1	EMBL	sequence_feature	529428	529782	.	-	.	ID=id961;Note=DnaJ C terminal region Score %3D 120.5 E-value %3D 2.2e-33;gbkey=misc_feature;gene=dnaJ1
BX072543.1	EMBL	sequence_feature	529821	530073	.	-	.	ID=id962;Note=DnaJ central domain (4 repeats) Score %3D 65.4 E-value %3D 8.5e-17;gbkey=misc_feature;gene=dnaJ1
BX072543.1	EMBL	sequence_feature	530205	530307	.	-	.	ID=id963;Note=DnaJ domain Score %3D 8.5 E-value %3D 8e-05;gbkey=misc_feature;gene=dnaJ1
BX072543.1	EMBL	sequence_feature	530215	530274	.	-	.	ID=id964;Note=PS00636 Nt-dnaJ domain signature.;gbkey=misc_feature;gene=dnaJ1
BX072543.1	EMBL	gene	530842	531444	.	-	.	ID=gene467;Name=TW493;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW493
BX072543.1	EMBL	CDS	530842	531444	.	-	0	ID=cds467;Parent=gene467;Dbxref=InterPro:IPR018960,UniProtKB/TrEMBL:Q83HN4,NCBI_GP:CAD67160.1;Name=CAD67160.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67160.1;transl_table=11
BX072543.1	EMBL	gene	531458	533263	.	-	.	ID=gene468;Name=lepA;gbkey=Gene;gene=lepA;gene_biotype=protein_coding;locus_tag=TW494
BX072543.1	EMBL	CDS	531458	533263	.	-	0	ID=cds468;Parent=gene468;Dbxref=GOA:Q83NI1,InterPro:IPR000640,InterPro:IPR000795,InterPro:IPR004161,InterPro:IPR005225,InterPro:IPR006297,InterPro:IPR009022,InterPro:IPR013842,InterPro:IPR027417,NCBI_GP:CAD67161.1;Name=CAD67161.1;Note=Similar to Escherichia coli GTP-binding protein LepA or b2569 or z3851 or ecs3435 SWALL:LEPA_ECOLI (SWALL:P07682) (599 aa) fasta scores: E(): 5.7e-114%2C 49.83%25 id in 592 aa;gbkey=CDS;gene=lepA;product=GTP-binding protein LepA;protein_id=CAD67161.1;transl_table=11
BX072543.1	EMBL	sequence_feature	531793	532060	.	-	.	ID=id965;Note=Elongation factor G C-terminus Score %3D 129.1 E-value %3D 5.8e-36;gbkey=misc_feature;gene=lepA
BX072543.1	EMBL	sequence_feature	532426	532672	.	-	.	ID=id966;Note=Elongation factor Tu domain 2 Score %3D 51.2 E-value %3D 1.6e-12;gbkey=misc_feature;gene=lepA
BX072543.1	EMBL	sequence_feature	532699	533242	.	-	.	ID=id967;Note=Elongation factor Tu GTP binding domain Score %3D 222.4 E-value %3D 4.7e-64;gbkey=misc_feature;gene=lepA
BX072543.1	EMBL	sequence_feature	533075	533122	.	-	.	ID=id968;Note=PS00301 GTP-binding elongation factors signature.;gbkey=misc_feature;gene=lepA
BX072543.1	EMBL	sequence_feature	533192	533215	.	-	.	ID=id969;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=lepA
BX072543.1	EMBL	gene	533550	533837	.	+	.	ID=gene469;Name=rpsT;gbkey=Gene;gene=rpsT;gene_biotype=protein_coding;locus_tag=TW495
BX072543.1	EMBL	CDS	533550	533837	.	+	0	ID=cds469;Parent=gene469;Dbxref=GOA:Q83HN3,InterPro:IPR002583,NCBI_GP:CAD67162.1;Name=CAD67162.1;Note=Similar to Escherichia coli 30s ribosomal protein S20 RpsT or b0023 or z0027 or ecs0026 SWALL:RS20_ECOLI (SWALL:P02378) (86 aa) fasta scores: E(): 0.0017%2C 34.14%25 id in 82 aa%2C and to Streptomyces coelicolor 30s ribosomal protein S20 RpsT or SCO2563 or SCC123.01 SWALL:RS20_STRCO (SWALL:Q9RDM3) (88 aa) fasta scores: E(): 1.7e-14%2C 62.06%25 id in 87 aa;gbkey=CDS;gene=rpsT;product=30s ribosomal protein S20;protein_id=CAD67162.1;transl_table=11
BX072543.1	EMBL	sequence_feature	533553	533802	.	+	.	ID=id970;Note=Ribosomal protein S20 Score %3D 100.1 E-value %3D 3e-27;gbkey=misc_feature;gene=rpsT
BX072543.1	EMBL	gene	533898	536120	.	-	.	ID=gene470;Name=relA;gbkey=Gene;gene=relA;gene_biotype=protein_coding;locus_tag=TW496
BX072543.1	EMBL	CDS	533898	536120	.	-	0	ID=cds470;Parent=gene470;Dbxref=GOA:Q83HN2,InterPro:IPR002912,InterPro:IPR003607,InterPro:IPR004095,InterPro:IPR004811,InterPro:IPR007685,InterPro:IPR012675,InterPro:IPR012676,UniProtKB/TrEMBL:Q83HN2,NCBI_GP:CAD67163.1;Name=CAD67163.1;Note=Similar to Corynebacterium glutamicum GTP pyrophosphokinase RelA or cgl1653 SWALL:RELA_CORGL (SWALL:O87331) (760 aa) fasta scores: E(): 2e-124%2C 43.98%25 id in 732 aa%2C and to Escherichia coli GTP pyrophosphokinase RelA or b2784 or z4099 or ecs3644 SWALL:RELA_ECOLI (SWALL:P11585) (744 aa) fasta scores: E(): 3.3e-79%2C 34.23%25 id in 739 aa;gbkey=CDS;gene=relA;product=GTP pyrophosphokinase;protein_id=CAD67163.1;transl_table=11
BX072543.1	EMBL	sequence_feature	533903	534119	.	-	.	ID=id971;Note=ACT domain Score %3D 39.8 E-value %3D 4.3e-09;gbkey=misc_feature;gene=relA
BX072543.1	EMBL	sequence_feature	534704	534893	.	-	.	ID=id972;Note=TGS domain Score %3D 98.2 E-value %3D 1.2e-26;gbkey=misc_feature;gene=relA
BX072543.1	EMBL	sequence_feature	535025	535355	.	-	.	ID=id973;Note=Region found in RelA / SpoT proteins Score %3D 218.6 E-value %3D 6.5e-63;gbkey=misc_feature;gene=relA
BX072543.1	EMBL	sequence_feature	535628	535919	.	-	.	ID=id974;Note=HD domain Score %3D 34.8 E-value %3D 1.4e-07;gbkey=misc_feature;gene=relA
BX072543.1	EMBL	gene	536344	536976	.	-	.	ID=gene471;Name=TW497;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW497
BX072543.1	EMBL	CDS	536344	536976	.	-	0	ID=cds471;Parent=gene471;Dbxref=InterPro:IPR000601,UniProtKB/TrEMBL:Q83HN1,NCBI_GP:CAD67164.1;Name=CAD67164.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67164.1;transl_table=11
BX072543.1	EMBL	gene	537313	538281	.	-	.	ID=gene472;Name=secF;gbkey=Gene;gene=secF;gene_biotype=protein_coding;locus_tag=TW498
BX072543.1	EMBL	CDS	537313	538281	.	-	0	ID=cds472;Parent=gene472;Dbxref=GOA:Q83NI0,InterPro:IPR005665,InterPro:IPR022645,InterPro:IPR022813,UniProtKB/TrEMBL:Q83NI0,NCBI_GP:CAD67165.1;Name=CAD67165.1;Note=Similar to Streptomyces coelicolor protein-export membrane protein SecF or SCO1515 or SCL2.05c SWALL:SECF_STRCO (SWALL:Q53956) (373 aa) fasta scores: E(): 2.7e-43%2C 42.15%25 id in 325 aa%2C and to Escherichia coli protein-export membrane protein SecF or b0409 or z0508 or ecs0460 SWALL:SECF_ECOLI (SWALL:P19674) (323 aa) fasta scores: E(): 4.9e-19%2C 29.41%25 id in 323 aa;gbkey=CDS;gene=secF;product=protein-export membrane protein SecF;protein_id=CAD67165.1;transl_table=11
BX072543.1	EMBL	sequence_feature	537372	538173	.	-	.	ID=id975;Note=Protein export membrane protein Score %3D 270.2 E-value %3D 1.9e-78;gbkey=misc_feature;gene=secF
BX072543.1	EMBL	sequence_feature	538138	538206	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	537802	537861	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	537721	537789	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	537640	537708	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	537472	537540	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	537376	537444	.	-	.	ID=id976;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 141-160%2C 165-187%2C 192-214%2C 248-270 and 280-302;gbkey=misc_feature;gene=secF;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	gene	538281	539903	.	-	.	ID=gene473;Name=secD;gbkey=Gene;gene=secD;gene_biotype=protein_coding;locus_tag=TW499
BX072543.1	EMBL	CDS	538281	539903	.	-	0	ID=cds473;Parent=gene473;Dbxref=GOA:Q83NH9,InterPro:IPR005791,InterPro:IPR022645,InterPro:IPR022813,UniProtKB/TrEMBL:Q83NH9,NCBI_GP:CAD67166.1;Name=CAD67166.1;Note=Similar to Streptomyces coelicolor protein-export membrane protein SecD or SCO1516 or SCL2.06c SWALL:SECD_STRCO (SWALL:Q53955) (570 aa) fasta scores: E(): 3e-52%2C 40.21%25 id in 552 aa%2C and to Corynebacterium glutamicum SecD SWALL:Q9AE07 (EMBL:AF038651) (637 aa) fasta scores: E(): 7.8e-32%2C 31.01%25 id in 590 aa;gbkey=CDS;gene=secD;product=protein-export membrane protein SecD;protein_id=CAD67166.1;transl_table=11
BX072543.1	EMBL	sequence_feature	538400	539198	.	-	.	ID=id977;Note=Protein export membrane protein Score %3D -55.5 E-value %3D 3.3e-06;gbkey=misc_feature;gene=secD
BX072543.1	EMBL	sequence_feature	538821	538880	.	-	.	ID=id978;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 342-361%2C 366-388%2C 398-420%2C 453-470 and 474-496;gbkey=misc_feature;gene=secD;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	538740	538808	.	-	.	ID=id978;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 342-361%2C 366-388%2C 398-420%2C 453-470 and 474-496;gbkey=misc_feature;gene=secD;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	538644	538712	.	-	.	ID=id978;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 342-361%2C 366-388%2C 398-420%2C 453-470 and 474-496;gbkey=misc_feature;gene=secD;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	538494	538547	.	-	.	ID=id978;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 342-361%2C 366-388%2C 398-420%2C 453-470 and 474-496;gbkey=misc_feature;gene=secD;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	538416	538484	.	-	.	ID=id978;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 342-361%2C 366-388%2C 398-420%2C 453-470 and 474-496;gbkey=misc_feature;gene=secD;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	539982	540473	.	-	.	ID=gene474;Name=TW500;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW500
BX072543.1	EMBL	CDS	539982	540473	.	-	0	ID=cds474;Parent=gene474;Dbxref=InterPro:IPR003849,UniProtKB/TrEMBL:Q83NH8,NCBI_GP:CAD67167.1;Name=CAD67167.1;Note=Similar to Streptomyces coelicolor putative secreted protein SCO1517 or SCL2.07c SWALL:Q9L292 (EMBL:AL137778) (169 aa) fasta scores: E(): 0.038%2C 25.74%25 id in 167 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67167.1;transl_table=11
BX072543.1	EMBL	sequence_feature	540411	540464	.	-	.	ID=id979;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 4-21;gbkey=misc_feature
BX072543.1	EMBL	gene	540495	541490	.	-	.	ID=gene475;Name=ruvB;gbkey=Gene;gene=ruvB;gene_biotype=protein_coding;locus_tag=TW501
BX072543.1	EMBL	CDS	540495	541490	.	-	0	ID=cds475;Parent=gene475;Dbxref=GOA:Q83HN0,InterPro:IPR003593,InterPro:IPR004605,InterPro:IPR008823,InterPro:IPR008824,InterPro:IPR011991,InterPro:IPR027417,NCBI_GP:CAD67168.1;Name=CAD67168.1;Note=Similar to Escherichia coli holliday junction DNA helicase RuvB or b1860 or z2912 or ecs2570 SWALL:RUVB_ECOLI (SWALL:P08577) (336 aa) fasta scores: E(): 3.6e-57%2C 54.4%25 id in 318 aa;gbkey=CDS;gene=ruvB;product=holliday junction DNA helicase RuvB;protein_id=CAD67168.1;transl_table=11
BX072543.1	EMBL	sequence_feature	540818	541355	.	-	.	ID=id980;Note=ATPase family associated with various cellular activities (AAA) Score %3D 97.7 E-value %3D 1.6e-26;gbkey=misc_feature;gene=ruvB
BX072543.1	EMBL	sequence_feature	541317	541340	.	-	.	ID=id981;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=ruvB
BX072543.1	EMBL	gene	541501	542025	.	-	.	ID=gene476;Name=ruvA;gbkey=Gene;gene=ruvA;gene_biotype=protein_coding;locus_tag=TW502
BX072543.1	EMBL	CDS	541501	542025	.	-	0	ID=cds476;Parent=gene476;Dbxref=GOA:Q83HM9,InterPro:IPR000085,InterPro:IPR003583,InterPro:IPR010994,InterPro:IPR011114,InterPro:IPR012340,InterPro:IPR013849,UniProtKB/TrEMBL:Q83HM9,NCBI_GP:CAD67169.1;Name=CAD67169.1;Note=Similar to Thermus thermophilus holliday junction DNA helicase RuvA SWALL:RUVA_THETH (SWALL:Q9F1Q3) (191 aa) fasta scores: E(): 1e-15%2C 38.23%25 id in 170 aa;gbkey=CDS;gene=ruvA;product=holliday junction DNA helicase RuvA;protein_id=CAD67169.1;transl_table=11
BX072543.1	EMBL	sequence_feature	541686	541902	.	-	.	ID=id982;Note=RuvA central domain II Score %3D 77.5 E-value %3D 2e-20;gbkey=misc_feature;gene=ruvA
BX072543.1	EMBL	sequence_feature	541908	542022	.	-	.	ID=id983;Note=RuvA N terminal domain Score %3D 24.1 E-value %3D 1.3e-08;gbkey=misc_feature;gene=ruvA
BX072543.1	EMBL	gene	542124	542675	.	-	.	ID=gene477;Name=ruvC;gbkey=Gene;gene=ruvC;gene_biotype=protein_coding;locus_tag=TW503
BX072543.1	EMBL	CDS	542124	542675	.	-	0	ID=cds477;Parent=gene477;Dbxref=GOA:Q83HM8,InterPro:IPR002176,InterPro:IPR012337,InterPro:IPR020563,UniProtKB/TrEMBL:Q83HM8,NCBI_GP:CAD67170.1;Name=CAD67170.1;Note=Similar to Escherichia coli crossover junction endodeoxyribonuclease RuvC or b1863 or z2915 or ecs2573 SWALL:RUVC_ECOLI (SWALL:P24239) (172 aa) fasta scores: E(): 2e-07%2C 27.38%25 id in 168 aa%2C and to Mycobacterium leprae crossover junction endodeoxyribonuclease RuvC or ml0481 or b1177_c3_226 SWALL:RUVC_MYCLE (SWALL:P40834) (188 aa) fasta scores: E(): 1.6e-20%2C 40%25 id in 185 aa;gbkey=CDS;gene=ruvC;product=crossover junction endodeoxyribonuclease RuvC;protein_id=CAD67170.1;transl_table=11
BX072543.1	EMBL	sequence_feature	542222	542669	.	-	.	ID=id984;Note=Crossover junction endodeoxyribonuclease RuvC Score %3D 108.8 E-value %3D 7.6e-30;gbkey=misc_feature;gene=ruvC
BX072543.1	EMBL	gene	542666	543424	.	-	.	ID=gene478;Name=TW504;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW504
BX072543.1	EMBL	CDS	542666	543424	.	-	0	ID=cds478;Parent=gene478;Dbxref=GOA:P67192,InterPro:IPR002876,InterPro:IPR017856,InterPro:IPR026563,InterPro:IPR026564,InterPro:IPR029072,NCBI_GP:CAD67171.1;Name=CAD67171.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2603c or mt2678 or mtci270a.02 SWALL:YQ03_MYCTU (SWALL:O33214) (251 aa) fasta scores: E(): 5.5e-43%2C 52.01%25 id in 248 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67171.1;transl_table=11
BX072543.1	EMBL	sequence_feature	542692	543412	.	-	.	ID=id985;Note=Domain of unknown function DUF28 Score %3D 320.5 E-value %3D 1.4e-93;gbkey=misc_feature
BX072543.1	EMBL	gene	543467	544033	.	-	.	ID=gene479;Name=TW505;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW505
BX072543.1	EMBL	CDS	543467	544033	.	-	0	ID=cds479;Parent=gene479;Dbxref=GOA:Q83HM6,InterPro:IPR002161,InterPro:IPR021196,InterPro:IPR029062,NCBI_GP:CAD67172.1;Name=CAD67172.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1522 or SCL2.12c SWALL:Q9L287 (EMBL:AL137778) (202 aa) fasta scores: E(): 1.2e-25%2C 47.02%25 id in 185 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67172.1;transl_table=11
BX072543.1	EMBL	sequence_feature	543472	544021	.	-	.	ID=id986;Note=SNO glutamine amidotransferase family Score %3D 207.8 E-value %3D 1.2e-59;gbkey=misc_feature
BX072543.1	EMBL	gene	544033	544896	.	-	.	ID=gene480;Name=TW506;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW506
BX072543.1	EMBL	CDS	544033	544896	.	-	0	ID=cds480;Parent=gene480;Dbxref=GOA:Q83HM5,InterPro:IPR001852,InterPro:IPR011060,InterPro:IPR013785,NCBI_GP:CAD67173.1;Name=CAD67173.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2606c or mt2681 or mtcy1a10.27 SWALL:YQ06_MYCTU (SWALL:O06208) (299 aa) fasta scores: E(): 1.6e-67%2C 68.51%25 id in 289 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67173.1;transl_table=11
BX072543.1	EMBL	sequence_feature	544272	544890	.	-	.	ID=id987;Note=SOR/SNZ family Score %3D 405.8 E-value %3D 3e-119;gbkey=misc_feature
BX072543.1	EMBL	gene	544909	545445	.	-	.	ID=gene481;Name=TW507;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW507
BX072543.1	EMBL	CDS	544909	545445	.	-	0	ID=cds481;Parent=gene481;Dbxref=GOA:Q83HM4,InterPro:IPR001310,InterPro:IPR011146,UniProtKB/TrEMBL:Q83HM4,NCBI_GP:CAD67174.1;Name=CAD67174.1;Note=Similar to Streptomyces coelicolor hypothetical HIT family protein SCL2.20c or SCO1530 SWALL:Q9L279 (EMBL:AL137778) (186 aa) fasta scores: E(): 7.6e-35%2C 50%25 id in 168 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67174.1;transl_table=11
BX072543.1	EMBL	sequence_feature	545001	545340	.	-	.	ID=id988;Note=HIT family Score %3D 42.0 E-value %3D 9.8e-10;gbkey=misc_feature
BX072543.1	EMBL	gene	545454	547376	.	-	.	ID=gene482;Name=thrS;gbkey=Gene;gene=thrS;gene_biotype=protein_coding;locus_tag=TW508
BX072543.1	EMBL	CDS	545454	547376	.	-	0	ID=cds482;Parent=gene482;Dbxref=GOA:Q83HM3,InterPro:IPR002314,InterPro:IPR002320,InterPro:IPR004154,InterPro:IPR006195,InterPro:IPR012947,InterPro:IPR018163,NCBI_GP:CAD67175.1;Name=CAD67175.1;Note=Similar to Thermus thermophilus threonyl-tRNA synthetase ThrS SWALL:SYT_THETH (SWALL:P56881) (659 aa) fasta scores: E(): 1e-99%2C 42.13%25 id in 617 aa;gbkey=CDS;gene=thrS;product=threonyl-tRNA synthetase;protein_id=CAD67175.1;transl_table=11
BX072543.1	EMBL	sequence_feature	545510	545801	.	-	.	ID=id989;Note=Anticodon binding domain Score %3D 63.4 E-value %3D 3.3e-16;gbkey=misc_feature;gene=thrS
BX072543.1	EMBL	sequence_feature	545832	545861	.	-	.	ID=id990;Note=PS00339 Aminoacyl-transfer RNA synthetases class-II signature 2.;gbkey=misc_feature;gene=thrS
BX072543.1	EMBL	sequence_feature	546167	546647	.	-	.	ID=id991;Note=tRNA synthetase class II core domain (G%2C H%2C P%2C S and T) Score %3D 127.3 E-value %3D 2e-35;gbkey=misc_feature;gene=thrS
BX072543.1	EMBL	gene	547499	548923	.	+	.	ID=gene483;Name=glnA;gbkey=Gene;gene=glnA;gene_biotype=protein_coding;locus_tag=TW509
BX072543.1	EMBL	CDS	547499	548923	.	+	0	ID=cds483;Parent=gene483;Dbxref=GOA:Q83HM2,InterPro:IPR004809,InterPro:IPR008146,InterPro:IPR008147,InterPro:IPR014746,InterPro:IPR027303,UniProtKB/TrEMBL:Q83HM2,NCBI_GP:CAD67176.1;Name=CAD67176.1;Note=Similar to Escherichia coli glutamine synthetase GlnA or b3870 or z5406 or ecs4792 SWALL:GLNA_ECOLI (SWALL:P06711) (468 aa) fasta scores: E(): 2.2e-89%2C 48.62%25 id in 471 aa;gbkey=CDS;gene=glnA;product=glutamine synthetase;protein_id=CAD67176.1;transl_table=11
BX072543.1	EMBL	sequence_feature	547544	547790	.	+	.	ID=id992;Note=Glutamine synthetase%2C beta-Grasp domain Score %3D 105.2 E-value %3D 8.9e-29;gbkey=misc_feature;gene=glnA
BX072543.1	EMBL	sequence_feature	547808	548657	.	+	.	ID=id993;Note=Glutamine synthetase%2C catalytic domain Score %3D 486.0 E-value %3D 2e-143;gbkey=misc_feature;gene=glnA
BX072543.1	EMBL	sequence_feature	548279	548326	.	+	.	ID=id994;Note=PS00181 Glutamine synthetase putative ATP-binding region signature.;gbkey=misc_feature;gene=glnA
BX072543.1	EMBL	gene	548929	549738	.	+	.	ID=gene484;Name=panB;gbkey=Gene;gene=panB;gene_biotype=protein_coding;locus_tag=TW510
BX072543.1	EMBL	CDS	548929	549738	.	+	0	ID=cds484;Parent=gene484;Dbxref=GOA:Q83HM1,InterPro:IPR003700,InterPro:IPR015813,NCBI_GP:CAD67177.1;Name=CAD67177.1;Note=Similar to Escherichia coli 3-methyl-2-oxobutanoate hydroxymethyltransferase PanB or b0134 SWALL:PANB_ECOLI (SWALL:P31057) (264 aa) fasta scores: E(): 3.1e-30%2C 38.4%25 id in 263 aa;gbkey=CDS;gene=panB;product=3-methyl-2-oxobutanoate hydroxymethyltransferase;protein_id=CAD67177.1;transl_table=11
BX072543.1	EMBL	sequence_feature	548953	549721	.	+	.	ID=id995;Note=Ketopantoate hydroxymethyltransferase Score %3D 376.3 E-value %3D 2.2e-110;gbkey=misc_feature;gene=panB
BX072543.1	EMBL	gene	549738	550607	.	+	.	ID=gene485;Name=map;gbkey=Gene;gene=map;gene_biotype=protein_coding;locus_tag=TW511
BX072543.1	EMBL	CDS	549738	550607	.	+	0	ID=cds485;Parent=gene485;Dbxref=GOA:Q83HM0,InterPro:IPR000994,InterPro:IPR001714,InterPro:IPR002467,UniProtKB/TrEMBL:Q83HM0,NCBI_GP:CAD67178.1;Name=CAD67178.1;Note=Similar to Escherichia coli methionine aminopeptidase Map or b0168 or z0178 or ecs0170 SWALL:AMPM_ECOLI (SWALL:P07906) (264 aa) fasta scores: E(): 1.6e-41%2C 46.15%25 id in 247 aa%2C and to Streptomyces coelicolor methionine aminopeptidase Map3 or SCO2266 or SCC75A.12 SWALL:Q9RKR2 (EMBL:AL133220) (285 aa) fasta scores: E(): 1.2e-64%2C 57.34%25 id in 279 aa;gbkey=CDS;gene=map;product=methionine aminopeptidase;protein_id=CAD67178.1;transl_table=11
BX072543.1	EMBL	sequence_feature	549864	550587	.	+	.	ID=id996;Note=metallopeptidase family M24 Score %3D 223.2 E-value %3D 2.7e-64;gbkey=misc_feature;gene=map
BX072543.1	EMBL	sequence_feature	550350	550406	.	+	.	ID=id997;Note=PS00680 Methionine aminopeptidase subfamily 1 signature.;gbkey=misc_feature;gene=map
BX072543.1	EMBL	gene	551089	551790	.	-	.	ID=gene486;Name=TW512;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW512
BX072543.1	EMBL	CDS	551089	551790	.	-	0	ID=cds486;Parent=gene486;Dbxref=InterPro:IPR003743,UniProtKB/TrEMBL:Q83HL9,NCBI_GP:CAD67179.1;Name=CAD67179.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2229c or mt2288 or mtcy427.10C SWALL:YM29_MYCTU (SWALL:Q10513) (245 aa) fasta scores: E(): 5.6e-06%2C 24.78%25 id in 234 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67179.1;transl_table=11
BX072543.1	EMBL	sequence_feature	551095	551103	.	-	.	ID=id998;Note=This hit extended beyond the end of the feature by 1 aa and was clipped.%3B~PS00294 Prenyl group binding site (CAAX box).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	551097	551775	.	-	.	ID=id999;Note=Uncharacterized ACR%2C COG1579 Score %3D -16.3 E-value %3D 5.9e-06;gbkey=misc_feature
BX072543.1	EMBL	gene	551783	552622	.	-	.	ID=gene487;Name=TW513;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW513
BX072543.1	EMBL	CDS	551783	552622	.	-	0	ID=cds487;Parent=gene487;Dbxref=GOA:Q83HL8,InterPro:IPR002678,UniProtKB/TrEMBL:Q83HL8,NCBI_GP:CAD67180.1;Name=CAD67180.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2301 or SCC30.09c SWALL:YN01_STRCO (SWALL:Q9L012) (285 aa) fasta scores: E(): 4.7e-28%2C 36.74%25 id in 283 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67180.1;transl_table=11
BX072543.1	EMBL	sequence_feature	551809	552589	.	-	.	ID=id1000;Note=Domain of unknown function DUF34 Score %3D 118.5 E-value %3D 8.9e-33;gbkey=misc_feature
BX072543.1	EMBL	tRNA	552644	552717	.	-	.	ID=rna29;Note=tRNA Val anticodon TAC%2C Cove score 83.83;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	exon	552644	552717	.	-	.	ID=id1001;Parent=rna29;Note=tRNA Val anticodon TAC%2C Cove score 83.83;gbkey=tRNA;product=tRNA-Val
BX072543.1	EMBL	gene	552783	553241	.	-	.	ID=gene488;Name=TW514;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW514
BX072543.1	EMBL	CDS	552783	553241	.	-	0	ID=cds488;Parent=gene488;Dbxref=GOA:Q83HL7,InterPro:IPR000866,InterPro:IPR012336,UniProtKB/TrEMBL:Q83HL7,NCBI_GP:CAD67181.1;Name=CAD67181.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2238c or mt2298 or mtcy427.19C SWALL:YM38_MYCTU (SWALL:Q10520) (153 aa) fasta scores: E(): 4.5e-19%2C 43.33%25 id in 150 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67181.1;transl_table=11
BX072543.1	EMBL	sequence_feature	552800	553220	.	-	.	ID=id1002;Note=AhpC/TSA family Score %3D 123.8 E-value %3D 2.3e-34;gbkey=misc_feature
BX072543.1	EMBL	gene	553337	556156	.	+	.	ID=gene489;Name=aceE;gbkey=Gene;gene=aceE;gene_biotype=protein_coding;locus_tag=TW515
BX072543.1	EMBL	CDS	553337	556156	.	+	0	ID=cds489;Parent=gene489;Dbxref=GOA:Q83HL6,InterPro:IPR004660,InterPro:IPR005474,InterPro:IPR009014,InterPro:IPR029061,UniProtKB/TrEMBL:Q83HL6,NCBI_GP:CAD67182.1;Name=CAD67182.1;Note=Similar to Escherichia coli pyruvate dehydrogenase E1 component AceE or b0114 or z0124 or ecs0118 SWALL:ODP1_ECOLI (SWALL:P06958) (886 aa) fasta scores: E(): 3.9e-128%2C 45.16%25 id in 921 aa%2C and to Streptomyces coelicolor pyruvate dehydrogenase E1 component SCO2371 or SCC8A.29 SWALL:Q9KY19 (EMBL:AL356892) (918 aa) fasta scores: E(): 1.1e-198%2C 53.66%25 id in 928 aa. Has an insertion in the N-terminal region relative to homologues.;gbkey=CDS;gene=aceE;product=pyruvate dehydrogenase E1 component;protein_id=CAD67182.1;transl_table=11
BX072543.1	EMBL	gene	556140	557159	.	+	.	ID=gene490;Name=fabD;gbkey=Gene;gene=fabD;gene_biotype=protein_coding;locus_tag=TW516
BX072543.1	EMBL	CDS	556140	557159	.	+	0	ID=cds490;Parent=gene490;Dbxref=GOA:Q820Y8,InterPro:IPR001227,InterPro:IPR014043,InterPro:IPR016035,InterPro:IPR016036,UniProtKB/TrEMBL:Q820Y8,NCBI_GP:CAD67183.1;Name=CAD67183.1;Note=Similar to Streptomyces coelicolor malonyl CoA:acyl carrier protein malonyltransferase FabD or SCO2387 or SC4A7.15 SWALL:P72391 (EMBL:X86475) (316 aa) fasta scores: E(): 3.4e-29%2C 43.08%25 id in 318 aa;gbkey=CDS;gene=fabD;product=malonyl coa:acyl carrier protein malonyltransferase;protein_id=CAD67183.1;transl_table=11
BX072543.1	EMBL	sequence_feature	556191	557109	.	+	.	ID=id1003;Note=Acyl transferase domain Score %3D -66.0 E-value %3D 3.8e-07;gbkey=misc_feature;gene=fabD
BX072543.1	EMBL	sequence_feature	557145	557153	.	+	.	ID=id1004;Note=This hit extended beyond the end of the feature by 1 aa and was clipped.%3B~PS00294 Prenyl group binding site (CAAX box).;gbkey=misc_feature;gene=fabD
BX072543.1	EMBL	gene	557173	558141	.	+	.	ID=gene491;Name=fabH;gbkey=Gene;gene=fabH;gene_biotype=protein_coding;locus_tag=TW517
BX072543.1	EMBL	CDS	557173	558141	.	+	0	ID=cds491;Parent=gene491;Dbxref=GOA:P64117,InterPro:IPR013747,InterPro:IPR013751,InterPro:IPR016038,InterPro:IPR016039,NCBI_GP:CAD67184.1;Name=CAD67184.1;Note=Similar to Mycobacterium tuberculosis 3-oxoacyl-[acyl-carrier-protein] synthase III FabH or Rv0533c or mt0557 or mtcy25d10.12C SWALL:FABH_MYCTU (SWALL:O06399) (335 aa) fasta scores: E(): 3e-43%2C 43.51%25 id in 324 aa%2C and to Streptomyces glaucescens FabH protein fabH SWALL:Q54206 (EMBL:L43074) (333 aa) fasta scores: E(): 1.5e-47%2C 45.34%25 id in 322 aa;gbkey=CDS;gene=fabH;product=3-oxoacyl-[acyl-carrier-protein] synthase III;protein_id=CAD67184.1;transl_table=11
BX072543.1	EMBL	gene	558218	558466	.	+	.	ID=gene492;Name=acp;gbkey=Gene;gene=acp;gene_biotype=protein_coding;locus_tag=TW518
BX072543.1	EMBL	CDS	558218	558466	.	+	0	ID=cds492;Parent=gene492;Dbxref=GOA:Q83NH7,InterPro:IPR003231,InterPro:IPR009081,NCBI_GP:CAD67185.1;Name=CAD67185.1;Note=Similar to Streptomyces coelicolor acyl carrier protein AcpP or SCO2389 or SC4A7.17 SWALL:P72393 (EMBL:X86475) (82 aa) fasta scores: E(): 2.3e-11%2C 46.34%25 id in 82 aa;gbkey=CDS;gene=acp;product=acyl carrier protein;protein_id=CAD67185.1;transl_table=11
BX072543.1	EMBL	sequence_feature	558245	558446	.	+	.	ID=id1005;Note=Phosphopantetheine attachment site Score %3D 67.3 E-value %3D 2.4e-17;gbkey=misc_feature;gene=acp
BX072543.1	EMBL	gene	558467	559702	.	+	.	ID=gene493;Name=fabF;gbkey=Gene;gene=fabF;gene_biotype=protein_coding;locus_tag=TW519
BX072543.1	EMBL	CDS	558467	559702	.	+	0	ID=cds493;Parent=gene493;Dbxref=GOA:Q83HL4,InterPro:IPR014030,InterPro:IPR014031,InterPro:IPR016038,InterPro:IPR016039,UniProtKB/TrEMBL:Q83HL4,NCBI_GP:CAD67186.1;Name=CAD67186.1;Note=Similar to Synechocystis sp. 3-oxoacyl-[acyl-carrier-protein] synthase II FabF or sll1069 SWALL:FABF_SYNY3 (SWALL:P73283) (416 aa) fasta scores: E(): 9.8e-58%2C 42.05%25 id in 409 aa;gbkey=CDS;gene=fabF;product=3-oxoacyl-[acyl-carrier-protein] synthase II;protein_id=CAD67186.1;transl_table=11
BX072543.1	EMBL	sequence_feature	558470	559199	.	+	.	ID=id1006;Note=Beta-ketoacyl synthase%2C N-terminal domain Score %3D 174.8 E-value %3D 1e-49;gbkey=misc_feature;gene=fabF
BX072543.1	EMBL	sequence_feature	559223	559691	.	+	.	ID=id1007;Note=Beta-ketoacyl synthase%2C C-terminal domain Score %3D 185.0 E-value %3D 8.8e-53;gbkey=misc_feature;gene=fabF
BX072543.1	EMBL	gene	559792	560274	.	-	.	ID=gene494;Name=TW520;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW520
BX072543.1	EMBL	CDS	559792	560274	.	-	0	ID=cds494;Parent=gene494;Dbxref=InterPro:IPR021491,UniProtKB/TrEMBL:Q83HL3,NCBI_GP:CAD67187.1;Name=CAD67187.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2391 or SC4A7.19c SWALL:Q9RDP6 (EMBL:AL133423) (164 aa) fasta scores: E(): 4e-22%2C 41.33%25 id in 150 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67187.1;transl_table=11
BX072543.1	EMBL	gene	560351	561961	.	-	.	ID=gene495;Name=qcrB;gbkey=Gene;gene=qcrB;gene_biotype=protein_coding;locus_tag=TW521
BX072543.1	EMBL	CDS	560351	561961	.	-	0	ID=cds495;Parent=gene495;Dbxref=GOA:Q83NH6,InterPro:IPR005797,InterPro:IPR005798,InterPro:IPR016174,InterPro:IPR027387,UniProtKB/TrEMBL:Q83NH6,NCBI_GP:CAD67188.1;Name=CAD67188.1;Note=Similar to Streptomyces coelicolor ubiquinol-cytochrome C reductase cytochrome B subunit QcrB or SCO2148 or SC6G10.21c SWALL:QCRB_STRCO (SWALL:Q9X806) (545 aa) fasta scores: E(): 1.2e-113%2C 54.15%25 id in 517 aa%2C and to Corynebacterium glutamicum cytochrome B subunit CytB or QcrB SWALL:Q9F481 (EMBL:AB047851) (539 aa) fasta scores: E(): 2.1e-92%2C 50.33%25 id in 455 aa;gbkey=CDS;gene=qcrB;product=ubiquinol-cytochrome C reductase cytochrome B subunit;protein_id=CAD67188.1;transl_table=11
BX072543.1	EMBL	sequence_feature	561752	561820	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=1/9;partial=true
BX072543.1	EMBL	sequence_feature	561542	561610	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=2/9;partial=true
BX072543.1	EMBL	sequence_feature	561449	561517	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=3/9;partial=true
BX072543.1	EMBL	sequence_feature	561353	561421	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=4/9;partial=true
BX072543.1	EMBL	sequence_feature	561248	561316	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=5/9;partial=true
BX072543.1	EMBL	sequence_feature	561080	561148	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=6/9;partial=true
BX072543.1	EMBL	sequence_feature	560879	560947	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=7/9;partial=true
BX072543.1	EMBL	sequence_feature	560753	560821	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=8/9;partial=true
BX072543.1	EMBL	sequence_feature	560651	560719	.	-	.	ID=id1008;Note=9 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 48-70%2C 118-140%2C 149-171%2C 181-203%2C 216-238%2C 272-294%2C 339-361%2C 381-403 and 415-437;gbkey=misc_feature;gene=qcrB;is_ordered=true;part=9/9;partial=true
BX072543.1	EMBL	sequence_feature	561229	561856	.	-	.	ID=id1009;Note=Cytochrome b(N-terminal)/b6/petB Score %3D 57.5 E-value %3D 2.1e-14;gbkey=misc_feature;gene=qcrB
BX072543.1	EMBL	gene	561961	562944	.	-	.	ID=gene496;Name=qcrA;gbkey=Gene;gene=qcrA;gene_biotype=protein_coding;locus_tag=TW522
BX072543.1	EMBL	CDS	561961	562944	.	-	0	ID=cds496;Parent=gene496;Dbxref=GOA:Q83NH5,InterPro:IPR005805,InterPro:IPR017941,UniProtKB/TrEMBL:Q83NH5,NCBI_GP:CAD67189.1;Name=CAD67189.1;Note=Similar to Streptomyces coelicolor ubiquinol-cytochrome C reductase iron-sulfur subunit QcrA or SCO2149 or SC6G10.22c SWALL:QCRA_STRCO (SWALL:Q9X807) (353 aa) fasta scores: E(): 2.2e-55%2C 45.84%25 id in 325 aa%2C and to Corynebacterium glutamicum rieske iron-sulfur protein QcrA or cgl2190 SWALL:BAB99583 (EMBL:AJ306418) (408 aa) fasta scores: E(): 1.6e-21%2C 31.75%25 id in 381 aa;gbkey=CDS;gene=qcrA;product=ubiquinol-cytochrome C reductase iron-sulfur subunit;protein_id=CAD67189.1;transl_table=11
BX072543.1	EMBL	sequence_feature	562032	562317	.	-	.	ID=id1010;Note=Rieske [2Fe-2S] domain Score %3D 37.9 E-value %3D 1.6e-08;gbkey=misc_feature;gene=qcrA
BX072543.1	EMBL	sequence_feature	562117	562134	.	-	.	ID=id1011;Note=PS00200 Rieske iron-sulfur protein signature 2.;gbkey=misc_feature;gene=qcrA
BX072543.1	EMBL	sequence_feature	562783	562851	.	-	.	ID=id1012;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 32-54%2C 69-91 and 138-160;gbkey=misc_feature;gene=qcrA;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	562672	562740	.	-	.	ID=id1012;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 32-54%2C 69-91 and 138-160;gbkey=misc_feature;gene=qcrA;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	562465	562533	.	-	.	ID=id1012;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 32-54%2C 69-91 and 138-160;gbkey=misc_feature;gene=qcrA;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	562998	563822	.	-	.	ID=gene497;Name=qcrC;gbkey=Gene;gene=qcrC;gene_biotype=protein_coding;locus_tag=TW523
BX072543.1	EMBL	CDS	562998	563822	.	-	0	ID=cds497;Parent=gene497;Dbxref=GOA:Q83NH4,InterPro:IPR003088,InterPro:IPR009056,InterPro:IPR009152,UniProtKB/TrEMBL:Q83NH4,NCBI_GP:CAD67190.1;Name=CAD67190.1;Note=Similar to Streptomyces coelicolor cytochrome C heme-binding subunit QcrC or SCO2150 or SC6G10.23c SWALL:Q9X808 (EMBL:AL049497) (269 aa) fasta scores: E(): 6.1e-43%2C 49.03%25 id in 259 aa%2C and to Corynebacterium glutamicum cytochrome cc1 subunit qcrC SWALL:Q9F483 (EMBL:AB047851) (283 aa) fasta scores: E(): 2e-20%2C 43.79%25 id in 274 aa;gbkey=CDS;gene=qcrC;product=cytochrome C heme-binding subunit;protein_id=CAD67190.1;transl_table=11
BX072543.1	EMBL	sequence_feature	563685	563753	.	-	.	ID=id1013;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-46 and 248-270;gbkey=misc_feature;gene=qcrC;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	563013	563081	.	-	.	ID=id1013;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 24-46 and 248-270;gbkey=misc_feature;gene=qcrC;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	563129	563363	.	-	.	ID=id1014;Note=Cytochrome c Score %3D 23.3 E-value %3D 0.00013;gbkey=misc_feature;gene=qcrC
BX072543.1	EMBL	sequence_feature	563307	563324	.	-	.	ID=id1015;Note=PS00190 Cytochrome c family heme-binding site signature.;gbkey=misc_feature;gene=qcrC
BX072543.1	EMBL	sequence_feature	563408	563645	.	-	.	ID=id1016;Note=Cytochrome c Score %3D 9.1 E-value %3D 0.0035;gbkey=misc_feature;gene=qcrC
BX072543.1	EMBL	sequence_feature	563589	563606	.	-	.	ID=id1017;Note=PS00190 Cytochrome c family heme-binding site signature.;gbkey=misc_feature;gene=qcrC
BX072543.1	EMBL	gene	563822	564445	.	-	.	ID=gene498;Name=ctaE;gbkey=Gene;gene=ctaE;gene_biotype=protein_coding;locus_tag=TW524
BX072543.1	EMBL	CDS	563822	564445	.	-	0	ID=cds498;Parent=gene498;Dbxref=GOA:Q83HL2,InterPro:IPR000298,InterPro:IPR013833,InterPro:IPR024791,UniProtKB/TrEMBL:Q83HL2,NCBI_GP:CAD67191.1;Name=CAD67191.1;Note=Similar to Corynebacterium glutamicum cytochrome c oxidase subunit III CtaE or cgl2192 SWALL:Q9AEL8 (EMBL:AJ306418) (205 aa) fasta scores: E(): 7.2e-24%2C 47.93%25 id in 194 aa;gbkey=CDS;gene=ctaE;product=cytochrome c oxidase subunit III;protein_id=CAD67191.1;transl_table=11
BX072543.1	EMBL	sequence_feature	563827	564418	.	-	.	ID=id1018;Note=Cytochrome c oxidase subunit III Score %3D -92.5 E-value %3D 9e-12;gbkey=misc_feature;gene=ctaE
BX072543.1	EMBL	sequence_feature	564323	564391	.	-	.	ID=id1019;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 61-83%2C 104-126%2C 141-163 and 184-206;gbkey=misc_feature;gene=ctaE;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	564197	564265	.	-	.	ID=id1019;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 61-83%2C 104-126%2C 141-163 and 184-206;gbkey=misc_feature;gene=ctaE;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	564068	564136	.	-	.	ID=id1019;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 61-83%2C 104-126%2C 141-163 and 184-206;gbkey=misc_feature;gene=ctaE;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	563957	564025	.	-	.	ID=id1019;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 61-83%2C 104-126%2C 141-163 and 184-206;gbkey=misc_feature;gene=ctaE;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	563828	563896	.	-	.	ID=id1019;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 19-41%2C 61-83%2C 104-126%2C 141-163 and 184-206;gbkey=misc_feature;gene=ctaE;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	564534	564953	.	-	.	ID=gene499;Name=TW525;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW525
BX072543.1	EMBL	CDS	564534	564953	.	-	0	ID=cds499;Parent=gene499;Dbxref=GOA:Q83NH3,InterPro:IPR021050,UniProtKB/TrEMBL:Q83NH3,NCBI_GP:CAD67192.1;Name=CAD67192.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO2154 or SC6G10.27c SWALL:Q9X812 (EMBL:AL049497) (132 aa) fasta scores: E(): 2.7e-10%2C 33.07%25 id in 130 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67192.1;transl_table=11
BX072543.1	EMBL	sequence_feature	564867	564935	.	-	.	ID=id1020;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 81-103 and 108-130;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	564789	564857	.	-	.	ID=id1020;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 81-103 and 108-130;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	564645	564713	.	-	.	ID=id1020;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 81-103 and 108-130;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	564564	564632	.	-	.	ID=id1020;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 33-55%2C 81-103 and 108-130;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	564974	566605	.	-	.	ID=gene500;Name=ctaD;gbkey=Gene;gene=ctaD;gene_biotype=protein_coding;locus_tag=TW526
BX072543.1	EMBL	CDS	564974	566605	.	-	0	ID=cds500;Parent=gene500;Dbxref=GOA:Q83NH2,InterPro:IPR000883,InterPro:IPR014241,InterPro:IPR023615,InterPro:IPR023616,UniProtKB/TrEMBL:Q83NH2,NCBI_GP:CAD67193.1;Name=CAD67193.1;Note=Similar to Corynebacterium glutamicum cytochrome c oxidase subunit I CtaD SWALL:Q93HZ5 (EMBL:AB052748) (584 aa) fasta scores: E(): 2.6e-138%2C 63.18%25 id in 527 aa;gbkey=CDS;gene=ctaD;product=cytochrome c oxidase subunit I;protein_id=CAD67193.1;transl_table=11
BX072543.1	EMBL	sequence_feature	566447	566515	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	566312	566380	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	566186	566254	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	566060	566128	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	565931	565999	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	565796	565864	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	565694	565762	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	565613	565681	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	565487	565555	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	565376	565444	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	565274	565342	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	565148	565216	.	-	.	ID=id1021;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 31-53%2C 76-98%2C 118-140%2C 160-182%2C 203-225%2C 248-270%2C 282-304%2C 309-331%2C 351-373%2C 388-410%2C 422-444 and 464-486;gbkey=misc_feature;gene=ctaD;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	sequence_feature	565180	566545	.	-	.	ID=id1022;Note=Cytochrome C and Quinol oxidase polypeptide I Score %3D 764.9 E-value %3D 2.3e-227;gbkey=misc_feature;gene=ctaD
BX072543.1	EMBL	sequence_feature	565457	565486	.	-	.	ID=id1023;Note=PS00152 ATP synthase alpha and beta subunits signature.;gbkey=misc_feature;gene=ctaD
BX072543.1	EMBL	sequence_feature	565688	565852	.	-	.	ID=id1024;Note=PS00077 Heme-copper oxidase catalytic subunit%2C copper B binding region signature.;gbkey=misc_feature;gene=ctaD
BX072543.1	EMBL	gene	566617	567489	.	-	.	ID=gene501;Name=ctaC;gbkey=Gene;gene=ctaC;gene_biotype=protein_coding;locus_tag=TW527
BX072543.1	EMBL	CDS	566617	567489	.	-	0	ID=cds501;Parent=gene501;Dbxref=GOA:Q83HL1,InterPro:IPR001505,InterPro:IPR002429,InterPro:IPR008972,InterPro:IPR011759,InterPro:IPR014222,UniProtKB/TrEMBL:Q83HL1,NCBI_GP:CAD67194.1;Name=CAD67194.1;Note=Similar to Paracoccus denitrificans cytochrome c oxidase polypeptide II precursor CtaC or CtaB or CoiI SWALL:COX2_PARDE (SWALL:P08306) (298 aa) fasta scores: E(): 1.3e-17%2C 26.49%25 id in 268 aa;gbkey=CDS;gene=ctaC;product=putative cytochrome c oxidase subunit II;protein_id=CAD67194.1;transl_table=11
BX072543.1	EMBL	sequence_feature	566685	567072	.	-	.	ID=id1025;Note=Cytochrome C oxidase subunit II%2C periplasmic domain Score %3D 55.4 E-value %3D 8.5e-14;gbkey=misc_feature;gene=ctaC
BX072543.1	EMBL	sequence_feature	566740	566886	.	-	.	ID=id1026;Note=PS00078 CO II and nitrous oxide reductase dinuclear copper centers signature.;gbkey=misc_feature;gene=ctaC
BX072543.1	EMBL	sequence_feature	567108	567396	.	-	.	ID=id1027;Note=Cytochrome C oxidase subunit II%2C transmembrane domain Score %3D -25.5 E-value %3D 0.057;gbkey=misc_feature;gene=ctaC
BX072543.1	EMBL	sequence_feature	567385	567453	.	-	.	ID=id1028;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 65-87 and 104-126;gbkey=misc_feature;gene=ctaC;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	567229	567297	.	-	.	ID=id1028;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 65-87 and 104-126;gbkey=misc_feature;gene=ctaC;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	567112	567180	.	-	.	ID=id1028;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 65-87 and 104-126;gbkey=misc_feature;gene=ctaC;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	567349	567489	.	-	.	ID=id1029;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.847 between residues 47 and 48;gbkey=misc_feature;gene=ctaC
BX072543.1	EMBL	gene	567559	567903	.	-	.	ID=gene502;Name=TW528;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW528
BX072543.1	EMBL	CDS	567559	567903	.	-	0	ID=cds502;Parent=gene502;Dbxref=GOA:Q83HL0,InterPro:IPR000361,InterPro:IPR016092,InterPro:IPR017870,UniProtKB/TrEMBL:Q83HL0,NCBI_GP:CAD67195.1;Name=CAD67195.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2161 or SC6G10.34c SWALL:Q9X819 (EMBL:AL049497) (118 aa) fasta scores: E(): 6.3e-29%2C 70.27%25 id in 111 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67195.1;transl_table=11
BX072543.1	EMBL	sequence_feature	567564	567879	.	-	.	ID=id1030;Note=HesB-like domain Score %3D 169.9 E-value %3D 3.1e-48;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	567565	567618	.	-	.	ID=id1031;Note=PS01152 Hypothetical hesB/yadR/yfhF family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	567920	569260	.	-	.	ID=gene503;Name=TW529;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW529
BX072543.1	EMBL	CDS	567920	569260	.	-	0	ID=cds503;Parent=gene503;Dbxref=GOA:Q83NH1,InterPro:IPR002933,InterPro:IPR011650,UniProtKB/TrEMBL:Q83NH1,NCBI_GP:CAD67196.1;Name=CAD67196.1;Note=Similar to Streptomyces coelicolor putative peptidase SCO1074 or SCG22.20 SWALL:Q9K425 (EMBL:AL359779) (451 aa) fasta scores: E(): 4.9e-47%2C 37.09%25 id in 434 aa;gbkey=CDS;product=putative peptidase;protein_id=CAD67196.1;transl_table=11
BX072543.1	EMBL	sequence_feature	567934	569212	.	-	.	ID=id1032;Note=Peptidase family M20/M25/M40 Score %3D 138.9 E-value %3D 6.6e-39;gbkey=misc_feature
BX072543.1	EMBL	gene	569392	569913	.	+	.	ID=gene504;Name=TW530;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW530
BX072543.1	EMBL	CDS	569392	569913	.	+	0	ID=cds504;Parent=gene504;Dbxref=InterPro:IPR021403,UniProtKB/TrEMBL:Q83NH0,NCBI_GP:CAD67197.1;Name=CAD67197.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO2169 or SC5F7.32 SWALL:Q9S2R7 (EMBL:AL096872) (251 aa) fasta scores: E(): 5e-15%2C 36.14%25 id in 166 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67197.1;transl_table=11
BX072543.1	EMBL	sequence_feature	569617	569685	.	+	.	ID=id1033;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98 and 102-124;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	569695	569763	.	+	.	ID=id1033;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98 and 102-124;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	569929	570414	.	+	.	ID=gene505;Name=rnhA;gbkey=Gene;gene=rnhA;gene_biotype=protein_coding;locus_tag=TW531
BX072543.1	EMBL	CDS	569929	570414	.	+	0	ID=cds505;Parent=gene505;Dbxref=GOA:Q83HK9,InterPro:IPR002156,InterPro:IPR012337,InterPro:IPR022892,NCBI_GP:CAD67198.1;Name=CAD67198.1;Note=Similar to Escherichia coli ribonuclease HI RnhA or Rnh or DasF or HerA or SdrA or b0214 or z0239 or ecs0210 SWALL:RNH_ECOLI (SWALL:P00647) (155 aa) fasta scores: E(): 2.9e-15%2C 40.58%25 id in 138 aa;gbkey=CDS;gene=rnhA;product=ribonuclease HI;protein_id=CAD67198.1;transl_table=11
BX072543.1	EMBL	sequence_feature	569935	570349	.	+	.	ID=id1034;Note=RNase H Score %3D 128.8 E-value %3D 7.2e-36;gbkey=misc_feature;gene=rnhA
BX072543.1	EMBL	gene	570529	571521	.	-	.	ID=gene506;Name=pyrD;gbkey=Gene;gene=pyrD;gene_biotype=protein_coding;locus_tag=TW532
BX072543.1	EMBL	CDS	570529	571521	.	-	0	ID=cds506;Parent=gene506;Dbxref=GOA:Q83HK8,InterPro:IPR001295,InterPro:IPR005719,InterPro:IPR012135,InterPro:IPR013785,UniProtKB/TrEMBL:Q83HK8,NCBI_GP:CAD67199.1;Name=CAD67199.1;Note=Similar to Escherichia coli dihydroorotate dehydrogenase PyrD or b0945 or z1294 or ecs1029 SWALL:PYRD_ECOLI (SWALL:P05021) (336 aa) fasta scores: E(): 3.7e-35%2C 37.88%25 id in 322 aa%2C and to Streptomyces coelicolor dihydroorotate dehydrogenase PyrD or SCO1482 or SC9C5.06c SWALL:Q9KXR7 (EMBL:AL357523) (368 aa) fasta scores: E(): 1.7e-45%2C 45.58%25 id in 340 aa;gbkey=CDS;gene=pyrD;product=dihydroorotate dehydrogenase;protein_id=CAD67199.1;transl_table=11
BX072543.1	EMBL	sequence_feature	570537	571419	.	-	.	ID=id1035;Note=Dihydroorotate dehydrogenase Score %3D 339.3 E-value %3D 3.1e-99;gbkey=misc_feature;gene=pyrD
BX072543.1	EMBL	sequence_feature	570619	570681	.	-	.	ID=id1036;Note=PS00912 Dihydroorotate dehydrogenase signature 2.;gbkey=misc_feature;gene=pyrD
BX072543.1	EMBL	sequence_feature	571252	571311	.	-	.	ID=id1037;Note=PS00911 Dihydroorotate dehydrogenase signature 1.;gbkey=misc_feature;gene=pyrD
BX072543.1	EMBL	gene	571543	571986	.	-	.	ID=gene507;Name=TW533;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW533
BX072543.1	EMBL	CDS	571543	571986	.	-	0	ID=cds507;Parent=gene507;Dbxref=GOA:P67324,InterPro:IPR003796,InterPro:IPR005144,NCBI_GP:CAD67200.1;Name=CAD67200.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv2718c or mt2791 or mtcy05a6.39C SWALL:YR18_MYCTU (SWALL:O07217) (154 aa) fasta scores: E(): 7.5e-31%2C 56.55%25 id in 145 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67200.1;transl_table=11
BX072543.1	EMBL	sequence_feature	571581	571851	.	-	.	ID=id1038;Note=ATP cone domain Score %3D 92.1 E-value %3D 8.1e-25;gbkey=misc_feature
BX072543.1	EMBL	gene	571987	572463	.	-	.	ID=gene508;Name=TW534;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW534
BX072543.1	EMBL	CDS	571987	572463	.	-	0	ID=cds508;Parent=gene508;Dbxref=GOA:Q83HK6,InterPro:IPR000551,InterPro:IPR009061,UniProtKB/TrEMBL:Q83HK6,NCBI_GP:CAD67201.1;Name=CAD67201.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv1830 or mt1879 or mtcy1a11.13C SWALL:YI30_MYCTU (SWALL:Q50603) (225 aa) fasta scores: E(): 3.4e-28%2C 60.28%25 id in 141 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67201.1;transl_table=11
BX072543.1	EMBL	gene	572506	573183	.	-	.	ID=gene509;Name=TW535;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW535
BX072543.1	EMBL	CDS	572506	573183	.	-	0	ID=cds509;Parent=gene509;Dbxref=GOA:Q83HK5,InterPro:IPR000551,InterPro:IPR009061,UniProtKB/TrEMBL:Q83HK5,NCBI_GP:CAD67202.1;Name=CAD67202.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO1383 or SC1A8a.03c SWALL:Q9KZP9 (EMBL:AL353861) (246 aa) fasta scores: E(): 2.9e-11%2C 35.02%25 id in 197 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67202.1;transl_table=11
BX072543.1	EMBL	gene	573189	573620	.	-	.	ID=gene510;Name=TW536;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW536
BX072543.1	EMBL	CDS	573189	573620	.	-	0	ID=cds510;Parent=gene510;Dbxref=InterPro:IPR000253,InterPro:IPR008984,UniProtKB/TrEMBL:Q83HK4,NCBI_GP:CAD67203.1;Name=CAD67203.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv1827 or mt1875 or mtcy1a11.16C SWALL:YI27_MYCTU (SWALL:Q50606) (162 aa) fasta scores: E(): 1.2e-22%2C 64.35%25 id in 101 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67203.1;transl_table=11
BX072543.1	EMBL	sequence_feature	573236	573425	.	-	.	ID=id1039;Note=FHA domain Score %3D 59.3 E-value %3D 5.9e-15;gbkey=misc_feature
BX072543.1	EMBL	gene	573636	574154	.	-	.	ID=gene511;Name=TW537;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW537
BX072543.1	EMBL	CDS	573636	574154	.	-	0	ID=cds511;Parent=gene511;Dbxref=UniProtKB/TrEMBL:Q83NG9,NCBI_GP:CAD67204.1;Name=CAD67204.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67204.1;transl_table=11
BX072543.1	EMBL	sequence_feature	573930	573998	.	-	.	ID=id1040;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 53-75%2C 80-102 and 115-137;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	573849	573917	.	-	.	ID=id1040;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 53-75%2C 80-102 and 115-137;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	573744	573812	.	-	.	ID=id1040;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 53-75%2C 80-102 and 115-137;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	574357	574854	.	+	.	ID=gene512;Name=TW539;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW539
BX072543.1	EMBL	CDS	574357	574854	.	+	0	ID=cds512;Parent=gene512;Dbxref=UniProtKB/TrEMBL:Q83HK3,NCBI_GP:CAD67205.1;Name=CAD67205.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67205.1;transl_table=11
BX072543.1	EMBL	gene	574920	575669	.	-	.	ID=gene513;Name=ftsQ;gbkey=Gene;gene=ftsQ;gene_biotype=protein_coding;locus_tag=TW540
BX072543.1	EMBL	CDS	574920	575669	.	-	0	ID=cds513;Parent=gene513;Dbxref=GOA:Q83NG8,InterPro:IPR013685,UniProtKB/TrEMBL:Q83NG8,NCBI_GP:CAD67206.1;Name=CAD67206.1;Note=Similar to Streptomyces coelicolor cell division protein FtsQ or SCO2083 or SC4A10.16c SWALL:FTSQ_STRCO (SWALL:P45518) (264 aa) fasta scores: E(): 0.011%2C 26.33%25 id in 243 aa%2C and to Corynebacterium glutamicum cell division protein ftsq homolog ftsq or divb or cgl2156 SWALL:FTSQ_CORGL (SWALL:P94336) (222 aa) fasta scores: E(): 9.8e-11%2C 26.26%25 id in 217 aa;gbkey=CDS;gene=ftsQ;product=cell division protein;protein_id=CAD67206.1;transl_table=11
BX072543.1	EMBL	sequence_feature	574949	575591	.	-	.	ID=id1041;Note=Cell division protein FtsQ Score %3D 43.8 E-value %3D 2.7e-10;gbkey=misc_feature;gene=ftsQ
BX072543.1	EMBL	sequence_feature	575493	575669	.	-	.	ID=id1042;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.966) with cleavage site probability 0.264 between residues 59 and 60;gbkey=misc_feature;gene=ftsQ
BX072543.1	EMBL	sequence_feature	575499	575567	.	-	.	ID=id1043;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 35-57;gbkey=misc_feature;gene=ftsQ
BX072543.1	EMBL	gene	575696	577123	.	-	.	ID=gene514;Name=murC;gbkey=Gene;gene=murC;gene_biotype=protein_coding;locus_tag=TW541
BX072543.1	EMBL	CDS	575696	577123	.	-	0	ID=cds514;Parent=gene514;Dbxref=GOA:Q83HK2,InterPro:IPR000713,InterPro:IPR004101,InterPro:IPR005758,InterPro:IPR013221,InterPro:IPR016040,UniProtKB/TrEMBL:Q83HK2,NCBI_GP:CAD67207.1;Name=CAD67207.1;Note=Similar to Streptomyces coelicolor UDP-N-acetylmuramate--alanine ligase MurC or SCO6060 or SC9B1.07 SWALL:MURC_STRCO (SWALL:Q9X827) (462 aa) fasta scores: E(): 1.1e-48%2C 35.83%25 id in 466 aa%2C and to Escherichia coli UDP-N-acetylmuramate--alanine ligase MurC or b0091 SWALL:MURC_ECOLI (SWALL:P17952) (491 aa) fasta scores: E(): 4.7e-41%2C 31.78%25 id in 475 aa;gbkey=CDS;gene=murC;product=UDP-N-acetylmuramate--alanine ligase;protein_id=CAD67207.1;transl_table=11
BX072543.1	EMBL	sequence_feature	575878	576154	.	-	.	ID=id1044;Note=Mur ligase family%2C glutamate ligase domain Score %3D 78.9 E-value %3D 7.6e-21;gbkey=misc_feature;gene=murC
BX072543.1	EMBL	sequence_feature	576178	576973	.	-	.	ID=id1045;Note=Mur ligase family%2C catalytic domain Score %3D 85.9 E-value %3D 5.7e-23;gbkey=misc_feature;gene=murC
BX072543.1	EMBL	gene	577126	578196	.	-	.	ID=gene515;Name=murG;gbkey=Gene;gene=murG;gene_biotype=protein_coding;locus_tag=TW542
BX072543.1	EMBL	CDS	577126	578196	.	-	0	ID=cds515;Parent=gene515;Dbxref=GOA:Q83HK1,InterPro:IPR004276,InterPro:IPR006009,InterPro:IPR007235,NCBI_GP:CAD67208.1;Name=CAD67208.1;Note=Similar to Streptomyces coelicolor UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol n-acetylglucosamine transferase MurG or SCO2084 or SC4A10.17C SWALL:MURG_STRCO (SWALL:Q9ZBA5) (364 aa) fasta scores: E(): 4e-42%2C 38.42%25 id in 367 aa%2C and to Escherichia coli UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol n-acetylglucosamine transferase MurG or b0090 SWALL:MURG_ECOLI (SWALL:P17443) (354 aa) fasta scores: E(): 3.3e-26%2C 34.46%25 id in 354 aa;gbkey=CDS;gene=murG;product=UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol n-acetylglucosamine transferase;protein_id=CAD67208.1;transl_table=11
BX072543.1	EMBL	sequence_feature	577161	577644	.	-	.	ID=id1046;Note=Glycosyltransferase family 28 C-terminal domain Score %3D 92.1 E-value %3D 8.1e-25;gbkey=misc_feature;gene=murG
BX072543.1	EMBL	sequence_feature	577713	578190	.	-	.	ID=id1047;Note=Glycosyltransferase family 28 N-terminal domain Score %3D 188.5 E-value %3D 7.4e-54;gbkey=misc_feature;gene=murG
BX072543.1	EMBL	gene	578196	579308	.	-	.	ID=gene516;Name=ftsW;gbkey=Gene;gene=ftsW;gene_biotype=protein_coding;locus_tag=TW543
BX072543.1	EMBL	CDS	578196	579308	.	-	0	ID=cds516;Parent=gene516;Dbxref=GOA:Q83NG7,InterPro:IPR001182,InterPro:IPR013437,UniProtKB/TrEMBL:Q83NG7,NCBI_GP:CAD67209.1;Name=CAD67209.1;Note=Similar to Streptomyces coelicolor cell division protein FtsW or SCO2085 or SC4A10.18c SWALL:Q9ZBA6 (EMBL:U10879) (456 aa) fasta scores: E(): 2.7e-36%2C 35.22%25 id in 369 aa%2C and to Escherichia coli cell division protein FtsW or b0089 or z0099 or ecs0093 SWALL:FTSW_ECOLI (SWALL:P16457) (414 aa) fasta scores: E(): 5e-27%2C 30.79%25 id in 354 aa;gbkey=CDS;gene=ftsW;product=cell division protein FtsW;protein_id=CAD67209.1;transl_table=11
BX072543.1	EMBL	sequence_feature	578204	579272	.	-	.	ID=id1048;Note=Cell cycle protein Score %3D 238.8 E-value %3D 5.6e-69;gbkey=misc_feature;gene=ftsW
BX072543.1	EMBL	sequence_feature	579207	579275	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	579111	579179	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	579024	579092	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	578832	578885	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	578745	578813	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	578415	578483	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	578313	578381	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	578217	578285	.	-	.	ID=id1049;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 44-66%2C 73-95%2C 142-159%2C 166-188%2C 276-298%2C 310-332 and 342-364;gbkey=misc_feature;gene=ftsW;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	579210	579308	.	-	.	ID=id1050;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.986) with cleavage site probability 0.447 between residues 33 and 34;gbkey=misc_feature;gene=ftsW
BX072543.1	EMBL	gene	579308	580750	.	-	.	ID=gene517;Name=murD;gbkey=Gene;gene=murD;gene_biotype=protein_coding;locus_tag=TW544
BX072543.1	EMBL	CDS	579308	580750	.	-	0	ID=cds517;Parent=gene517;Dbxref=GOA:Q83HK0,InterPro:IPR004101,InterPro:IPR005762,InterPro:IPR013221,InterPro:IPR016040,InterPro:IPR018109,NCBI_GP:CAD67210.1;Name=CAD67210.1;Note=Similar to Streptomyces coelicolor UDP-N-acetylmuramoylalanine--D-glutamate ligase MurD SWALL:Q9ZBA7 (EMBL:U10879) (221 aa) fasta scores: E(): 1e-18%2C 35%25 id in 220 aa%2C and to Escherichia coli UDP-N-acetylmuramoylalanine--D-glutamate ligase MurD or b0088 SWALL:MURD_ECOLI (SWALL:P14900) (437 aa) fasta scores: E(): 8.2e-11%2C 30.21%25 id in 470 aa;gbkey=CDS;gene=murD;product=UDP-N-acetylmuramoylalanine--D-glutamate ligase;protein_id=CAD67210.1;transl_table=11
BX072543.1	EMBL	sequence_feature	579502	579739	.	-	.	ID=id1051;Note=Mur ligase family%2C glutamate ligase domain Score %3D 35.3 E-value %3D 9.7e-08;gbkey=misc_feature;gene=murD
BX072543.1	EMBL	sequence_feature	579763	580594	.	-	.	ID=id1052;Note=Mur ligase family%2C catalytic domain Score %3D 80.2 E-value %3D 3e-21;gbkey=misc_feature;gene=murD
BX072543.1	EMBL	gene	580752	582281	.	-	.	ID=gene518;Name=murE;gbkey=Gene;gene=murE;gene_biotype=protein_coding;locus_tag=TW545
BX072543.1	EMBL	CDS	580752	582281	.	-	0	ID=cds518;Parent=gene518;Dbxref=GOA:Q83HJ9,InterPro:IPR000713,InterPro:IPR004101,InterPro:IPR005761,InterPro:IPR013221,NCBI_GP:CAD67211.1;Name=CAD67211.1;Note=Similar to Streptomyces coelicolor UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C6-diaminopimelateligase MurE or SCO2089 or SC4A10.22c SWALL:MURE_STRCO (SWALL:Q9S2W7) (506 aa) fasta scores: E(): 2.7e-44%2C 33.52%25 id in 528 aa%2C and to Escherichia coli UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C6-diaminopimelateligase MurE or b0085 SWALL:MURE_ECOLI (SWALL:P22188) (494 aa) fasta scores: E(): 2.9e-29%2C 29.76%25 id in 467 aa;gbkey=CDS;gene=murE;product=UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C6-diaminopimelate ligase;protein_id=CAD67211.1;transl_table=11
BX072543.1	EMBL	sequence_feature	580973	581237	.	-	.	ID=id1053;Note=Mur ligase family%2C glutamate ligase domain Score %3D 59.0 E-value %3D 7.2e-15;gbkey=misc_feature;gene=murE
BX072543.1	EMBL	sequence_feature	581273	582149	.	-	.	ID=id1054;Note=Mur ligase family%2C catalytic domain Score %3D 63.4 E-value %3D 3.5e-16;gbkey=misc_feature;gene=murE
BX072543.1	EMBL	gene	582278	583387	.	-	.	ID=gene519;Name=mraY;gbkey=Gene;gene=mraY;gene_biotype=protein_coding;locus_tag=TW546
BX072543.1	EMBL	CDS	582278	583387	.	-	0	ID=cds519;Parent=gene519;Dbxref=GOA:Q83HJ8,InterPro:IPR000715,InterPro:IPR003524,InterPro:IPR018480,NCBI_GP:CAD67212.1;Name=CAD67212.1;Note=Similar to Streptomyces coelicolor phospho-N-acetylmuramoyl-pentapeptide-transferase MraY or MurX or SCO2087 or SC4A10.20c SWALL:MRAY_STRCO (SWALL:P56833) (363 aa) fasta scores: E(): 4.9e-55%2C 47.45%25 id in 373 aa%2C and to Escherichia coli phospho-N-acetylmuramoyl-pentapeptide-transferase MraY or MurX or b0087 SWALL:MRAY_ECOLI (SWALL:P15876) (360 aa) fasta scores: E(): 7.4e-25%2C 36.03%25 id in 358 aa;gbkey=CDS;gene=mraY;product=phospho-N-acetylmuramoyl-pentapeptide-transferase;protein_id=CAD67212.1;transl_table=11
BX072543.1	EMBL	sequence_feature	583310	583378	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=1/10;partial=true
BX072543.1	EMBL	sequence_feature	583166	583234	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=2/10;partial=true
BX072543.1	EMBL	sequence_feature	583100	583153	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=3/10;partial=true
BX072543.1	EMBL	sequence_feature	582971	583039	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=4/10;partial=true
BX072543.1	EMBL	sequence_feature	582845	582913	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=5/10;partial=true
BX072543.1	EMBL	sequence_feature	582740	582808	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=6/10;partial=true
BX072543.1	EMBL	sequence_feature	582605	582658	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=7/10;partial=true
BX072543.1	EMBL	sequence_feature	582518	582586	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=8/10;partial=true
BX072543.1	EMBL	sequence_feature	582440	582508	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=9/10;partial=true
BX072543.1	EMBL	sequence_feature	582296	582364	.	-	.	ID=id1055;Note=10 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 52-74%2C 79-96%2C 117-139%2C 159-181%2C 194-216%2C 244-261%2C 268-290%2C 294-316 and 342-364;gbkey=misc_feature;gene=mraY;is_ordered=true;part=10/10;partial=true
BX072543.1	EMBL	sequence_feature	582505	583150	.	-	.	ID=id1056;Note=Glycosyl transferase Score %3D 134.3 E-value %3D 1.6e-37;gbkey=misc_feature;gene=mraY
BX072543.1	EMBL	gene	583384	584778	.	-	.	ID=gene520;Name=murF;gbkey=Gene;gene=murF;gene_biotype=protein_coding;locus_tag=TW547
BX072543.1	EMBL	CDS	583384	584778	.	-	0	ID=cds520;Parent=gene520;Dbxref=GOA:Q83HJ7,InterPro:IPR000713,InterPro:IPR004101,InterPro:IPR005863,InterPro:IPR013221,UniProtKB/TrEMBL:Q83HJ7,NCBI_GP:CAD67213.1;Name=CAD67213.1;Note=Similar to Streptomyces toyocaensis probable UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanyl ligase MurF or MurX SWALL:MURF_STRTO (SWALL:O33804) (443 aa) fasta scores: E(): 2.5e-30%2C 31.44%25 id in 442 aa%2C and to Escherichia coli UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanyl ligase MurF or Mra or b0086 SWALL:MURF_ECOLI (SWALL:P11880) (452 aa) fasta scores: E(): 3.3e-28%2C 31.41%25 id in 382 aa;gbkey=CDS;gene=murF;product=probable UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanyl ligase;protein_id=CAD67213.1;transl_table=11
BX072543.1	EMBL	sequence_feature	583569	583836	.	-	.	ID=id1057;Note=Mur ligase family%2C glutamate ligase domain Score %3D 14.2 E-value %3D 0.00088;gbkey=misc_feature;gene=murF
BX072543.1	EMBL	sequence_feature	583860	584658	.	-	.	ID=id1058;Note=Mur ligase family%2C catalytic domain Score %3D 120.7 E-value %3D 1.9e-33;gbkey=misc_feature;gene=murF
BX072543.1	EMBL	gene	584800	586545	.	-	.	ID=gene521;Name=pbp;gbkey=Gene;gene=pbp;gene_biotype=protein_coding;locus_tag=TW548
BX072543.1	EMBL	CDS	584800	586545	.	-	0	ID=cds521;Parent=gene521;Dbxref=GOA:Q83NG6,InterPro:IPR001460,InterPro:IPR005311,InterPro:IPR012338,UniProtKB/TrEMBL:Q83NG6,NCBI_GP:CAD67214.1;Name=CAD67214.1;Note=Similar to Bacillus subtilis penicillin-binding protein 2b PbpB SWALL:PBPB_BACSU (SWALL:Q07868) (716 aa) fasta scores: E(): 2.4e-32%2C 27.68%25 id in 596 aa%2C and to Streptomyces coelicolor FtsI SWALL:Q9Z5V7 (EMBL:AF123319) (651 aa) fasta scores: E(): 8.1e-44%2C 30.62%25 id in 604 aa;gbkey=CDS;gene=pbp;product=penicillin-binding protein;protein_id=CAD67214.1;transl_table=11
BX072543.1	EMBL	sequence_feature	584865	585852	.	-	.	ID=id1059;Note=Penicillin binding protein transpeptidase domain Score %3D 184.2 E-value %3D 1.5e-52;gbkey=misc_feature;gene=pbp
BX072543.1	EMBL	sequence_feature	584992	585015	.	-	.	ID=id1060;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=pbp
BX072543.1	EMBL	sequence_feature	585906	586398	.	-	.	ID=id1061;Note=Penicillin-binding Protein dimerisation domain Score %3D 97.2 E-value %3D 2.3e-26;gbkey=misc_feature;gene=pbp
BX072543.1	EMBL	sequence_feature	586444	586545	.	-	.	ID=id1062;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.854 between residues 34 and 35;gbkey=misc_feature;gene=pbp
BX072543.1	EMBL	sequence_feature	586459	586527	.	-	.	ID=id1063;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature;gene=pbp
BX072543.1	EMBL	gene	586618	587073	.	-	.	ID=gene522;Name=TW549;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW549
BX072543.1	EMBL	CDS	586618	587073	.	-	0	ID=cds522;Parent=gene522;Dbxref=UniProtKB/TrEMBL:Q83NG5,NCBI_GP:CAD67215.1;Name=CAD67215.1;Note=Similar to Streptomyces coelicolor putative membrane protein SCO2091 or SC4A10.24c SWALL:Q9S2W5 (EMBL:AL109663) (206 aa) fasta scores: E(): 0.0016%2C 34.44%25 id in 90 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67215.1;transl_table=11
BX072543.1	EMBL	sequence_feature	586957	587073	.	-	.	ID=id1064;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.479 between residues 39 and 40;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	586969	587037	.	-	.	ID=id1065;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-35;gbkey=misc_feature
BX072543.1	EMBL	gene	587070	588023	.	-	.	ID=gene523;Name=mraW;gbkey=Gene;gene=mraW;gene_biotype=protein_coding;locus_tag=TW550
BX072543.1	EMBL	CDS	587070	588023	.	-	0	ID=cds523;Parent=gene523;Dbxref=GOA:Q83HJ6,InterPro:IPR002903,InterPro:IPR023397,InterPro:IPR029063,NCBI_GP:CAD67216.1;Name=CAD67216.1;Note=Similar to Streptococcus pneumoniae S-adenosyl-methyltransferase MraW or sp0334 SWALL:MRAW_STRPN (SWALL:Q97SK1) (316 aa) fasta scores: E(): 2.9e-39%2C 40.06%25 id in 312 aa%2C and to Escherichia coli S-adenosyl-methyltransferase MraW or b0082 or z0092 or ecs0086 SWALL:MRAW_ECOLI (SWALL:P18595) (313 aa) fasta scores: E(): 4e-34%2C 39.68%25 id in 315 aa;gbkey=CDS;gene=mraW;product=S-adenosyl-methyltransferase;protein_id=CAD67216.1;transl_table=11
BX072543.1	EMBL	sequence_feature	587120	588020	.	-	.	ID=id1066;Note=MraW methylase family Score %3D 427.7 E-value %3D 7.6e-126;gbkey=misc_feature;gene=mraW
BX072543.1	EMBL	sequence_feature	587832	587933	.	-	.	ID=id1067;Note=PS00107 Protein kinases ATP-binding region signature.;gbkey=misc_feature;gene=mraW
BX072543.1	EMBL	gene	588073	588501	.	-	.	ID=gene524;Name=mraZ;gbkey=Gene;gene=mraZ;gene_biotype=protein_coding;locus_tag=TW551
BX072543.1	EMBL	CDS	588073	588501	.	-	0	ID=cds524;Parent=gene524;Dbxref=GOA:Q83HJ5,InterPro:IPR003444,InterPro:IPR020603,NCBI_GP:CAD67217.1;Name=CAD67217.1;Note=Similar to Bacillus halodurans protein MraZ or bh2576 SWALL:MRAZ_BACHD (SWALL:Q9K9R9) (143 aa) fasta scores: E(): 3.3e-20%2C 41%25 id in 139 aa%2C and to Escherichia coli protein MraZ or b0081 SWALL:MRAZ_ECOLI (SWALL:P22186) (152 aa) fasta scores: E(): 2.6e-05%2C 29.77%25 id in 131 aa;gbkey=CDS;gene=mraZ;product=conserved hypothetical protein MraZ;protein_id=CAD67217.1;transl_table=11
BX072543.1	EMBL	sequence_feature	588081	588291	.	-	.	ID=id1068;Note=Domain of unknown function UPF0040 family Score %3D 69.6 E-value %3D 4.7e-18;gbkey=misc_feature;gene=mraZ
BX072543.1	EMBL	sequence_feature	588294	588501	.	-	.	ID=id1069;Note=Domain of unknown function UPF0040 family Score %3D 51.8 E-value %3D 1.1e-12;gbkey=misc_feature;gene=mraZ
BX072543.1	EMBL	gene	588579	589076	.	-	.	ID=gene525;Name=TW552;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW552
BX072543.1	EMBL	CDS	588579	589076	.	-	0	ID=cds525;Parent=gene525;Dbxref=InterPro:IPR008009,UniProtKB/TrEMBL:Q83NG4,NCBI_GP:CAD67218.1;Name=CAD67218.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD67218.1;transl_table=11
BX072543.1	EMBL	sequence_feature	588777	588845	.	-	.	ID=id1070;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 78-100 and 115-137;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	588666	588734	.	-	.	ID=id1070;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 78-100 and 115-137;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	589163	589504	.	-	.	ID=gene526;Name=TW553;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW553
BX072543.1	EMBL	CDS	589163	589504	.	-	0	ID=cds526;Parent=gene526;Dbxref=InterPro:IPR021401,UniProtKB/TrEMBL:Q83NG3,NCBI_GP:CAD67219.1;Name=CAD67219.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67219.1;transl_table=11
BX072543.1	EMBL	sequence_feature	589286	589345	.	-	.	ID=id1071;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 54-73 and 77-99;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	589208	589276	.	-	.	ID=id1071;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 54-73 and 77-99;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	589617	590681	.	+	.	ID=gene527;Name=TW554;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW554
BX072543.1	EMBL	CDS	589617	590681	.	+	0	ID=cds527;Parent=gene527;Dbxref=GOA:Q83NG2,InterPro:IPR000092,InterPro:IPR008949,InterPro:IPR017446,UniProtKB/TrEMBL:Q83NG2,NCBI_GP:CAD67220.1;Name=CAD67220.1;Note=Similar to Brevibacterium linens ggpp synthase CrtE SWALL:Q9KK76 (EMBL:AF139916) (385 aa) fasta scores: E(): 2.2e-08%2C 28.82%25 id in 333 aa%2C and to Aeropyrum pernix farnesylgeranyl diphosphate synthase Fgs SWALL:Q9UWR6 (EMBL:AB025791) (318 aa) fasta scores: E(): 2.3e-07%2C 28.42%25 id in 299 aa;gbkey=CDS;product=putative polyprenyl diphosphate synthase;protein_id=CAD67220.1;transl_table=11
BX072543.1	EMBL	sequence_feature	589692	590586	.	+	.	ID=id1072;Note=Polyprenyl synthetase Score %3D 45.7 E-value %3D 4.6e-11;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	589851	589895	.	+	.	ID=id1073;Note=PS00723 Polyprenyl synthetases signature 1.;gbkey=misc_feature
BX072543.1	EMBL	gene	590691	592496	.	+	.	ID=gene528;Name=TW555;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW555
BX072543.1	EMBL	CDS	590691	592496	.	+	0	ID=cds528;Parent=gene528;Dbxref=GOA:Q820C0,InterPro:IPR000719,InterPro:IPR005543,InterPro:IPR008271,InterPro:IPR011009,UniProtKB/TrEMBL:Q820C0,NCBI_GP:CAD67221.1;Name=CAD67221.1;Note=Similar to Streptomyces coelicolor eukaryotic-type protain kinase PkaF SWALL:Q9ZNB3 (EMBL:AB019394) (629 aa) fasta scores: E(): 2.5e-38%2C 33.07%25 id in 638 aa;gbkey=CDS;product=putative eukaryotic-type serine/threonine protein kinase;protein_id=CAD67221.1;transl_table=11
BX072543.1	EMBL	sequence_feature	590736	591492	.	+	.	ID=id1074;Note=Protein kinase domain Score %3D 208.8 E-value %3D 6e-60;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	591093	591131	.	+	.	ID=id1075;Note=PS00108 Serine/Threonine protein kinases active-site signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	591615	591683	.	+	.	ID=id1076;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 309-331;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	592095	592293	.	+	.	ID=id1077;Note=PASTA domain Score %3D 61.1 E-value %3D 1.7e-15;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	592296	592491	.	+	.	ID=id1078;Note=PASTA domain Score %3D 36.8 E-value %3D 3.4e-08;gbkey=misc_feature
BX072543.1	EMBL	gene	592766	594133	.	-	.	ID=gene529;Name=aroH;gbkey=Gene;gene=aroH;gene_biotype=protein_coding;locus_tag=TW556
BX072543.1	EMBL	CDS	592766	594133	.	-	0	ID=cds529;Parent=gene529;Dbxref=GOA:Q83HJ4,InterPro:IPR002480,UniProtKB/TrEMBL:Q83HJ4,NCBI_GP:CAD67222.1;Name=CAD67222.1;Note=Similar to Streptomyces coelicolor phospho-2-dehydro-3-deoxyheptonate aldolase AroH or SCO2115 or SC6E10.09c SWALL:AROF_STRCO (SWALL:P80574) (449 aa) fasta scores: E(): 3.3e-106%2C 59.17%25 id in 436 aa;gbkey=CDS;gene=aroH;product=phospho-2-dehydro-3-deoxyheptonate aldolase;protein_id=CAD67222.1;transl_table=11
BX072543.1	EMBL	sequence_feature	592783	594052	.	-	.	ID=id1079;Note=Class-II DAHP synthetase family Score %3D 803.9 E-value %3D 4.3e-239;gbkey=misc_feature;gene=aroH
BX072543.1	EMBL	gene	594117	594782	.	-	.	ID=gene530;Name=TW557;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW557
BX072543.1	EMBL	CDS	594117	594782	.	-	0	ID=cds530;Parent=gene530;Dbxref=GOA:Q83HJ3,InterPro:IPR002123,UniProtKB/TrEMBL:Q83HJ3,NCBI_GP:CAD67223.1;Name=CAD67223.1;Note=Similar to Streptomyces coelicolor putative acyltransferase SCO1228 or 2SCG1.03 SWALL:Q9FCD9 (EMBL:AL391014) (240 aa) fasta scores: E(): 7.8e-41%2C 47.03%25 id in 219 aa%2C and to Limnanthes alba 1-acyl-sn-glycerol-3-phosphate acyltransferase SWALL:PLSC_LIMAL (SWALL:Q42868) (281 aa) fasta scores: E(): 2.4e-07%2C 30%25 id in 160 aa;gbkey=CDS;product=putative acyltransferase;protein_id=CAD67223.1;transl_table=11
BX072543.1	EMBL	sequence_feature	594167	594713	.	-	.	ID=id1080;Note=Acyltransferase Score %3D 115.9 E-value %3D 5.5e-32;gbkey=misc_feature
BX072543.1	EMBL	gene	594860	595777	.	-	.	ID=gene531;Name=glk;gbkey=Gene;gene=glk;gene_biotype=protein_coding;locus_tag=TW558
BX072543.1	EMBL	CDS	594860	595777	.	-	0	ID=cds531;Parent=gene531;Dbxref=GOA:Q83HJ2,InterPro:IPR000600,UniProtKB/TrEMBL:Q83HJ2,NCBI_GP:CAD67224.1;Name=CAD67224.1;Note=Similar to Streptomyces coelicolor glucokinase GlkA or Glk or SCO2126 or SC6E10.20c SWALL:GLK_STRCO (SWALL:P40184) (317 aa) fasta scores: E(): 9.5e-28%2C 39.22%25 id in 311 aa;gbkey=CDS;gene=glk;product=glucokinase;protein_id=CAD67224.1;transl_table=11
BX072543.1	EMBL	sequence_feature	595222	595762	.	-	.	ID=id1081;Note=ROK family Score %3D 172.8 E-value %3D 4e-49;gbkey=misc_feature;gene=glk
BX072543.1	EMBL	gene	595831	598080	.	-	.	ID=gene532;Name=TW559;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW559
BX072543.1	EMBL	CDS	595831	598080	.	-	0	ID=cds532;Parent=gene532;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NG1,NCBI_GP:CAD67225.1;Name=CAD67225.1;Note=No significant database matches. Probably membrane spanning. Contains 4 x 100bp (approx) repeat sequence in the C-terminal region from residue 324-736 approx.;gbkey=CDS;product=WiSP family protein;protein_id=CAD67225.1;transl_table=11
BX072543.1	EMBL	sequence_feature	598165	598233	.	-	.	ID=id1082;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.819) with cleavage site probability 0.639 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	gene	598196	598759	.	-	.	ID=gene533;Name=TW560;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW560
BX072543.1	EMBL	CDS	598196	598759	.	-	0	ID=cds533;Parent=gene533;Dbxref=GOA:Q83NG0,InterPro:IPR003784,UniProtKB/TrEMBL:Q83NG0,NCBI_GP:CAD67226.1;Name=CAD67226.1;Note=Similar to Rhizobium meliloti hypothetical transmembrane protein Smc00964 SWALL:Q92RI3 (EMBL:AL591785) (187 aa) fasta scores: E(): 1.6e-25%2C 49.42%25 id in 174 aa%2C and to Bacillus sphaericus biotin synthesis associated protein BioY SWALL:BIOY_BACSH (SWALL:P22819) (196 aa) fasta scores: E(): 4.6e-08%2C 30.05%25 id in 183 aa;gbkey=CDS;product=conserved putative integral membrane protein (BioY-family);protein_id=CAD67226.1;transl_table=11
BX072543.1	EMBL	sequence_feature	598207	598660	.	-	.	ID=id1083;Note=BioY family Score %3D 96.2 E-value %3D 4.5e-26;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	598673	598732	.	-	.	ID=id1084;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29%2C 49-71%2C 86-108%2C 120-142 and 157-179;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	598547	598615	.	-	.	ID=id1084;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29%2C 49-71%2C 86-108%2C 120-142 and 157-179;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	598436	598504	.	-	.	ID=id1084;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29%2C 49-71%2C 86-108%2C 120-142 and 157-179;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	598334	598402	.	-	.	ID=id1084;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29%2C 49-71%2C 86-108%2C 120-142 and 157-179;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	598223	598291	.	-	.	ID=id1084;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-29%2C 49-71%2C 86-108%2C 120-142 and 157-179;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	sequence_feature	598634	598759	.	-	.	ID=id1085;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.967) with cleavage site probability 0.575 between residues 42 and 43;gbkey=misc_feature
BX072543.1	EMBL	tRNA	598812	598883	.	-	.	ID=rna30;Note=tRNA Gln anticodon CTG%2C Cove score 56.91;gbkey=tRNA;product=tRNA-Gln
BX072543.1	EMBL	exon	598812	598883	.	-	.	ID=id1086;Parent=rna30;Note=tRNA Gln anticodon CTG%2C Cove score 56.91;gbkey=tRNA;product=tRNA-Gln
BX072543.1	EMBL	gene	598981	599292	.	-	.	ID=gene534;Name=TW561;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW561
BX072543.1	EMBL	CDS	598981	599292	.	-	0	ID=cds534;Parent=gene534;Dbxref=InterPro:IPR008009,UniProtKB/TrEMBL:Q83NF9,NCBI_GP:CAD67227.1;Name=CAD67227.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD67227.1;transl_table=11
BX072543.1	EMBL	gene	599498	600619	.	-	.	ID=gene535;Name=TW562;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW562
BX072543.1	EMBL	CDS	599498	600619	.	-	0	ID=cds535;Parent=gene535;Dbxref=GOA:Q83NF8,InterPro:IPR000103,InterPro:IPR013027,InterPro:IPR023753,UniProtKB/TrEMBL:Q83NF8,NCBI_GP:CAD67228.1;Name=CAD67228.1;Note=Weak but full length similarity to many oxidoreductases eg. Deinococcus radiodurans pyridine nucleotide-disulphide oxidoreductase%2C class II dr0412 SWALL:Q9RXA3 (EMBL:AE001901) (324 aa) fasta scores: E(): 7.1e-07%2C 23.26%25 id in 361 aa%2C and Borrelia burgdorferi thioredoxin reductase TrxB or bb0515 SWALL:TRXB_BORBU (SWALL:P94284) (326 aa) fasta scores: E(): 0.4%2C 22.43%25 id in 361 aa;gbkey=CDS;product=putative oxidoreductase;protein_id=CAD67228.1;transl_table=11
BX072543.1	EMBL	gene	600620	602062	.	-	.	ID=gene536;Name=gltX;gbkey=Gene;gene=gltX;gene_biotype=protein_coding;locus_tag=TW563
BX072543.1	EMBL	CDS	600620	602062	.	-	0	ID=cds536;Parent=gene536;Dbxref=GOA:Q83HJ1,InterPro:IPR000924,InterPro:IPR004527,InterPro:IPR008925,InterPro:IPR014729,InterPro:IPR020058,InterPro:IPR020061,InterPro:IPR020751,NCBI_GP:CAD67229.1;Name=CAD67229.1;Note=Similar to Mycobacterium tuberculosis glutamyl-tRNA synthetase GltX or GltS or Rv2992c or mt3070 or mtv012.06C SWALL:SYE_MYCTU (SWALL:O53241) (490 aa) fasta scores: E(): 1.1e-104%2C 54.62%25 id in 476 aa%2C and to Bacillus stearothermophilus glutamyl-tRNA synthetase GltX SWALL:SYE_BACST (SWALL:P22249) (489 aa) fasta scores: E(): 3.8e-53%2C 34.84%25 id in 485 aa;gbkey=CDS;gene=gltX;product=glutamyl-tRNA synthetase;protein_id=CAD67229.1;transl_table=11
BX072543.1	EMBL	sequence_feature	601093	602050	.	-	.	ID=id1087;Note=tRNA synthetases class I (E and Q)%2C catalytic domain Score %3D 315.1 E-value %3D 5.7e-92;gbkey=misc_feature;gene=gltX
BX072543.1	EMBL	gene	602111	603196	.	-	.	ID=gene537;Name=ilvE;gbkey=Gene;gene=ilvE;gene_biotype=protein_coding;locus_tag=TW564
BX072543.1	EMBL	CDS	602111	603196	.	-	0	ID=cds537;Parent=gene537;Dbxref=GOA:Q83HJ0,InterPro:IPR001544,InterPro:IPR005786,InterPro:IPR018300,UniProtKB/TrEMBL:Q83HJ0,NCBI_GP:CAD67230.1;Name=CAD67230.1;Note=Similar to Mycobacterium tuberculosis probable branched-chain amino acid aminotransferase IlvE or Rv2210c or mt2266 or mtcy190.21C SWALL:ILVE_MYCTU (SWALL:Q10399) (368 aa) fasta scores: E(): 1.2e-62%2C 47.01%25 id in 368 aa%2C and to Rattus norvegicus branched-chain amino acid aminotransferase%2C cytosolic BcaT1 SWALL:BCAT_RAT (SWALL:P54690) (411 aa) fasta scores: E(): 2.8e-39%2C 35.38%25 id in 373 aa;gbkey=CDS;gene=ilvE;product=branched-chain amino acid aminotransferase;protein_id=CAD67230.1;transl_table=11
BX072543.1	EMBL	sequence_feature	602176	603049	.	-	.	ID=id1088;Note=Aminotransferase class IV Score %3D 342.1 E-value %3D 4.4e-100;gbkey=misc_feature;gene=ilvE
BX072543.1	EMBL	sequence_feature	602399	602491	.	-	.	ID=id1089;Note=PS00770 Aminotransferases class-IV signature.;gbkey=misc_feature;gene=ilvE
BX072543.1	EMBL	gene	603297	604298	.	-	.	ID=gene538;Name=ilvC;gbkey=Gene;gene=ilvC;gene_biotype=protein_coding;locus_tag=TW565
BX072543.1	EMBL	CDS	603297	604298	.	-	0	ID=cds538;Parent=gene538;Dbxref=GOA:Q83HI9,InterPro:IPR000506,InterPro:IPR008927,InterPro:IPR013023,InterPro:IPR013116,InterPro:IPR013328,NCBI_GP:CAD67231.1;Name=CAD67231.1;Note=Similar to Streptomyces avermitilis ketol-acid reductoisomerase IlvC SWALL:ILVC_STRAW (SWALL:Q59818) (333 aa) fasta scores: E(): 1.5e-74%2C 59.25%25 id in 324 aa;gbkey=CDS;gene=ilvC;product=ketol-acid reductoisomerase;protein_id=CAD67231.1;transl_table=11
BX072543.1	EMBL	sequence_feature	603302	603737	.	-	.	ID=id1090;Note=Acetohydroxy acid isomeroreductase%2C catalytic domain Score %3D 255.2 E-value %3D 6.3e-74;gbkey=misc_feature;gene=ilvC
BX072543.1	EMBL	gene	604367	604609	.	-	.	ID=gene539;Name=ilvN;gbkey=Gene;gene=ilvN;gene_biotype=protein_coding;locus_tag=TW566
BX072543.1	EMBL	CDS	604367	604609	.	-	0	ID=cds539;Parent=gene539;Dbxref=GOA:Q83HI8,InterPro:IPR002912,UniProtKB/TrEMBL:Q83HI8,NCBI_GP:CAD67232.1;Name=CAD67232.1;Note=Similar to Corynebacterium glutamicum acetohydroxy acid synthase%2C small subunit IlvN or LivS or cgl1272 SWALL:Q57091 (EMBL:L09232) (172 aa) fasta scores: E(): 1.9e-06%2C 45.12%25 id in 82 aa;gbkey=CDS;gene=ilvN;product=acetohydroxy acid synthase%2C small subunit;protein_id=CAD67232.1;transl_table=11
BX072543.1	EMBL	sequence_feature	604381	604597	.	-	.	ID=id1091;Note=ACT domain Score %3D 58.7 E-value %3D 8.7e-15;gbkey=misc_feature;gene=ilvN
BX072543.1	EMBL	gene	604602	606347	.	-	.	ID=gene540;Name=ilvB;gbkey=Gene;gene=ilvB;gene_biotype=protein_coding;locus_tag=TW567
BX072543.1	EMBL	CDS	604602	606347	.	-	0	ID=cds540;Parent=gene540;Dbxref=GOA:Q83HI7,InterPro:IPR000399,InterPro:IPR011766,InterPro:IPR012000,InterPro:IPR012001,InterPro:IPR012846,InterPro:IPR029035,InterPro:IPR029061,UniProtKB/TrEMBL:Q83HI7,NCBI_GP:CAD67233.1;Name=CAD67233.1;Note=Similar to Mycobacterium avium acetolactate synthase ilvB SWALL:ILVB_MYCAV (SWALL:Q59498) (621 aa) fasta scores: E(): 4.5e-127%2C 57.38%25 id in 582 aa. Note truncated N-terminus relative to homologues.;gbkey=CDS;gene=ilvB;product=acetolactate synthase;protein_id=CAD67233.1;transl_table=11
BX072543.1	EMBL	sequence_feature	604712	605249	.	-	.	ID=id1092;Note=Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain Score %3D 260.3 E-value %3D 1.9e-75;gbkey=misc_feature;gene=ilvB
BX072543.1	EMBL	sequence_feature	605001	605060	.	-	.	ID=id1093;Note=PS00187 Thiamine pyrophosphate enzymes signature.;gbkey=misc_feature;gene=ilvB
BX072543.1	EMBL	sequence_feature	605297	605771	.	-	.	ID=id1094;Note=Thiamine pyrophosphate enzyme%2C central domain Score %3D 192.3 E-value %3D 5.3e-55;gbkey=misc_feature;gene=ilvB
BX072543.1	EMBL	sequence_feature	605831	606344	.	-	.	ID=id1095;Note=Thiamine pyrophosphate enzyme%2C N-terminal TPP binding domain Score %3D 273.6 E-value %3D 1.8e-79;gbkey=misc_feature;gene=ilvB
BX072543.1	EMBL	gene	606392	608101	.	-	.	ID=gene541;Name=ilvD;gbkey=Gene;gene=ilvD;gene_biotype=protein_coding;locus_tag=TW568
BX072543.1	EMBL	CDS	606392	608101	.	-	0	ID=cds541;Parent=gene541;Dbxref=GOA:Q83HI6,InterPro:IPR000581,InterPro:IPR004404,InterPro:IPR015928,InterPro:IPR020558,NCBI_GP:CAD67234.1;Name=CAD67234.1;Note=Similar to Mycobacterium tuberculosis dihydroxy-acid dehydratase IlvD or Rv0189c or mt0199 or mtci28.28C SWALL:ILVD_MYCTU (SWALL:O07433) (575 aa) fasta scores: E(): 1.2e-153%2C 71.5%25 id in 558 aa%2C and to Saccharomyces cerevisiae dihydroxy-acid dehydratase%2C mitochondrial precursor Ilv3 or yjr016c or j1450 SWALL:ILV3_YEAST (SWALL:P39522) (585 aa) fasta scores: E(): 1.3e-93%2C 46.69%25 id in 559 aa%2C and to Lactococcus lactis dihydroxy-acid dehydratase IlvD or ll1223 SWALL:ILVD_LACLA (SWALL:Q02139) (570 aa) fasta scores: E(): 5.8e-84%2C 43.26%25 id in 564 aa;gbkey=CDS;gene=ilvD;product=dihydroxy-acid dehydratase;protein_id=CAD67234.1;transl_table=11
BX072543.1	EMBL	sequence_feature	606397	607966	.	-	.	ID=id1096;Note=Dehydratase family Score %3D 972.8 E-value %3D 5.9e-290;gbkey=misc_feature;gene=ilvD
BX072543.1	EMBL	sequence_feature	607670	607702	.	-	.	ID=id1097;Note=PS00886 Dihydroxy-acid and 6-phosphogluconate dehydratases signature 1.;gbkey=misc_feature;gene=ilvD
BX072543.1	EMBL	repeat_region	608184	616164	.	+	.	ID=id1098;Note=Non-coding degenerate repeat region in Repeat Cluster 2 (RC2).;gbkey=repeat_region
BX072543.1	EMBL	tRNA	614058	614133	.	-	.	ID=rna31;Note=tRNA Lys anticodon CTT%2C Cove score 73.89;gbkey=tRNA;product=tRNA-Lys
BX072543.1	EMBL	exon	614058	614133	.	-	.	ID=id1099;Parent=rna31;Note=tRNA Lys anticodon CTT%2C Cove score 73.89;gbkey=tRNA;product=tRNA-Lys
BX072543.1	EMBL	gene	616144	616510	.	-	.	ID=gene542;Name=ssrA;gbkey=Gene;gene=ssrA;gene_biotype=misc_RNA
BX072543.1	EMBL	transcript	616144	616510	.	-	.	ID=rna32;Parent=gene542;Note=tmRNA;gbkey=misc_RNA;gene=ssrA
BX072543.1	EMBL	exon	616144	616510	.	-	.	ID=id1100;Parent=rna32;Note=tmRNA;gbkey=misc_RNA;gene=ssrA
BX072543.1	EMBL	gene	616652	617908	.	-	.	ID=gene543;Name=ksgA;gbkey=Gene;gene=ksgA;gene_biotype=protein_coding;locus_tag=TW569
BX072543.1	EMBL	CDS	616652	617908	.	-	0	ID=cds542;Parent=gene543;Dbxref=GOA:Q83HI5,InterPro:IPR001737,InterPro:IPR020596,InterPro:IPR020598,InterPro:IPR023165,InterPro:IPR029063,UniProtKB/TrEMBL:Q83HI5,NCBI_GP:CAD67235.1;Name=CAD67235.1;Note=Localised similarity to a family of proteins which includes Escherichia coli dimethyladenosine transferase KsgA%2C a protein involved in ribosome function. C-terminal region similar to Escherichia coli dimethyladenosine transferase KsgA or rsma or b0051 SWALL:KSGA_ECOLI (SWALL:P06992) (273 aa) fasta scores: E(): 2e-11%2C 34.19%25 id in 155 aa. N-terminal region contains ribosomal RNA adenine dimethylases signature similar to Mycobacterium tuberculosis KsgA or Rv1010 or mtci237.27 or mt1039 SWALL:O05595 (EMBL:Z94752) blast scores: E(): 9e-27%2C score: 304 35%25 id.;gbkey=CDS;gene=ksgA;product=dimethyladenosine transferase;protein_id=CAD67235.1;transl_table=11
BX072543.1	EMBL	sequence_feature	616699	617845	.	-	.	ID=id1101;Note=Ribosomal RNA adenine dimethylase Score %3D 69.1 E-value %3D 6.4e-18;gbkey=misc_feature;gene=ksgA
BX072543.1	EMBL	sequence_feature	617690	617773	.	-	.	ID=id1102;Note=PS01131 Ribosomal RNA adenine dimethylases signature.;gbkey=misc_feature;gene=ksgA
BX072543.1	EMBL	gene	617905	622575	.	-	.	ID=gene544;Name=TW570;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW570
BX072543.1	EMBL	CDS	617905	622575	.	-	0	ID=cds543;Parent=gene544;Dbxref=InterPro:IPR003961,InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NF7,NCBI_GP:CAD67236.1;Name=CAD67236.1;Note=No significant database matches. 4x degenerate repeat at residue 650-1066. Exact 4x repeat at residue 1198-1555. Threonine-rich region residue 111-1171.;gbkey=CDS;product=WiSP family protein;protein_id=CAD67236.1;transl_table=11
BX072543.1	EMBL	sequence_feature	622441	622575	.	-	.	ID=id1103;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.891 between residues 45 and 46;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	622447	622515	.	-	.	ID=id1104;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-43;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	619310	621350	.	-	.	ID=id1105;Note=Coding degenerate repeat region in Repeat Cluster 2 (RC2). Related to local non-coding repeat regions.;gbkey=repeat_region
BX072543.1	EMBL	sequence_alteration	620446	620448	.	-	.	ID=id1106;Note=polymorphic bases: ACA or GGG;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620462	620462	.	-	.	ID=id1107;Note=polymorphic base: C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620474	620479	.	-	.	ID=id1108;Note=polymorphic bases: AACCAA or CTC;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620688	620688	.	-	.	ID=id1109;Note=polymorphic base: C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620718	620718	.	-	.	ID=id1110;Note=polymorphic base: T or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620726	620726	.	-	.	ID=id1111;Note=polymorphic base: T or G;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620731	620731	.	-	.	ID=id1112;Note=polymorphic base: T or G;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620732	620732	.	-	.	ID=id1113;Note=polymorphic base: C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620733	620733	.	-	.	ID=id1114;Note=polymorphic base: T or G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620738	620738	.	-	.	ID=id1115;Note=polymorphic base: G or T or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620817	620817	.	-	.	ID=id1116;Note=polymorphic base: A or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620826	620826	.	-	.	ID=id1117;Note=polymorphic base: A or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620883	620883	.	-	.	ID=id1118;Note=polymorphic base: A or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620906	620906	.	-	.	ID=id1119;Note=polymorphic base: T or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620934	620934	.	-	.	ID=id1120;Note=polymorphic base: A or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620939	620940	.	-	.	ID=id1121;Note=polymorphic bases: TT or TCCCT;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620945	620945	.	-	.	ID=id1122;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620946	620946	.	-	.	ID=id1123;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620948	620948	.	-	.	ID=id1124;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620951	620951	.	-	.	ID=id1125;Note=polymorphic base: C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620953	620953	.	-	.	ID=id1126;Note=polymorphic base: T or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620954	620954	.	-	.	ID=id1127;Note=polymorphic base: A or G;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620955	620955	.	-	.	ID=id1128;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620962	620962	.	-	.	ID=id1129;Note=polymorphic base: C or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	620965	620965	.	-	.	ID=id1130;Note=polymorphic base: A or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621058	621065	.	-	.	ID=id1131;Note=polymorphic bases: CCGTGTTT or GCACAGAG;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621073	621077	.	-	.	ID=id1132;Note=polymorphic basea: CAAGT or TATGG;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621082	621087	.	-	.	ID=id1133;Note=polymorphic bases: GGTGGT or AAGACC;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621098	621098	.	-	.	ID=id1134;Note=polymorphic base: C or G;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621099	621099	.	-	.	ID=id1135;Note=polymorphic base: G or A or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621101	621101	.	-	.	ID=id1136;Note=polymorphic base: C or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621293	621293	.	-	.	ID=id1137;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621309	621309	.	-	.	ID=id1138;Note=polymorphic base: T or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621313	621313	.	-	.	ID=id1139;Note=polymorphic base: G or C;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621316	621316	.	-	.	ID=id1140;Note=polymorphic base: C or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621318	621318	.	-	.	ID=id1141;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621382	621382	.	-	.	ID=id1142;Note=polymorphic base: C or AA;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621396	621397	.	-	.	ID=id1143;Note=polymorphic bases: CC or TA;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621419	621420	.	-	.	ID=id1144;Note=polymorphic bases: CC or CAAA or CATATACCCAATATCTATC;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621424	621424	.	-	.	ID=id1145;Note=polymorphic base: C or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621441	621441	.	-	.	ID=id1146;Note=polymorphic base: G or A;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621450	621450	.	-	.	ID=id1147;Note=polymorphic base: A or T;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621455	621456	.	-	.	ID=id1148;Note=polymorphic bases: GG or GGTG;gbkey=variation
BX072543.1	EMBL	sequence_alteration	621462	621462	.	-	.	ID=id1149;Note=polymorphic base: A or T;gbkey=variation
BX072543.1	EMBL	repeat_region	620439	620643	.	+	.	ID=id1150;Note=repeated at 649651..649852 in RC1;gbkey=repeat_region
BX072543.1	EMBL	gene	623081	623716	.	-	.	ID=gene545;Name=smpB;gbkey=Gene;gene=smpB;gene_biotype=protein_coding;locus_tag=TW571
BX072543.1	EMBL	CDS	623081	623716	.	-	0	ID=cds544;Parent=gene545;Dbxref=GOA:Q83NF6,InterPro:IPR000037,InterPro:IPR020081,InterPro:IPR023620,NCBI_GP:CAD67237.1;Name=CAD67237.1;Note=Similar to Streptomyces coelicolor ssrA-binding protein SmpB or SCO2966 or SCE59.25c SWALL:Q9L1S9 (EMBL:AL138851) (159 aa) fasta scores: E(): 2.9e-23%2C 47.02%25 id in 151 aa%2C and to Mycobacterium tuberculosis ssra-binding protein smpb or rv3100c or mt3184 or mtcy164.11C SWALL:SSRP_MYCTU (SWALL:P96294) (160 aa) fasta scores: E(): 6.8e-21%2C 44.21%25 id in 147 aa;gbkey=CDS;gene=smpB;product=ssrA-binding protein;protein_id=CAD67237.1;transl_table=11
BX072543.1	EMBL	sequence_feature	623443	623644	.	-	.	ID=id1151;Note=SmpB protein Score %3D 93.6 E-value %3D 2.7e-25;gbkey=misc_feature;gene=smpB
BX072543.1	EMBL	sequence_feature	623546	623584	.	-	.	ID=id1152;Note=PS01317 Protein smpB signature.;gbkey=misc_feature;gene=smpB
BX072543.1	EMBL	gene	623728	624639	.	-	.	ID=gene546;Name=ftsX;gbkey=Gene;gene=ftsX;gene_biotype=protein_coding;locus_tag=TW572
BX072543.1	EMBL	CDS	623728	624639	.	-	0	ID=cds545;Parent=gene546;Dbxref=GOA:Q83NF5,InterPro:IPR003838,InterPro:IPR004513,UniProtKB/TrEMBL:Q83NF5,NCBI_GP:CAD67238.1;Name=CAD67238.1;Note=Similar to Mycobacterium tuberculosis cell division protein FtsX homolog or Rv3101c or mt3185 or mtcy164.12C SWALL:FTSX_MYCTU (SWALL:P96293) (297 aa) fasta scores: E(): 6.8e-15%2C 27.96%25 id in 304 aa%2C and to Streptomyces coelicolor putative cell division protein SCO2968 or SCE59.27c SWALL:Q9L1S7 (EMBL:AL138851) (305 aa) fasta scores: E(): 6.1e-37%2C 37.7%25 id in 305 aa;gbkey=CDS;gene=ftsX;product=cell division protein FtsX;protein_id=CAD67238.1;transl_table=11
BX072543.1	EMBL	sequence_feature	623733	624123	.	-	.	ID=id1153;Note=Predicted permease Score %3D 66.1 E-value %3D 5.1e-17;gbkey=misc_feature;gene=ftsX
BX072543.1	EMBL	sequence_feature	624514	624582	.	-	.	ID=id1154;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 183-205%2C 233-255 and 275-297;gbkey=misc_feature;gene=ftsX;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	624025	624093	.	-	.	ID=id1154;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 183-205%2C 233-255 and 275-297;gbkey=misc_feature;gene=ftsX;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	623875	623943	.	-	.	ID=id1154;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 183-205%2C 233-255 and 275-297;gbkey=misc_feature;gene=ftsX;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	623749	623817	.	-	.	ID=id1154;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 183-205%2C 233-255 and 275-297;gbkey=misc_feature;gene=ftsX;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	624523	624639	.	-	.	ID=id1155;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.848) with cleavage site probability 0.366 between residues 39 and 40;gbkey=misc_feature;gene=ftsX
BX072543.1	EMBL	gene	624654	626954	.	-	.	ID=gene547;Name=ftsE;gbkey=Gene;gene=ftsE;gene_biotype=protein_coding;locus_tag=TW573
BX072543.1	EMBL	CDS	624654	626954	.	-	0	ID=cds546;Parent=gene547;Dbxref=GOA:Q83HI4,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR005286,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HI4,NCBI_GP:CAD67239.1;Name=CAD67239.1;Note=Similar to Escherichia coli cell division ATP-binding protein FtsE or b3463 or z4837 or ecs4312 SWALL:FTSE_ECOLI (SWALL:P10115) (222 aa) fasta scores: E(): 4.8e-30%2C 50%25 id in 214 aa%2C and to Mycobacterium tuberculosis FtsE SWALL:P96292 (EMBL:X70031) (195 aa) fasta scores: E(): 5e-31%2C 58.42%25 id in 190 aa;gbkey=CDS;gene=ftsE;product=cell division ATP-binding protein FtsE;protein_id=CAD67239.1;transl_table=11
BX072543.1	EMBL	sequence_feature	626315	626870	.	-	.	ID=id1156;Note=ABC transporter Score %3D 193.5 E-value %3D 2.3e-55;gbkey=misc_feature;gene=ftsE
BX072543.1	EMBL	sequence_feature	626496	626540	.	-	.	ID=id1157;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature;gene=ftsE
BX072543.1	EMBL	sequence_feature	626826	626849	.	-	.	ID=id1158;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=ftsE
BX072543.1	EMBL	gene	627148	628278	.	-	.	ID=gene548;Name=prfB;gbkey=Gene;gene=prfB;gene_biotype=protein_coding;locus_tag=TW574
BX072543.1	EMBL	CDS	627148	628278	.	-	0	ID=cds547;Parent=gene548;Dbxref=GOA:Q83NF4,InterPro:IPR000352,InterPro:IPR004374,InterPro:IPR005139,InterPro:IPR014720,UniProtKB/TrEMBL:Q83NF4,NCBI_GP:CAD67240.1;Name=CAD67240.1;Note=Similar to Bacillus subtilis peptide chain release factor 2 PrfB SWALL:RF2_BACSU (SWALL:P28367) (366 aa) fasta scores: E(): 5.7e-50%2C 40.33%25 id in 362 aa;gbkey=CDS;gene=prfB;product=peptide chain release factor 2;protein_id=CAD67240.1;transl_table=11
BX072543.1	EMBL	sequence_feature	627273	627609	.	-	.	ID=id1159;Note=Peptidyl-tRNA hydrolase domain Score %3D 207.2 E-value %3D 1.8e-59;gbkey=misc_feature;gene=prfB
BX072543.1	EMBL	sequence_feature	627499	627549	.	-	.	ID=id1160;Note=PS00745 Prokaryotic-type class I peptide chain release factors signature.;gbkey=misc_feature;gene=prfB
BX072543.1	EMBL	sequence_feature	627699	628029	.	-	.	ID=id1161;Note=PCRF domain Score %3D 106.4 E-value %3D 3.8e-29;gbkey=misc_feature;gene=prfB
BX072543.1	EMBL	gene	628384	629523	.	+	.	ID=gene549;Name=TW575;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW575
BX072543.1	EMBL	CDS	628384	629523	.	+	0	ID=cds548;Parent=gene549;Dbxref=GOA:Q83NF3,InterPro:IPR011701,InterPro:IPR016196,InterPro:IPR020846,UniProtKB/TrEMBL:Q83NF3,NCBI_GP:CAD67241.1;Name=CAD67241.1;Note=Weakly similar to Listeria monocytogenes hypothetical protein Lmo1250 SWALL:Q8Y7M4 (EMBL:AL591978) (401 aa) fasta scores: E(): 4.4e-09%2C 21.61%25 id in 384 aa%2C and to Escherichia coli tetracycline resistance protein%2C class B TetA SWALL:TCR2_ECOLI (SWALL:P02980) (401 aa) fasta scores: E(): 1.3e-06%2C 21.82%25 id in 339 aa;gbkey=CDS;product=putative integral membrane transport protein;protein_id=CAD67241.1;transl_table=11
BX072543.1	EMBL	sequence_feature	628390	629494	.	+	.	ID=id1162;Note=Sugar (and other) transporter Score %3D -112.4 E-value %3D 0.00074;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	628444	628512	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	628540	628593	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	628612	628680	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	628723	628791	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	628810	628878	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	629146	629214	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	629233	629301	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	629419	629487	.	+	.	ID=id1163;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 53-70%2C 77-99%2C 114-136%2C 143-165%2C 255-277%2C 284-306 and 346-368;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	repeat_region	629540	634404	.	+	.	ID=id1164;Note=Non-coding degenerate repeat region in Repeat Cluster 2 (RC2).;gbkey=repeat_region
BX072543.1	EMBL	gene	634418	635638	.	-	.	ID=gene550;Name=pyrB;gbkey=Gene;gene=pyrB;gene_biotype=protein_coding;locus_tag=TW576
BX072543.1	EMBL	CDS	634418	635638	.	-	0	ID=cds549;Parent=gene550;Dbxref=GOA:Q83HI3,InterPro:IPR002082,InterPro:IPR006130,InterPro:IPR006131,InterPro:IPR006132,UniProtKB/TrEMBL:Q83HI3,NCBI_GP:CAD67242.1;Name=CAD67242.1;Note=Similar to Methanococcus jannaschii aspartate carbamoyltransferase PyrB or mj1581 SWALL:PYRB_METJA (SWALL:Q58976) (306 aa) fasta scores: E(): 2.6e-39%2C 43.59%25 id in 312 aa%2C and to Burkholderia cepacia aspartate transcarbamoylase PyrB SWALL:Q9F9H3 (EMBL:AF192346) (431 aa) fasta scores: E(): 2e-55%2C 42.1%25 id in 399 aa%2C and to C-terminal region of Mesocricetus auratus Cad protein [includes: glutamine-dependent carbamoyl-phosphate synthase Cad SWALL:PYR1_MESAU (SWALL:P08955) (2225 aa) fasta scores: E(): 4.8e-40%2C 40.38%25 id in 312 aa;gbkey=CDS;gene=pyrB;product=aspartate carbamoyltransferase;protein_id=CAD67242.1;transl_table=11
BX072543.1	EMBL	sequence_feature	634498	634963	.	-	.	ID=id1165;Note=Aspartate/ornithine carbamoyltransferase%2C Asp/Orn binding domain Score %3D 51.3 E-value %3D 1.5e-12;gbkey=misc_feature;gene=pyrB
BX072543.1	EMBL	sequence_feature	634984	635419	.	-	.	ID=id1166;Note=Aspartate/ornithine carbamoyltransferase%2C carbamoyl-P binding domain Score %3D 157.9 E-value %3D 1.2e-44;gbkey=misc_feature;gene=pyrB
BX072543.1	EMBL	sequence_feature	635261	635284	.	-	.	ID=id1167;Note=PS00097 Aspartate and ornithine carbamoyltransferases signature.;gbkey=misc_feature;gene=pyrB
BX072543.1	EMBL	repeat_region	635696	644284	.	+	.	ID=id1168;Note=Non-coding degenerate repeat region in Repeat Cluster 2 (RC2).;gbkey=repeat_region
BX072543.1	EMBL	gene	644368	644865	.	-	.	ID=gene551;Name=TW577;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW577
BX072543.1	EMBL	CDS	644368	644865	.	-	0	ID=cds550;Parent=gene551;Dbxref=UniProtKB/TrEMBL:Q83NF2,NCBI_GP:CAD67243.1;Name=CAD67243.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67243.1;transl_table=11
BX072543.1	EMBL	sequence_feature	644698	644766	.	-	.	ID=id1169;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 87-109;gbkey=misc_feature
BX072543.1	EMBL	gene	644981	645415	.	-	.	ID=gene552;Name=TW578;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW578
BX072543.1	EMBL	CDS	644981	645415	.	-	0	ID=cds551;Parent=gene552;Dbxref=InterPro:IPR012495,UniProtKB/TrEMBL:Q83NF1,NCBI_GP:CAD67244.1;Name=CAD67244.1;Note=No significant database matches;gbkey=CDS;product=putative membrane/secreted protein;protein_id=CAD67244.1;transl_table=11
BX072543.1	EMBL	sequence_feature	645260	645415	.	-	.	ID=id1170;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.699) with cleavage site probability 0.428 between residues 52 and 53;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	645287	645355	.	-	.	ID=id1171;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-43;gbkey=misc_feature
BX072543.1	EMBL	gene	645415	645834	.	-	.	ID=gene553;Name=TW579;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW579
BX072543.1	EMBL	CDS	645415	645834	.	-	0	ID=cds552;Parent=gene553;Dbxref=InterPro:IPR012495,UniProtKB/TrEMBL:Q83NF0,NCBI_GP:CAD67245.1;Name=CAD67245.1;Note=Weakly similar to Rhizobium loti hypothetical protein Mll7596 mll7596 SWALL:Q985N7 (EMBL:AP003012) (148 aa) fasta scores: E(): 0.017%2C 29.41%25 id in 119 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67245.1;transl_table=11
BX072543.1	EMBL	sequence_feature	645679	645747	.	-	.	ID=id1172;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 30-52;gbkey=misc_feature
BX072543.1	EMBL	gene	645831	646019	.	-	.	ID=gene554;Name=TW580;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW580
BX072543.1	EMBL	CDS	645831	646019	.	-	0	ID=cds553;Parent=gene554;Dbxref=UniProtKB/TrEMBL:Q83NE9,NCBI_GP:CAD67246.1;Name=CAD67246.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67246.1;transl_table=11
BX072543.1	EMBL	sequence_feature	645888	645956	.	-	.	ID=id1173;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 22-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	645897	646019	.	-	.	ID=id1174;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.819) with cleavage site probability 0.657 between residues 41 and 42;gbkey=misc_feature
BX072543.1	EMBL	gene	646082	646978	.	-	.	ID=gene555;Name=TW581;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW581
BX072543.1	EMBL	CDS	646082	646978	.	-	0	ID=cds554;Parent=gene555;Dbxref=InterPro:IPR018076,UniProtKB/TrEMBL:Q83NE8,NCBI_GP:CAD67247.1;Name=CAD67247.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67247.1;transl_table=11
BX072543.1	EMBL	sequence_feature	646898	646966	.	-	.	ID=id1175;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 97-119%2C 124-146 and 275-297;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	646622	646690	.	-	.	ID=id1175;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 97-119%2C 124-146 and 275-297;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	646541	646609	.	-	.	ID=id1175;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 97-119%2C 124-146 and 275-297;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	646088	646156	.	-	.	ID=id1175;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-27%2C 97-119%2C 124-146 and 275-297;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	646880	646978	.	-	.	ID=id1176;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.964) with cleavage site probability 0.381 between residues 33 and 34;gbkey=misc_feature
BX072543.1	EMBL	gene	646975	647859	.	-	.	ID=gene556;Name=TW582;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW582
BX072543.1	EMBL	CDS	646975	647859	.	-	0	ID=cds555;Parent=gene556;Dbxref=InterPro:IPR018076,UniProtKB/TrEMBL:Q83NE7,NCBI_GP:CAD67248.1;Name=CAD67248.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67248.1;transl_table=11
BX072543.1	EMBL	sequence_feature	647764	647832	.	-	.	ID=id1177;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 57-79%2C 83-105%2C 228-247 and 262-284;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	647623	647691	.	-	.	ID=id1177;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 57-79%2C 83-105%2C 228-247 and 262-284;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	647545	647613	.	-	.	ID=id1177;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 57-79%2C 83-105%2C 228-247 and 262-284;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	647119	647178	.	-	.	ID=id1177;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 57-79%2C 83-105%2C 228-247 and 262-284;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	647008	647076	.	-	.	ID=id1177;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 10-32%2C 57-79%2C 83-105%2C 228-247 and 262-284;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	sequence_feature	647764	647859	.	-	.	ID=id1178;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.997) with cleavage site probability 0.637 between residues 32 and 33;gbkey=misc_feature
BX072543.1	EMBL	gene	647813	649147	.	-	.	ID=gene557;Name=TW583;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW583
BX072543.1	EMBL	CDS	647813	649147	.	-	0	ID=cds556;Parent=gene557;Dbxref=GOA:Q83NE6,InterPro:IPR001482,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NE6,NCBI_GP:CAD67249.1;Name=CAD67249.1;Note=Similar to Pseudomonas aeruginosa probable type II secretion system protein Pa4302 SWALL:Q9HW98 (EMBL:AE004846) (421 aa) fasta scores: E(): 1.5e-39%2C 38.72%25 id in 346 aa%2C and to Actinobacillus actinomycetemcomitans tight adherance protein TadA SWALL:Q9XC06 (EMBL:AF152598) (426 aa) fasta scores: E(): 7.5e-36%2C 35.04%25 id in 371 aa;gbkey=CDS;product=TadA-like protein;protein_id=CAD67249.1;transl_table=11
BX072543.1	EMBL	sequence_feature	648040	648814	.	-	.	ID=id1179;Note=Type II/IV secretion system protein Score %3D -81.6 E-value %3D 1.9e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	648419	648442	.	-	.	ID=id1180;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	649604	655456	.	+	.	ID=id1181;Note=Non-coding degenerate repeat region in Repeat Cluster 2 (RC2).;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	649651	649852	.	+	.	ID=id1182;Note=repeated at 620439..620643 in TW570;gbkey=repeat_region
BX072543.1	EMBL	repeat_region	654444	654521	.	+	.	ID=id1183;Note=(tctgtgtccctga)6;gbkey=repeat_region
BX072543.1	EMBL	gene	655551	657386	.	+	.	ID=gene558;Name=TW584;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW584
BX072543.1	EMBL	CDS	655551	657386	.	+	0	ID=cds557;Parent=gene558;Dbxref=GOA:Q83NE5,InterPro:IPR001451,InterPro:IPR005882,InterPro:IPR011004,InterPro:IPR025877,InterPro:IPR029044,NCBI_GP:CAD67250.1;Name=CAD67250.1;Note=Similar to Mycobacterium tuberculosis GlmU or Rv1018c or mt1046 or mtcy10g2.31 SWALL:P96382 (EMBL:Z92539) (513 aa) fasta scores: E(): 1.9e-42%2C 33%25 id in 606 aa%2C and to Bacillus subtilis UDP-N-acetylglucosamine pyrophosphorylase GcaD or Tms or Tms-26 SWALL:GCAD_BACSU (SWALL:P14192) (456 aa) fasta scores: E(): 4e-35%2C 28.04%25 id in 592 aa%2C and to Escherichia coli bifunctional GlmU protein [includes: UDP-N-acetylglucosamine pyrophosphorylase GlmU or b3730 or z5228 or ecs4672 SWALL:GLMU_ECOLI (SWALL:P17114) (456 aa) fasta scores: E(): 1.3e-25%2C 27.48%25 id in 593 aa;gbkey=CDS;product=putative peptidoglycan synthesis protein;protein_id=CAD67250.1;transl_table=11
BX072543.1	EMBL	sequence_feature	656811	656862	.	+	.	ID=id1184;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 6.4 E-value %3D 7.9;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	656865	656916	.	+	.	ID=id1185;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 16.3 E-value %3D 0.052;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	656964	657015	.	+	.	ID=id1186;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 15.7 E-value %3D 0.076;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	657018	657069	.	+	.	ID=id1187;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 12.5 E-value %3D 0.71;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	657120	657171	.	+	.	ID=id1188;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 6.0 E-value %3D 8.9;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	657249	657300	.	+	.	ID=id1189;Note=Bacterial transferase hexapeptide (four repeats) Score %3D 9.4 E-value %3D 3.2;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	656350	656439	.	+	.	ID=id1190;Note=(ctaatcaggactgtgtga)5;gbkey=repeat_region
BX072543.1	EMBL	gene	657383	658429	.	+	.	ID=gene559;Name=prsA;gbkey=Gene;gene=prsA;gene_biotype=protein_coding;locus_tag=TW585
BX072543.1	EMBL	CDS	657383	658429	.	+	0	ID=cds558;Parent=gene559;Dbxref=GOA:Q83HI2,InterPro:IPR000842,InterPro:IPR005946,InterPro:IPR029057,InterPro:IPR029099,UniProtKB/TrEMBL:Q83HI2,NCBI_GP:CAD67251.1;Name=CAD67251.1;Note=Similar to Escherichia coli ribose-phosphate pyrophosphokinase PrsA or Prs or b1207 or z1978 or ecs1712 SWALL:KPRS_ECOLI (SWALL:P08330) (314 aa) fasta scores: E(): 1.4e-45%2C 44.9%25 id in 314 aa%2C and to Mycobacterium tuberculosis PrsA or Rv1017c or mtcy10g2.32 or mt1045 SWALL:P96383 (EMBL:Z92539) (326 aa) fasta scores: E(): 1.2e-60%2C 53.65%25 id in 315 aa;gbkey=CDS;gene=prsA;product=ribose-phosphate pyrophosphokinase;protein_id=CAD67251.1;transl_table=11
BX072543.1	EMBL	sequence_feature	657854	657901	.	+	.	ID=id1191;Note=PS00114 Phosphoribosyl pyrophosphate synthetase signature.;gbkey=misc_feature;gene=prsA
BX072543.1	EMBL	sequence_feature	657875	658286	.	+	.	ID=id1192;Note=Phosphoribosyl transferase domain Score %3D 99.4 E-value %3D 4.9e-27;gbkey=misc_feature;gene=prsA
BX072543.1	EMBL	sequence_feature	658118	658156	.	+	.	ID=id1193;Note=PS00103 Purine/pyrimidine phosphoribosyl transferases signature.;gbkey=misc_feature;gene=prsA
BX072543.1	EMBL	gene	658576	659718	.	+	.	ID=gene560;Name=ispG;gbkey=Gene;gene=ispG;gene_biotype=protein_coding;locus_tag=TW586
BX072543.1	EMBL	CDS	658576	659718	.	+	0	ID=cds559;Parent=gene560;Dbxref=GOA:Q83NE4,InterPro:IPR004588,InterPro:IPR011005,InterPro:IPR013785,InterPro:IPR016425,NCBI_GP:CAD67252.1;Name=CAD67252.1;Note=Similar to Escherichia coli 1-hydroxy-2-methyl-2-(e)-butenyl 4-diphosphate synthase IspG or GcpE or b2515 or z3778 or ecs3377 SWALL:ISPG_ECOLI (SWALL:P27433) (372 aa) fasta scores: E(): 1.8e-53%2C 44.28%25 id in 341 aa%2C and to Streptomyces coelicolor 1-hydroxy-2-methyl-2-(e)-butenyl 4-diphosphate synthase 2 IspG2 or GcpE2 or SCO5696 or SC5H4.20 SWALL:ISG2_STRCO (SWALL:Q9KYR9) (385 aa) fasta scores: E(): 2e-103%2C 71.65%25 id in 381 aa;gbkey=CDS;gene=ispG;product=1-hydroxy-2-methyl-2-(e)-butenyl 4-diphosphate synthase;protein_id=CAD67252.1;transl_table=11
BX072543.1	EMBL	sequence_feature	658624	659686	.	+	.	ID=id1194;Note=GcpE protein Score %3D 694.6 E-value %3D 3.3e-206;gbkey=misc_feature;gene=ispG
BX072543.1	EMBL	gene	659799	660323	.	-	.	ID=gene561;Name=TW587;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW587
BX072543.1	EMBL	CDS	659799	660323	.	-	0	ID=cds560;Parent=gene561;Dbxref=UniProtKB/TrEMBL:Q83NE3,NCBI_GP:CAD67253.1;Name=CAD67253.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67253.1;transl_table=11
BX072543.1	EMBL	sequence_feature	660210	660278	.	-	.	ID=id1195;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 102-124 and 201-223;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	660114	660182	.	-	.	ID=id1195;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 102-124 and 201-223;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	659817	659885	.	-	.	ID=id1195;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 70-92%2C 102-124 and 201-223;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	repeat_region	660272	660280	.	+	.	ID=id1196;Note=(c)9;gbkey=repeat_region
BX072543.1	EMBL	gene	660811	662616	.	+	.	ID=gene562;Name=proS;gbkey=Gene;gene=proS;gene_biotype=protein_coding;locus_tag=TW588
BX072543.1	EMBL	CDS	660811	662616	.	+	0	ID=cds561;Parent=gene562;Dbxref=GOA:Q83HI1,InterPro:IPR002314,InterPro:IPR002316,InterPro:IPR004154,InterPro:IPR004500,InterPro:IPR006195,InterPro:IPR007214,InterPro:IPR023717,NCBI_GP:CAD67254.1;Name=CAD67254.1;Note=Similar to Escherichia coli prolyl-tRNA synthetase ProS or DrpA or b0194 SWALL:SYP_ECOLI (SWALL:P16659) (572 aa) fasta scores: E(): 2.9e-38%2C 37%25 id in 600 aa%2C and to Mycobacterium tuberculosis prolyl-tRNA synthetase ProS or Rv2845c or mt2911 or mtcy24a1.12 SWALL:SYP_MYCTU (SWALL:O05814) (582 aa) fasta scores: E(): 2.1e-55%2C 45.81%25 id in 598 aa;gbkey=CDS;gene=proS;product=prolyl-tRNA synthetase;protein_id=CAD67254.1;transl_table=11
BX072543.1	EMBL	sequence_feature	660928	661390	.	+	.	ID=id1197;Note=tRNA synthetase class II core domain (G%2C H%2C P%2C S and T) Score %3D 164.3 E-value %3D 1.5e-46;gbkey=misc_feature;gene=proS
BX072543.1	EMBL	sequence_feature	661231	661293	.	+	.	ID=id1198;Note=PS00179 Aminoacyl-transfer RNA synthetases class-II signature 1.;gbkey=misc_feature;gene=proS
BX072543.1	EMBL	sequence_feature	662287	662560	.	+	.	ID=id1199;Note=Anticodon binding domain Score %3D 56.8 E-value %3D 3.3e-14;gbkey=misc_feature;gene=proS
BX072543.1	EMBL	gene	662858	666604	.	-	.	ID=gene563;Name=mfd;gbkey=Gene;gene=mfd;gene_biotype=protein_coding;locus_tag=TW589
BX072543.1	EMBL	CDS	662858	666604	.	-	0	ID=cds562;Parent=gene563;Dbxref=GOA:Q83NE2,InterPro:IPR001650,InterPro:IPR003711,InterPro:IPR004576,InterPro:IPR005118,InterPro:IPR011545,InterPro:IPR014001,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NE2,NCBI_GP:CAD67255.1;Name=CAD67255.1;Note=Similar to Escherichia coli transcription-repair coupling factor Mfd or b1114 SWALL:MFD_ECOLI (SWALL:P30958) (1148 aa) fasta scores: E(): 1.1e-100%2C 32.02%25 id in 1168 aa%2C and to Streptomyces coelicolor putative transcriptional-repair coupling factor SCO3109 or SCE41.18c SWALL:Q9F2P1 (EMBL:AL442120) (1184 aa) fasta scores: E(): 3.8e-136%2C 39.79%25 id in 1161 aa;gbkey=CDS;gene=mfd;product=transcription-repair coupling factor;protein_id=CAD67255.1;transl_table=11
BX072543.1	EMBL	sequence_feature	662974	663316	.	-	.	ID=id1200;Note=TRCF domain Score %3D 65.4 E-value %3D 8.7e-17;gbkey=misc_feature;gene=mfd
BX072543.1	EMBL	sequence_feature	663586	663802	.	-	.	ID=id1201;Note=Helicase conserved C-terminal domain Score %3D 52.3 E-value %3D 7.3e-13;gbkey=misc_feature;gene=mfd
BX072543.1	EMBL	sequence_feature	663946	664531	.	-	.	ID=id1202;Note=DEAD/DEAH box helicase Score %3D 123.9 E-value %3D 2.1e-34;gbkey=misc_feature;gene=mfd
BX072543.1	EMBL	sequence_feature	664400	664423	.	-	.	ID=id1203;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=mfd
BX072543.1	EMBL	gene	667703	669169	.	-	.	ID=gene564;Name=TW590;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW590
BX072543.1	EMBL	CDS	667703	669169	.	-	0	ID=cds563;Parent=gene564;Dbxref=GOA:Q83NE1,InterPro:IPR002528,UniProtKB/TrEMBL:Q83NE1,NCBI_GP:CAD67256.1;Name=CAD67256.1;Note=Weakly similar to other putative membrane proteins eg. Vibrio cholerae hypothetical protein Vc2671 SWALL:Q9KNR0 (EMBL:AE004332) (460 aa) fasta scores: E(): 8.7e-09%2C 23.44%25 id in 482 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67256.1;transl_table=11
BX072543.1	EMBL	sequence_feature	669068	669136	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	668957	669025	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	668828	668896	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	668717	668785	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	668630	668698	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	668552	668620	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	668252	668320	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	668141	668209	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	668012	668080	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	667916	667984	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	667814	667882	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	667742	667801	.	-	.	ID=id1204;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 49-71%2C 92-114%2C 129-151%2C 158-180%2C 184-206%2C 284-306%2C 321-343%2C 364-386%2C 396-418%2C 430-452 and 457-476;gbkey=misc_feature;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	sequence_feature	668653	669130	.	-	.	ID=id1205;Note=Uncharacterized membrane protein family UPF0013 Score %3D 39.7 E-value %3D 4.7e-09;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	669065	669169	.	-	.	ID=id1206;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.971) with cleavage site probability 0.526 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	gene	669363	670142	.	-	.	ID=gene565;Name=TW591;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW591
BX072543.1	EMBL	CDS	669363	670142	.	-	0	ID=cds564;Parent=gene565;Dbxref=GOA:Q83NE0,InterPro:IPR000412,InterPro:IPR013525,UniProtKB/TrEMBL:Q83NE0,NCBI_GP:CAD67257.1;Name=CAD67257.1;Note=Weakly similar to other putative membrane proteins eg. Archaeoglobus fulgidus daunorubicin resistance membrane protein af1883 SWALL:O28396 (EMBL:AE000972) (251 aa) fasta scores: E(): 0.0039%2C 24.51%25 id in 257 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67257.1;transl_table=11
BX072543.1	EMBL	sequence_feature	670002	670061	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	669906	669974	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	669750	669818	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	669654	669722	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	669549	669617	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	669408	669476	.	-	.	ID=id1207;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 28-47%2C 57-79%2C 109-131%2C 141-163%2C 176-198 and 223-245;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	gene	670145	671137	.	-	.	ID=gene566;Name=TW592;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW592
BX072543.1	EMBL	CDS	670145	671137	.	-	0	ID=cds565;Parent=gene566;Dbxref=GOA:Q83HI0,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HI0,NCBI_GP:CAD67258.1;Name=CAD67258.1;Note=Similar to many putative ABC transporter ATP-binding proteins eg. Caulobacter crescentus ABC transporter%2C ATP-binding protein cc1147 SWALL:Q9A947 (EMBL:AE005793) (328 aa) fasta scores: E(): 4.3e-20%2C 32.18%25 id in 289 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD67258.1;transl_table=11
BX072543.1	EMBL	sequence_feature	670417	670942	.	-	.	ID=id1208;Note=ABC transporter Score %3D 157.0 E-value %3D 2.2e-44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	670898	670921	.	-	.	ID=id1209;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	671258	671836	.	-	.	ID=gene567;Name=TW593;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW593
BX072543.1	EMBL	CDS	671258	671836	.	-	0	ID=cds566;Parent=gene567;Dbxref=UniProtKB/TrEMBL:Q83ND9,NCBI_GP:CAD67259.1;Name=CAD67259.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD67259.1;transl_table=11
BX072543.1	EMBL	sequence_feature	671768	671836	.	-	.	ID=id1210;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.895 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	gene	671969	672631	.	-	.	ID=gene568;Name=TW594;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW594
BX072543.1	EMBL	CDS	671969	672631	.	-	0	ID=cds567;Parent=gene568;Dbxref=GOA:Q83HH9,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HH9,NCBI_GP:CAD67260.1;Name=CAD67260.1;Note=Similar to Fusobacterium nucleatum ABC transporter ATP-binding protein Fn1352 SWALL:Q8RDY9 (EMBL:AE010640) (224 aa) fasta scores: E(): 7.7e-18%2C 35.61%25 id in 219 aa%2C and to Escherichia coli cell division ATP-binding protein FtsE or b3463 or z4837 or ecs4312 SWALL:FTSE_ECOLI (SWALL:P10115) (222 aa) fasta scores: E(): 8.4e-15%2C 32.86%25 id in 216 aa;gbkey=CDS;product=ABC transporter ATP-binding protein;protein_id=CAD67260.1;transl_table=11
BX072543.1	EMBL	sequence_feature	671995	672523	.	-	.	ID=id1211;Note=ABC transporter Score %3D 144.0 E-value %3D 1.9e-40;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	672173	672217	.	-	.	ID=id1212;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	672479	672502	.	-	.	ID=id1213;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	672632	673525	.	-	.	ID=gene569;Name=TW595;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW595
BX072543.1	EMBL	CDS	672632	673525	.	-	0	ID=cds568;Parent=gene569;Dbxref=UniProtKB/TrEMBL:Q83ND8,NCBI_GP:CAD67261.1;Name=CAD67261.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67261.1;transl_table=11
BX072543.1	EMBL	sequence_feature	673400	673525	.	-	.	ID=id1214;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.703 between residues 42 and 43;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	673421	673489	.	-	.	ID=id1215;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-35;gbkey=misc_feature
BX072543.1	EMBL	gene	673535	674707	.	-	.	ID=gene570;Name=TW596;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW596
BX072543.1	EMBL	CDS	673535	674707	.	-	0	ID=cds569;Parent=gene570;Dbxref=GOA:Q83ND7,InterPro:IPR003838,UniProtKB/TrEMBL:Q83ND7,NCBI_GP:CAD67262.1;Name=CAD67262.1;Note=Similar to Pseudomonas aeruginosa hypothetical protein Pa2988 SWALL:Q9HZL6 (EMBL:AE004724) (416 aa) fasta scores: E(): 0.00022%2C 24.59%25 id in 374 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67262.1;transl_table=11
BX072543.1	EMBL	sequence_feature	673558	673957	.	-	.	ID=id1216;Note=Predicted permease Score %3D 23.8 E-value %3D 0.00014;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	673862	673930	.	-	.	ID=id1217;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 246-268%2C 288-322 and 337-359;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	673700	673804	.	-	.	ID=id1217;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 246-268%2C 288-322 and 337-359;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	673589	673657	.	-	.	ID=id1217;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 246-268%2C 288-322 and 337-359;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	674949	675440	.	+	.	ID=gene571;Name=TW597;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW597
BX072543.1	EMBL	CDS	674949	675440	.	+	0	ID=cds570;Parent=gene571;Dbxref=UniProtKB/TrEMBL:Q83ND6,NCBI_GP:CAD67263.1;Name=CAD67263.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67263.1;transl_table=11
BX072543.1	EMBL	sequence_feature	674949	675068	.	+	.	ID=id1218;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.970) with cleavage site probability 0.956 between residues 40 and 41;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	675009	675077	.	+	.	ID=id1219;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 91-108 and 129-151;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	675219	675272	.	+	.	ID=id1219;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 91-108 and 129-151;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	675333	675401	.	+	.	ID=id1219;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 91-108 and 129-151;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	675726	675839	.	+	.	ID=gene572;Name=TW598;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW598
BX072543.1	EMBL	CDS	675726	675839	.	+	0	ID=cds571;Parent=gene572;Dbxref=UniProtKB/TrEMBL:Q83HH8,NCBI_GP:CAD67264.1;Name=CAD67264.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67264.1;transl_table=11
BX072543.1	EMBL	gene	675851	675955	.	+	.	ID=gene573;Name=TW599;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW599
BX072543.1	EMBL	CDS	675851	675955	.	+	0	ID=cds572;Parent=gene573;Dbxref=UniProtKB/TrEMBL:Q83HH7,NCBI_GP:CAD67265.1;Name=CAD67265.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67265.1;transl_table=11
BX072543.1	EMBL	gene	676009	676287	.	+	.	ID=gene574;Name=TW600;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW600
BX072543.1	EMBL	CDS	676009	676287	.	+	0	ID=cds573;Parent=gene574;Dbxref=UniProtKB/TrEMBL:Q83HH6,NCBI_GP:CAD67266.1;Name=CAD67266.1;Note=Doubtful CDS. No significant database matches. Contains variable length tandem repeat.;gbkey=CDS;product=hypothetical protein;protein_id=CAD67266.1;transl_table=11
BX072543.1	EMBL	sequence_alteration	676117	676179	.	+	.	ID=id1220;Note=Variation in tandem repeat: 7%2C 6 or 5 copies of (ctagaacta);gbkey=variation
BX072543.1	EMBL	repeat_region	676457	676466	.	+	.	ID=id1221;Note=(c)10;gbkey=repeat_region
BX072543.1	EMBL	gene	676717	676836	.	-	.	ID=gene575;Name=5S_rRNA;gbkey=Gene;gene=5S_rRNA;gene_biotype=rRNA
BX072543.1	EMBL	rRNA	676717	676836	.	-	.	ID=rna33;Parent=gene575;gbkey=rRNA;gene=5S_rRNA;product=5S ribosomal RNA
BX072543.1	EMBL	exon	676717	676836	.	-	.	ID=id1222;Parent=rna33;gbkey=rRNA;gene=5S_rRNA;product=5S ribosomal RNA
BX072543.1	EMBL	gene	676889	679989	.	-	.	ID=gene576;Name=23S_rRNA;gbkey=Gene;gene=23S_rRNA;gene_biotype=rRNA
BX072543.1	EMBL	rRNA	676889	679989	.	-	.	ID=rna34;Parent=gene576;gbkey=rRNA;gene=23S_rRNA;product=23S ribosomal RNA
BX072543.1	EMBL	exon	676889	679989	.	-	.	ID=id1223;Parent=rna34;gbkey=rRNA;gene=23S_rRNA;product=23S ribosomal RNA
BX072543.1	EMBL	gene	680284	681809	.	-	.	ID=gene577;Name=16S_rRNA;gbkey=Gene;gene=16S_rRNA;gene_biotype=rRNA
BX072543.1	EMBL	rRNA	680284	681809	.	-	.	ID=rna35;Parent=gene577;gbkey=rRNA;gene=16S_rRNA;product=16S ribosomal RNA
BX072543.1	EMBL	exon	680284	681809	.	-	.	ID=id1224;Parent=rna35;gbkey=rRNA;gene=16S_rRNA;product=16S ribosomal RNA
BX072543.1	EMBL	repeat_region	682236	682277	.	+	.	ID=id1225;Note=(ttactcagtatcag)3;gbkey=repeat_region
BX072543.1	EMBL	gene	682344	683117	.	-	.	ID=gene578;Name=TW602;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW602
BX072543.1	EMBL	CDS	682344	683117	.	-	0	ID=cds574;Parent=gene578;Dbxref=UniProtKB/TrEMBL:Q83ND5,NCBI_GP:CAD67267.1;Name=CAD67267.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67267.1;transl_table=11
BX072543.1	EMBL	gene	683275	684690	.	-	.	ID=gene579;Name=tyrS;gbkey=Gene;gene=tyrS;gene_biotype=protein_coding;locus_tag=TW603
BX072543.1	EMBL	CDS	683275	684690	.	-	0	ID=cds575;Parent=gene579;Dbxref=GOA:Q83HH5,InterPro:IPR001412,InterPro:IPR002305,InterPro:IPR002307,InterPro:IPR002942,InterPro:IPR014729,InterPro:IPR024088,InterPro:IPR024107,NCBI_GP:CAD67268.1;Name=CAD67268.1;Note=Similar to Escherichia coli tyrosyl-tRNA synthetase TyrS or b1637 or z2650 or ecs2346 SWALL:SYY_ECOLI (SWALL:P00951) (423 aa) fasta scores: E(): 6.5e-61%2C 48.43%25 id in 351 aa%2C and to Streptomyces coelicolor tyrosyl-tRNA synthetase TyrS or SCO1818 or SCI8.03 SWALL:Q9RJ50 (EMBL:AL132644) (422 aa) fasta scores: E(): 1.2e-78%2C 49.35%25 id in 464 aa;gbkey=CDS;gene=tyrS;product=tyrosyl-tRNA synthetase;protein_id=CAD67268.1;transl_table=11
BX072543.1	EMBL	sequence_feature	683343	683484	.	-	.	ID=id1226;Note=S4 domain Score %3D 20.1 E-value %3D 0.003;gbkey=misc_feature;gene=tyrS
BX072543.1	EMBL	sequence_feature	683703	684588	.	-	.	ID=id1227;Note=tRNA synthetases class I (W and Y) Score %3D 318.2 E-value %3D 6.8e-93;gbkey=misc_feature;gene=tyrS
BX072543.1	EMBL	sequence_feature	684523	684555	.	-	.	ID=id1228;Note=PS00178 Aminoacyl-transfer RNA synthetases class-I signature.;gbkey=misc_feature;gene=tyrS
BX072543.1	EMBL	gene	684889	687774	.	-	.	ID=gene580;Name=pheT;gbkey=Gene;gene=pheT;gene_biotype=protein_coding;locus_tag=TW604
BX072543.1	EMBL	CDS	684889	687774	.	-	0	ID=cds576;Parent=gene580;Dbxref=GOA:Q83HH4,InterPro:IPR002547,InterPro:IPR004532,InterPro:IPR005121,InterPro:IPR005146,InterPro:IPR005147,InterPro:IPR009061,InterPro:IPR012340,InterPro:IPR020825,NCBI_GP:CAD67269.1;Name=CAD67269.1;Note=Similar to Escherichia coli phenylalanyl-tRNA synthetase beta chain PheT or b1713 SWALL:SYFB_ECOLI (SWALL:P07395) (795 aa) fasta scores: E(): 2.6e-45%2C 28.75%25 id in 845 aa%2C and to Mycobacterium tuberculosis phenylalanyl-tRNA synthetase beta chain PheT or Rv1650 or mt1688 or mtcy06h11.15 SWALL:SYFB_MYCTU (SWALL:P94985) (831 aa) fasta scores: E(): 1.1e-50%2C 32.78%25 id in 976 aa;gbkey=CDS;gene=pheT;product=phenylalanyl-tRNA synthetase beta chain;protein_id=CAD67269.1;transl_table=11
BX072543.1	EMBL	sequence_feature	684897	685170	.	-	.	ID=id1229;Note=Ferredoxin-fold anticodon binding domain Score %3D 80.6 E-value %3D 2.3e-21;gbkey=misc_feature;gene=pheT
BX072543.1	EMBL	sequence_feature	686178	686403	.	-	.	ID=id1230;Note=tRNA synthetase B5 domain Score %3D 46.7 E-value %3D 3.7e-11;gbkey=misc_feature;gene=pheT
BX072543.1	EMBL	sequence_feature	686721	687144	.	-	.	ID=id1231;Note=B3/4 domain Score %3D 133.1 E-value %3D 3.7e-37;gbkey=misc_feature;gene=pheT
BX072543.1	EMBL	sequence_feature	687180	687576	.	-	.	ID=id1232;Note=Putative tRNA binding domain Score %3D -4.7 E-value %3D 0.0016;gbkey=misc_feature;gene=pheT
BX072543.1	EMBL	gene	687857	688867	.	-	.	ID=gene581;Name=pheS;gbkey=Gene;gene=pheS;gene_biotype=protein_coding;locus_tag=TW605
BX072543.1	EMBL	CDS	687857	688867	.	-	0	ID=cds577;Parent=gene581;Dbxref=GOA:Q83HH3,InterPro:IPR002319,InterPro:IPR004188,InterPro:IPR004529,InterPro:IPR006195,InterPro:IPR010978,InterPro:IPR022911,NCBI_GP:CAD67270.1;Name=CAD67270.1;Note=Similar to Escherichia coli phenylalanyl-tRNA synthetase alpha chain PheS or b1714 SWALL:SYFA_ECOLI (SWALL:P08312) (327 aa) fasta scores: E(): 5.7e-45%2C 38.88%25 id in 324 aa%2C and to Mycobacterium tuberculosis phenylalanyl-tRNA synthetase alpha chain PheS or Rv1649 or mt1687 or mtcy06h11.14 SWALL:SYFA_MYCTU (SWALL:P94984) (341 aa) fasta scores: E(): 4.3e-60%2C 47.54%25 id in 326 aa;gbkey=CDS;gene=pheS;product=phenylalanyl-tRNA synthetase alpha chain;protein_id=CAD67270.1;transl_table=11
BX072543.1	EMBL	sequence_feature	687910	688537	.	-	.	ID=id1233;Note=tRNA synthetases class II core domain (F) Score %3D 307.7 E-value %3D 9.7e-90;gbkey=misc_feature;gene=pheS
BX072543.1	EMBL	sequence_feature	688217	688270	.	-	.	ID=id1234;Note=PS00179 Aminoacyl-transfer RNA synthetases class-II signature 1.;gbkey=misc_feature;gene=pheS
BX072543.1	EMBL	sequence_feature	688597	688825	.	-	.	ID=id1235;Note=Aminoacyl tRNA synthetase class II%2C N-terminal domain Score %3D 33.7 E-value %3D 2.9e-07;gbkey=misc_feature;gene=pheS
BX072543.1	EMBL	gene	689251	689661	.	-	.	ID=gene582;Name=rplT;gbkey=Gene;gene=rplT;gene_biotype=protein_coding;locus_tag=TW606
BX072543.1	EMBL	CDS	689251	689661	.	-	0	ID=cds578;Parent=gene582;Dbxref=GOA:Q83HH2,InterPro:IPR005813,NCBI_GP:CAD67271.1;Name=CAD67271.1;Note=Similar to Escherichia coli 50s ribosomal protein L20 RplT or PdzA or b1716 or z2745 or ecs2423 or stm1336 or sty1775 SWALL:RL20_ECOLI (SWALL:P02421) (117 aa) fasta scores: E(): 2.7e-20%2C 53.91%25 id in 115 aa;gbkey=CDS;gene=rplT;product=50s ribosomal protein L20;protein_id=CAD67271.1;transl_table=11
BX072543.1	EMBL	sequence_feature	689337	689658	.	-	.	ID=id1236;Note=Ribosomal protein L20 Score %3D 159.2 E-value %3D 5e-45;gbkey=misc_feature;gene=rplT
BX072543.1	EMBL	gene	689691	689888	.	-	.	ID=gene583;Name=rpmI;gbkey=Gene;gene=rpmI;gene_biotype=protein_coding;locus_tag=TW607
BX072543.1	EMBL	CDS	689691	689888	.	-	0	ID=cds579;Parent=gene583;Dbxref=GOA:Q83HH1,InterPro:IPR001706,InterPro:IPR018265,InterPro:IPR021137,NCBI_GP:CAD67272.1;Name=CAD67272.1;Note=Similar to Escherichia coli 50s ribosomal protein L35 RpmI or b1717 or z2746 or ecs2424 or stm1335 or sty1776 SWALL:RL35_ECOLI (SWALL:P07085) (64 aa) fasta scores: E(): 0.0013%2C 39.62%25 id in 53 aa%2C and to Streptomyces coelicolor 50s ribosomal protein L35 RpmI or SCO1599 or SCI35.21c SWALL:RL35_STRCO (SWALL:O88059) (64 aa) fasta scores: E(): 9.6e-14%2C 62.5%25 id in 64 aa;gbkey=CDS;gene=rpmI;product=50s ribosomal protein L35;protein_id=CAD67272.1;transl_table=11
BX072543.1	EMBL	sequence_feature	689702	689873	.	-	.	ID=id1237;Note=Ribosomal protein L35 Score %3D 47.1 E-value %3D 2.8e-11;gbkey=misc_feature;gene=rpmI
BX072543.1	EMBL	gene	689959	690507	.	-	.	ID=gene584;Name=infC;gbkey=Gene;gene=infC;gene_biotype=protein_coding;locus_tag=TW608
BX072543.1	EMBL	CDS	689959	690507	.	-	0	ID=cds580;Parent=gene584;Dbxref=GOA:Q83HH0,InterPro:IPR001288,InterPro:IPR019813,InterPro:IPR019814,InterPro:IPR019815,NCBI_GP:CAD67273.1;Name=CAD67273.1;Note=Similar to Escherichia coli translation initiation factor IF-3 InfC or Fit or b1718 or z2747 or ecs2425 SWALL:IF3_ECOLI (SWALL:P02999) (180 aa) fasta scores: E(): 1.2e-23%2C 44.84%25 id in 165 aa;gbkey=CDS;gene=infC;product=translation initiation factor IF-3;protein_id=CAD67273.1;transl_table=11
BX072543.1	EMBL	sequence_feature	690021	690507	.	-	.	ID=id1238;Note=Translation initiation factor IF-3 Score %3D 262.4 E-value %3D 4.2e-76;gbkey=misc_feature;gene=infC
BX072543.1	EMBL	sequence_feature	690313	690354	.	-	.	ID=id1239;Note=PS00938 Initiation factor 3 signature.;gbkey=misc_feature;gene=infC
BX072543.1	EMBL	gene	691441	693909	.	-	.	ID=gene585;Name=metT;gbkey=Gene;gene=metT;gene_biotype=protein_coding;locus_tag=TW610
BX072543.1	EMBL	CDS	691441	693909	.	-	0	ID=cds581;Parent=gene585;Dbxref=GOA:Q83HG9,InterPro:IPR002629,InterPro:IPR013215,UniProtKB/TrEMBL:Q83HG9,NCBI_GP:CAD67274.1;Name=CAD67274.1;Note=Similar to Arabidopsis thaliana 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase CimS or at5g17920 or mpi7.9 SWALL:METE_ARATH (SWALL:O50008) (765 aa) fasta scores: E(): 3.5e-41%2C 35.44%25 id in 680 aa%2C and to Thermotoga maritima 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase MetE or tm1286 SWALL:METE_THEMA (SWALL:Q9X112) (734 aa) fasta scores: E(): 1.5e-48%2C 33.65%25 id in 731 aa;gbkey=CDS;gene=metT;product=putative methionine synthase;protein_id=CAD67274.1;transl_table=11
BX072543.1	EMBL	sequence_feature	691800	692616	.	-	.	ID=id1240;Note=Methionine synthase%2C vitamin-B12 independent Score %3D 26.1 E-value %3D 1.1e-14;gbkey=misc_feature;gene=metT
BX072543.1	EMBL	gene	694598	694954	.	-	.	ID=gene586;Name=TW611;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW611
BX072543.1	EMBL	CDS	694598	694954	.	-	0	ID=cds582;Parent=gene586;Dbxref=UniProtKB/TrEMBL:Q83ND4,NCBI_GP:CAD67275.1;Name=CAD67275.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67275.1;transl_table=11
BX072543.1	EMBL	sequence_feature	694877	694945	.	-	.	ID=id1241;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 33-55%2C 70-89 and 94-116;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	694790	694858	.	-	.	ID=id1241;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 33-55%2C 70-89 and 94-116;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	694688	694747	.	-	.	ID=id1241;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 33-55%2C 70-89 and 94-116;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	694607	694675	.	-	.	ID=id1241;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 33-55%2C 70-89 and 94-116;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	694956	697502	.	-	.	ID=gene587;Name=TW612;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW612
BX072543.1	EMBL	CDS	694956	697502	.	-	0	ID=cds583;Parent=gene587;Dbxref=InterPro:IPR029044,UniProtKB/TrEMBL:Q83HG8,NCBI_GP:CAD67276.1;Name=CAD67276.1;Note=Similar to Clostridium acetobutylicum glycosyltransferase domain containing protein Cac2327 SWALL:Q97GN9 (EMBL:AE007733) (1044 aa) fasta scores: E(): 2.9e-67%2C 33.03%25 id in 666 aa C-terminal region similar to Clostridium acetobutylicum diverged glycosyltransferase domain containing protein Cac2326 SWALL:Q97GP0 (EMBL:AE007733) (436 aa) fasta scores: E(): 1.6e-59%2C 37.91%25 id in 451 aa. N-terminal region contains match to Pfam entry PF00534 Glycosyl transferases group 1 and is similar to Porphyromonas gingivalis orf1%2C orf2 and orf3 genes SWALL:P72199 (EMBL:U60208) (322 aa) fasta scores: E(): 0.36%2C 24.01%25 id in 279 aa;gbkey=CDS;product=conserved hypothetical protein containing putative glycosyltransferase domain;protein_id=CAD67276.1;transl_table=11
BX072543.1	EMBL	sequence_feature	695183	695363	.	-	.	ID=id1242;Note=Glycosyl transferases group 1 Score %3D 26.8 E-value %3D 2.4e-07;gbkey=misc_feature
BX072543.1	EMBL	gene	697504	698094	.	-	.	ID=gene588;Name=rbfA;gbkey=Gene;gene=rbfA;gene_biotype=protein_coding;locus_tag=TW613
BX072543.1	EMBL	CDS	697504	698094	.	-	0	ID=cds584;Parent=gene588;Dbxref=GOA:Q83ND3,InterPro:IPR000238,InterPro:IPR015946,InterPro:IPR023799,NCBI_GP:CAD67277.1;Name=CAD67277.1;Note=Similar to Escherichia coli ribosome-binding factor A RbfA or p15b or b3167 or z4528 or ecs4048 SWALL:RBFA_ECOLI (SWALL:P09170) (132 aa) fasta scores: E(): 0.0053%2C 27.82%25 id in 115 aa%2C and to Corynebacterium glutamicum ribosome-binding factor A cgl1984 SWALL:BAB99377 (EMBL:AP005280) (149 aa) fasta scores: E(): 1.2e-10%2C 38.25%25 id in 149 aa%2C and to Streptococcus agalactiae ribosome binding factor A RbfA SWALL:Q9ZF19 (EMBL:AJ003164) (122 aa) fasta scores: E(): 0.0027%2C 31.57%25 id in 114 aa;gbkey=CDS;gene=rbfA;product=ribosome-binding factor A;protein_id=CAD67277.1;transl_table=11
BX072543.1	EMBL	sequence_feature	697752	698055	.	-	.	ID=id1243;Note=Ribosome-binding factor A Score %3D 86.1 E-value %3D 4.9e-23;gbkey=misc_feature;gene=rbfA
BX072543.1	EMBL	gene	698201	700612	.	-	.	ID=gene589;Name=infB;gbkey=Gene;gene=infB;gene_biotype=protein_coding;locus_tag=TW614
BX072543.1	EMBL	CDS	698201	700612	.	-	0	ID=cds585;Parent=gene589;Dbxref=GOA:Q83HG7,InterPro:IPR000178,InterPro:IPR000795,InterPro:IPR004161,InterPro:IPR005225,InterPro:IPR006847,InterPro:IPR009000,InterPro:IPR015760,InterPro:IPR023115,InterPro:IPR027417,NCBI_GP:CAD67278.1;Name=CAD67278.1;Note=Similar to Bacillus stearothermophilus translation initiation factor IF-2 InfB SWALL:IF2_BACST (SWALL:P04766) (741 aa) fasta scores: E(): 1.5e-79%2C 44.84%25 id in 796 aa;gbkey=CDS;gene=infB;product=translation initiation factor IF-2;protein_id=CAD67278.1;transl_table=11
BX072543.1	EMBL	sequence_feature	698236	698467	.	-	.	ID=id1244;Note=Elongation factor Tu domain 2 Score %3D 31.3 E-value %3D 1.5e-06;gbkey=misc_feature;gene=infB
BX072543.1	EMBL	sequence_feature	698953	699178	.	-	.	ID=id1245;Note=Elongation factor Tu domain 2 Score %3D 56.0 E-value %3D 5.9e-14;gbkey=misc_feature;gene=infB
BX072543.1	EMBL	sequence_feature	699214	699715	.	-	.	ID=id1246;Note=Elongation factor Tu GTP binding domain Score %3D 170.3 E-value %3D 2.3e-48;gbkey=misc_feature;gene=infB
BX072543.1	EMBL	sequence_feature	699665	699688	.	-	.	ID=id1247;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=infB
BX072543.1	EMBL	gene	700744	701703	.	-	.	ID=gene590;Name=nusA;gbkey=Gene;gene=nusA;gene_biotype=protein_coding;locus_tag=TW615
BX072543.1	EMBL	CDS	700744	701703	.	-	0	ID=cds586;Parent=gene590;Dbxref=GOA:Q83ND2,InterPro:IPR004087,InterPro:IPR004088,InterPro:IPR009019,InterPro:IPR010213,InterPro:IPR012340,InterPro:IPR013735,InterPro:IPR015946,InterPro:IPR022967,InterPro:IPR025249,InterPro:IPR028620,UniProtKB/TrEMBL:Q83ND2,NCBI_GP:CAD67279.1;Name=CAD67279.1;Note=Similar to Escherichia coli N utilization substance protein A NusA or b3169 or z4530 or ecs4050 SWALL:NUSA_ECOLI (SWALL:P03003) (495 aa) fasta scores: E(): 5.1e-25%2C 29.24%25 id in 342 aa%2C and to Thermus thermophilus N utilization substance protein A homolog NusA SWALL:NUSA_THETH (SWALL:P48514) (387 aa) fasta scores: E(): 2.4e-31%2C 39.2%25 id in 278 aa;gbkey=CDS;gene=nusA;product=N utilization transcriptional termination/antitermination factor;protein_id=CAD67279.1;transl_table=11
BX072543.1	EMBL	sequence_feature	700749	700857	.	-	.	ID=id1248;Note=KH domain Score %3D 10.5 E-value %3D 0.017;gbkey=misc_feature;gene=nusA
BX072543.1	EMBL	gene	702163	702450	.	-	.	ID=gene591;Name=TW616;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW616
BX072543.1	EMBL	CDS	702163	702450	.	-	0	ID=cds587;Parent=gene591;Dbxref=UniProtKB/TrEMBL:Q83HG6,NCBI_GP:CAD67280.1;Name=CAD67280.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67280.1;transl_table=11
BX072543.1	EMBL	gene	702560	703195	.	-	.	ID=gene592;Name=TW617;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW617
BX072543.1	EMBL	CDS	702560	703195	.	-	0	ID=cds588;Parent=gene592;Dbxref=InterPro:IPR003744,UniProtKB/TrEMBL:Q83ND1,NCBI_GP:CAD67281.1;Name=CAD67281.1;Note=Similar to Corynebacterium glutamicum uncharacterized Acr cgl0233 SWALL:BAB97626 (EMBL:AP005274) (246 aa) fasta scores: E(): 1.8e-21%2C 35.64%25 id in 202 aa%2C and to Chlamydia pneumoniae conserved hypothetical bacterial membrane protein cpn1045 or cpj1045 SWALL:Q9Z6L4 (EMBL:AE001685) (230 aa) fasta scores: E(): 3.2e-11%2C 28.98%25 id in 207 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67281.1;transl_table=11
BX072543.1	EMBL	sequence_feature	703091	703159	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	703004	703063	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	702917	702985	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	702821	702889	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	702695	702763	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	702569	702637	.	-	.	ID=id1249;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35%2C 45-64%2C 71-93%2C 103-125%2C 145-167 and 187-209;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	702694	703138	.	-	.	ID=id1250;Note=Uncharacterized ACR%2C YhhQ family COG1738 Score %3D 23.1 E-value %3D 4.6e-07;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	703100	703195	.	-	.	ID=id1251;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.949) with cleavage site probability 0.289 between residues 32 and 33;gbkey=misc_feature
BX072543.1	EMBL	gene	703479	703958	.	-	.	ID=gene593;Name=ppa2;gbkey=Gene;gene=ppa2;gene_biotype=protein_coding;locus_tag=TW618
BX072543.1	EMBL	CDS	703479	703958	.	-	0	ID=cds589;Parent=gene593;Dbxref=GOA:Q81ZK3,InterPro:IPR008162,UniProtKB/TrEMBL:Q81ZK3,NCBI_GP:CAD67282.1;Name=CAD67282.1;Note=Similar to Escherichia coli inorganic pyrophosphatase Ppa or b4226 or z5837 or ecs5204 SWALL:IPYR_ECO57 (SWALL:P17288) (175 aa) fasta scores: E(): 4.4e-26%2C 48.12%25 id in 160 aa;gbkey=CDS;gene=ppa2;product=inorganic pyrophosphatase;protein_id=CAD67282.1;transl_table=11
BX072543.1	EMBL	sequence_feature	703484	703946	.	-	.	ID=id1252;Note=Inorganic pyrophosphatase Score %3D 199.5 E-value %3D 3.6e-57;gbkey=misc_feature;gene=ppa2
BX072543.1	EMBL	sequence_feature	703782	703802	.	-	.	ID=id1253;Note=PS00387 Inorganic pyrophosphatase signature.;gbkey=misc_feature;gene=ppa2
BX072543.1	EMBL	gene	703961	704488	.	-	.	ID=gene594;Name=TW619;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW619
BX072543.1	EMBL	CDS	703961	704488	.	-	0	ID=cds590;Parent=gene594;Dbxref=UniProtKB/TrEMBL:Q81ZR0,NCBI_GP:CAD67283.1;Name=CAD67283.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67283.1;transl_table=11
BX072543.1	EMBL	sequence_feature	703976	704035	.	-	.	ID=id1254;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 152-171;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	704420	704488	.	-	.	ID=id1255;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.991 between residues 23 and 24;gbkey=misc_feature
BX072543.1	EMBL	gene	704564	705778	.	+	.	ID=gene595;Name=tgt;gbkey=Gene;gene=tgt;gene_biotype=protein_coding;locus_tag=TW620
BX072543.1	EMBL	CDS	704564	705778	.	+	0	ID=cds591;Parent=gene595;Dbxref=GOA:Q83HG5,InterPro:IPR002616,InterPro:IPR004803,UniProtKB/TrEMBL:Q83HG5,NCBI_GP:CAD67284.1;Name=CAD67284.1;Note=Similar to Escherichia coli queuine tRNA-ribosyltransferase Tgt or b0406 or z0505 or ecs0457 SWALL:TGT_ECO57 (SWALL:P19675) (375 aa) fasta scores: E(): 1.2e-33%2C 37.77%25 id in 368 aa%2C and to Zymomonas mobilis queuine tRNA-ribosyltransferase Tgt SWALL:TGT_ZYMMO (SWALL:P28720) (385 aa) fasta scores: E(): 6.2e-35%2C 37.05%25 id in 394 aa;gbkey=CDS;gene=tgt;product=queuine tRNA-ribosyltransferase;protein_id=CAD67284.1;transl_table=11
BX072543.1	EMBL	sequence_feature	705062	705761	.	+	.	ID=id1256;Note=Queuine tRNA-ribosyltransferase Score %3D 310.1 E-value %3D 1.9e-90;gbkey=misc_feature;gene=tgt
BX072543.1	EMBL	gene	705782	706750	.	-	.	ID=gene596;Name=TW621;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW621
BX072543.1	EMBL	CDS	705782	706750	.	-	0	ID=cds592;Parent=gene596;Dbxref=UniProtKB/TrEMBL:Q83ND0,NCBI_GP:CAD67285.1;Name=CAD67285.1;Note=No significant database matches;gbkey=CDS;product=proline/alanine-rich repetetive membrane anchored protein;protein_id=CAD67285.1;transl_table=11
BX072543.1	EMBL	sequence_feature	705833	705901	.	-	.	ID=id1257;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 284-306;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	706583	706750	.	-	.	ID=id1258;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.836 between residues 56 and 57;gbkey=misc_feature
BX072543.1	EMBL	gene	707270	708502	.	-	.	ID=gene597;Name=TW622;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW622
BX072543.1	EMBL	CDS	707270	708502	.	-	0	ID=cds593;Parent=gene597;Dbxref=InterPro:IPR000064,UniProtKB/TrEMBL:Q83NC9,NCBI_GP:CAD67286.1;Name=CAD67286.1;Note=C-terminal region similar to others eg. Streptomyces coelicolor putative NLP/P60 family secreted protein SCO4561 or SCD16A.22 SWALL:Q9XAQ3 (EMBL:AL078618) (277 aa) fasta scores: E(): 3.5e-11%2C 33.33%25 id in 207 aa;gbkey=CDS;product=putative NLP/P60 family secreted protein;protein_id=CAD67286.1;transl_table=11
BX072543.1	EMBL	sequence_feature	707281	707617	.	-	.	ID=id1259;Note=NLP/P60 family Score %3D 61.8 E-value %3D 1.1e-15;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	708416	708502	.	-	.	ID=id1260;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.977 between residues 29 and 30;gbkey=misc_feature
BX072543.1	EMBL	gene	709006	709233	.	-	.	ID=gene598;Name=TW623;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW623
BX072543.1	EMBL	CDS	709006	709233	.	-	0	ID=cds594;Parent=gene598;Dbxref=UniProtKB/TrEMBL:Q83HG4,NCBI_GP:CAD67287.1;Name=CAD67287.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67287.1;transl_table=11
BX072543.1	EMBL	tRNA	709498	709573	.	+	.	ID=rna36;Note=tRNA Glu anticodon TTC%2C Cove score 54.89;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	exon	709498	709573	.	+	.	ID=id1261;Parent=rna36;Note=tRNA Glu anticodon TTC%2C Cove score 54.89;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	tRNA	709583	709656	.	+	.	ID=rna37;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	exon	709583	709656	.	+	.	ID=id1262;Parent=rna37;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	tRNA	709662	709737	.	+	.	ID=rna38;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	exon	709662	709737	.	+	.	ID=id1263;Parent=rna38;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	gene	709750	710373	.	-	.	ID=gene599;Name=TW624;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW624
BX072543.1	EMBL	CDS	709750	710373	.	-	0	ID=cds595;Parent=gene599;Dbxref=UniProtKB/TrEMBL:Q83NC8,NCBI_GP:CAD67288.1;Name=CAD67288.1;Note=No significant database matches. Pro/Ala/Ser/Thr-rich.;gbkey=CDS;product=putative membrane protein;protein_id=CAD67288.1;transl_table=11
BX072543.1	EMBL	sequence_feature	709765	709833	.	-	.	ID=id1264;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 181-203;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	710227	710373	.	-	.	ID=id1265;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.994) with cleavage site probability 0.494 between residues 49 and 50;gbkey=misc_feature
BX072543.1	EMBL	gene	710513	712633	.	-	.	ID=gene600;Name=TW625;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW625
BX072543.1	EMBL	CDS	710513	712633	.	-	0	ID=cds596;Parent=gene600;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NC7,NCBI_GP:CAD67289.1;Name=CAD67289.1;Note=No significant database matches. Pro/Ala/Ser/Thr-rich.;gbkey=CDS;product=WiSP family protein;protein_id=CAD67289.1;transl_table=11
BX072543.1	EMBL	sequence_feature	710765	710833	.	-	.	ID=id1266;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 601-623 and 683-705;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	710519	710587	.	-	.	ID=id1266;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 601-623 and 683-705;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	712481	712633	.	-	.	ID=id1267;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.972) with cleavage site probability 0.962 between residues 51 and 52;gbkey=misc_feature
BX072543.1	EMBL	gene	712844	713704	.	-	.	ID=gene601;Name=miaA;gbkey=Gene;gene=miaA;gene_biotype=protein_coding;locus_tag=TW626
BX072543.1	EMBL	CDS	712844	713704	.	-	0	ID=cds597;Parent=gene601;Dbxref=GOA:Q820Y7,InterPro:IPR002627,InterPro:IPR018022,InterPro:IPR027417,NCBI_GP:CAD67290.1;Name=CAD67290.1;Note=Similar to Escherichia coli tRNA delta (2)-isopentenylpyrophosphate transferase MiaA or TrpX or b4171 SWALL:MIAA_SHIFL (SWALL:P16384) (316 aa) fasta scores: E(): 2.9e-18%2C 29.49%25 id in 278 aa%2C and to Streptomyces coelicolor trna delta (2)-isopentenylpyrophosphate transferase MiaA or SCO5791 or SC4H2.12 SWALL:MIAA_STRCO (SWALL:O69967) (312 aa) fasta scores: E(): 7.8e-35%2C 42.59%25 id in 270 aa;gbkey=CDS;gene=miaA;product=tRNA delta (2)-isopentenylpyrophosphate transferase;protein_id=CAD67290.1;transl_table=11
BX072543.1	EMBL	sequence_feature	712900	713647	.	-	.	ID=id1268;Note=IPP transferase Score %3D 212.4 E-value %3D 4.7e-61;gbkey=misc_feature;gene=miaA
BX072543.1	EMBL	gene	713825	715237	.	-	.	ID=gene602;Name=TW627;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW627
BX072543.1	EMBL	CDS	713825	715237	.	-	0	ID=cds598;Parent=gene602;Dbxref=GOA:Q83HG3,InterPro:IPR002792,InterPro:IPR005839,InterPro:IPR006463,InterPro:IPR006638,InterPro:IPR007197,InterPro:IPR013848,InterPro:IPR020612,InterPro:IPR023404,InterPro:IPR023970,NCBI_GP:CAD67291.1;Name=CAD67291.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5787 or SC4H2.08 SWALL:O69963 (EMBL:AL022268) (505 aa) fasta scores: E(): 2.5e-120%2C 65.12%25 id in 476 aa%2C and to Escherichia coli hypothetical protein YleA or b0661 or z0810 or ecs0699 SWALL:YLEA_ECO57 (SWALL:P77645) (474 aa) fasta scores: E(): 3.6e-59%2C 41.04%25 id in 441 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67291.1;transl_table=11
BX072543.1	EMBL	sequence_feature	713923	714124	.	-	.	ID=id1269;Note=TRAM domain Score %3D 15.7 E-value %3D 0.011;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	714283	714799	.	-	.	ID=id1270;Note=Radical SAM superfamily Score %3D 113.4 E-value %3D 3.1e-31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	714737	714799	.	-	.	ID=id1271;Note=PS01278 Uncharacterized protein family UPF0004 signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	714940	715234	.	-	.	ID=id1272;Note=Uncharacterized protein family UPF0004 Score %3D 157.0 E-value %3D 2.2e-44;gbkey=misc_feature
BX072543.1	EMBL	gene	715252	716565	.	-	.	ID=gene603;Name=recA;gbkey=Gene;gene=recA;gene_biotype=protein_coding;locus_tag=TW628
BX072543.1	EMBL	CDS	715252	716565	.	-	0	ID=cds599;Parent=gene603;Dbxref=GOA:P65982,InterPro:IPR003593,InterPro:IPR013765,InterPro:IPR020584,InterPro:IPR020587,InterPro:IPR020588,InterPro:IPR023400,InterPro:IPR027417,NCBI_GP:CAD67292.1;Name=CAD67292.1;Note=Similar to Streptomyces lividans RecA protein SWALL:RECA_STRLI (SWALL:P48294) (374 aa) fasta scores: E(): 1.5e-86%2C 70.27%25 id in 370 aa;gbkey=CDS;gene=recA;product=recombinase A;protein_id=CAD67292.1;transl_table=11
BX072543.1	EMBL	sequence_feature	715572	716535	.	-	.	ID=id1273;Note=recA bacterial DNA recombination protein Score %3D 765.1 E-value %3D 2.1e-227;gbkey=misc_feature;gene=recA
BX072543.1	EMBL	sequence_feature	715891	715917	.	-	.	ID=id1274;Note=PS00321 recA signature.;gbkey=misc_feature;gene=recA
BX072543.1	EMBL	sequence_feature	716338	716361	.	-	.	ID=id1275;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=recA
BX072543.1	EMBL	gene	716760	717365	.	-	.	ID=gene604;Name=pgsA;gbkey=Gene;gene=pgsA;gene_biotype=protein_coding;locus_tag=TW629
BX072543.1	EMBL	CDS	716760	717365	.	-	0	ID=cds600;Parent=gene604;Dbxref=GOA:Q83HG2,InterPro:IPR000462,InterPro:IPR004570,UniProtKB/TrEMBL:Q83HG2,NCBI_GP:CAD67293.1;Name=CAD67293.1;Note=Similar to Bacillus subtilis CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase PgsA SWALL:PGSA_BACSU (SWALL:P46322) (193 aa) fasta scores: E(): 3.8e-11%2C 40.54%25 id in 148 aa;gbkey=CDS;gene=pgsA;product=CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase;protein_id=CAD67293.1;transl_table=11
BX072543.1	EMBL	sequence_feature	716771	717275	.	-	.	ID=id1276;Note=CDP-alcohol phosphatidyltransferase Score %3D 120.6 E-value %3D 2.1e-33;gbkey=misc_feature;gene=pgsA
BX072543.1	EMBL	sequence_feature	717222	717290	.	-	.	ID=id1277;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 68-90%2C 116-138 and 172-194;gbkey=misc_feature;gene=pgsA;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	717096	717164	.	-	.	ID=id1277;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 68-90%2C 116-138 and 172-194;gbkey=misc_feature;gene=pgsA;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	716952	717020	.	-	.	ID=id1277;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 68-90%2C 116-138 and 172-194;gbkey=misc_feature;gene=pgsA;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	716784	716852	.	-	.	ID=id1277;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 26-48%2C 68-90%2C 116-138 and 172-194;gbkey=misc_feature;gene=pgsA;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	sequence_feature	717168	717236	.	-	.	ID=id1278;Note=PS00379 CDP-alcohol phosphatidyltransferases signature.;gbkey=misc_feature;gene=pgsA
BX072543.1	EMBL	gene	717488	717835	.	-	.	ID=gene605;Name=TW630;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW630
BX072543.1	EMBL	CDS	717488	717835	.	-	0	ID=cds601;Parent=gene605;Dbxref=UniProtKB/TrEMBL:Q83HG1,NCBI_GP:CAD67294.1;Name=CAD67294.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67294.1;transl_table=11
BX072543.1	EMBL	gene	717893	720118	.	-	.	ID=gene606;Name=TW631;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW631
BX072543.1	EMBL	CDS	717893	720118	.	-	0	ID=cds602;Parent=gene606;Dbxref=GOA:Q83MI4,InterPro:IPR002543,InterPro:IPR003593,InterPro:IPR018541,InterPro:IPR027417,NCBI_GP:CAD67295.1;Name=CAD67295.1;Note=Similar to Streptomyces coelicolor Ftsk homolog SCO5750 or SC7C7.05 SWALL:O86810 (EMBL:AL031031) (929 aa) fasta scores: E(): 1.9e-111%2C 46.58%25 id in 848 aa%2C and to Bacillus subtilis stage III sporulation protein E SpoIIIE SWALL:SP3E_BACSU (SWALL:P21458) (787 aa) fasta scores: E(): 1e-79%2C 46.84%25 id in 491 aa;gbkey=CDS;product=FtsK/SpoIIIE homologue;protein_id=CAD67295.1;transl_table=11
BX072543.1	EMBL	sequence_feature	718438	719035	.	-	.	ID=id1279;Note=FtsK/SpoIIIE family Score %3D 255.9 E-value %3D 3.8e-74;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	718877	718900	.	-	.	ID=id1280;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	719948	720004	.	-	.	ID=id1281;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-57%2C 72-94%2C 107-126%2C 136-158 and 165-187;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	719837	719905	.	-	.	ID=id1281;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-57%2C 72-94%2C 107-126%2C 136-158 and 165-187;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	719741	719800	.	-	.	ID=id1281;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-57%2C 72-94%2C 107-126%2C 136-158 and 165-187;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	719645	719713	.	-	.	ID=id1281;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-57%2C 72-94%2C 107-126%2C 136-158 and 165-187;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	719558	719626	.	-	.	ID=id1281;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-57%2C 72-94%2C 107-126%2C 136-158 and 165-187;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	720115	721752	.	-	.	ID=gene607;Name=TW632;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW632
BX072543.1	EMBL	CDS	720115	721752	.	-	0	ID=cds603;Parent=gene607;Dbxref=GOA:Q83HG0,InterPro:IPR001279,InterPro:IPR004613,InterPro:IPR011108,UniProtKB/TrEMBL:Q83HG0,NCBI_GP:CAD67296.1;Name=CAD67296.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5745 or SC9A10.09 SWALL:O86842 (EMBL:AL031260) (561 aa) fasta scores: E(): 1.8e-112%2C 53.95%25 id in 543 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67296.1;transl_table=11
BX072543.1	EMBL	sequence_feature	720123	721104	.	-	.	ID=id1282;Note=Uncharacterized protein family UPF0036 Score %3D 261.2 E-value %3D 9.6e-76;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	721122	721716	.	-	.	ID=id1283;Note=Metallo-beta-lactamase superfamily Score %3D 108.9 E-value %3D 7.1e-30;gbkey=misc_feature
BX072543.1	EMBL	gene	721883	722605	.	-	.	ID=gene608;Name=TW633;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW633
BX072543.1	EMBL	CDS	721883	722605	.	-	0	ID=cds604;Parent=gene608;Dbxref=GOA:Q83HF9,InterPro:IPR003669,NCBI_GP:CAD67297.1;Name=CAD67297.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5743 or SC9A10.07 SWALL:O86840 (EMBL:AL031260) (246 aa) fasta scores: E(): 4.4e-51%2C 59.82%25 id in 234 aa%2C and to Dictyostelium discoideum Thy1 protein ThyA or Thy1 SWALL:THY1_DICDI (SWALL:P15808) (260 aa) fasta scores: E(): 4.5e-14%2C 32.36%25 id in 207 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67297.1;transl_table=11
BX072543.1	EMBL	sequence_feature	721939	722593	.	-	.	ID=id1284;Note=Thymidylate synthase complementing protein Score %3D 216.3 E-value %3D 3.3e-62;gbkey=misc_feature
BX072543.1	EMBL	gene	722670	723827	.	-	.	ID=gene609;Name=TW634;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW634
BX072543.1	EMBL	CDS	722670	723827	.	-	0	ID=cds605;Parent=gene609;Dbxref=UniProtKB/TrEMBL:Q83NC5,NCBI_GP:CAD67298.1;Name=CAD67298.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67298.1;transl_table=11
BX072543.1	EMBL	sequence_feature	723729	723797	.	-	.	ID=id1285;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 74-96 and 411-433;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	722718	722786	.	-	.	ID=id1285;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 74-96 and 411-433;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	724522	724726	.	+	.	ID=id1286;Note=Transcription factor WhiB Score %3D 114.2 E-value %3D 1.8e-31;gbkey=misc_feature
BX072543.1	EMBL	gene	724543	724776	.	+	.	ID=gene610;Name=TW636;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW636
BX072543.1	EMBL	CDS	724543	724776	.	+	0	ID=cds606;Parent=gene610;Dbxref=GOA:Q83NC4,InterPro:IPR003482,UniProtKB/TrEMBL:Q83NC4,NCBI_GP:CAD67299.1;Name=CAD67299.1;Note=Similar to Streptomyces coelicolor hypothetical protein WblE or SCO5240 or 2SC7G11.02c SWALL:Q9X952 (EMBL:AJ239087) (85 aa) fasta scores: E(): 2.3e-20%2C 64.28%25 id in 84 aa%2C and to Streptomyces griseocarneus WhiB-STV protein SWALL:Q06387 (EMBL:X68708) (87 aa) fasta scores: E(): 1.4e-08%2C 43.83%25 id in 73 aa%2C and to Mycobacterium smegmatis WhmD SWALL:Q9S426 (EMBL:AF164439) (129 aa) fasta scores: E(): 1.4e-08%2C 45.07%25 id in 71 aa;gbkey=CDS;product=putative WhiB-family regulator;protein_id=CAD67299.1;transl_table=11
BX072543.1	EMBL	tRNA	725183	725263	.	+	.	ID=rna39;Note=tRNA Leu anticodon TAG%2C Cove score 60.57;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	exon	725183	725263	.	+	.	ID=id1287;Parent=rna39;Note=tRNA Leu anticodon TAG%2C Cove score 60.57;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	gene	725478	725921	.	-	.	ID=gene611;Name=TW637;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW637
BX072543.1	EMBL	CDS	725478	725921	.	-	0	ID=cds607;Parent=gene611;Dbxref=UniProtKB/TrEMBL:Q83HF8,NCBI_GP:CAD67300.1;Name=CAD67300.1;Note=Doubtful CDS. No significant database matches. Pro/Ala-rich.;gbkey=CDS;product=hypothetical protein;protein_id=CAD67300.1;transl_table=11
BX072543.1	EMBL	gene	725920	726630	.	+	.	ID=gene612;Name=TW638;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW638
BX072543.1	EMBL	CDS	725920	726630	.	+	0	ID=cds608;Parent=gene612;Dbxref=InterPro:IPR015414,UniProtKB/TrEMBL:Q83NC3,NCBI_GP:CAD67301.1;Name=CAD67301.1;Note=Similar to Streptomyces coelicolor possible membrane protein SCO3411 or SCE9.18c SWALL:Q9X8J1 (EMBL:AL049841) (303 aa) fasta scores: E(): 7.9e-28%2C 41.03%25 id in 212 aa%2C and to Escherichia coli DedA protein or b2317 or z3579 or ecs3201 SWALL:DEDA_ECO57 (SWALL:P09548) (219 aa) fasta scores: E(): 2.2e-21%2C 34.27%25 id in 213 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67301.1;transl_table=11
BX072543.1	EMBL	sequence_feature	725938	726006	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	726049	726117	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	726154	726222	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	726337	726405	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	726442	726510	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	726520	726588	.	+	.	ID=id1288;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 79-101%2C 140-162%2C 175-197 and 201-223;gbkey=misc_feature;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	726043	726541	.	+	.	ID=id1289;Note=DedA family Score %3D 85.3 E-value %3D 8.9e-23;gbkey=misc_feature
BX072543.1	EMBL	gene	726584	727165	.	-	.	ID=gene613;Name=TW639;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW639
BX072543.1	EMBL	CDS	726584	727165	.	-	0	ID=cds609;Parent=gene613;Dbxref=GOA:Q83HF7,InterPro:IPR002637,InterPro:IPR020922,InterPro:IPR029001,NCBI_GP:CAD67302.1;Name=CAD67302.1;Note=Similar to Streptomyces coelicolor Ham1 protein homolog SCO2902 or SCE19A.02c SWALL:HAM1_STRCO (SWALL:Q9S2H9) (200 aa) fasta scores: E(): 2e-25%2C 42.78%25 id in 194 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67302.1;transl_table=11
BX072543.1	EMBL	sequence_feature	726616	727159	.	-	.	ID=id1290;Note=Ham1 family Score %3D 191.1 E-value %3D 1.3e-54;gbkey=misc_feature
BX072543.1	EMBL	gene	727191	727961	.	-	.	ID=gene614;Name=rph;gbkey=Gene;gene=rph;gene_biotype=protein_coding;locus_tag=TW640
BX072543.1	EMBL	CDS	727191	727961	.	-	0	ID=cds610;Parent=gene614;Dbxref=GOA:Q83HF6,InterPro:IPR001247,InterPro:IPR002381,InterPro:IPR015847,InterPro:IPR018336,InterPro:IPR020568,InterPro:IPR027408,NCBI_GP:CAD67303.1;Name=CAD67303.1;Note=Similar to Escherichia coli ribonuclease PH Rph or b3643 SWALL:RNPH_ECOLI (SWALL:P03842) (238 aa) fasta scores: E(): 5.3e-42%2C 49.57%25 id in 236 aa%2C and to Bifidobacterium longum NCC2705 probable ribonuclease PH bl0286 SWALL:AAN24126 (EMBL:AE014647) (258 aa) fasta scores: E(): 3.3e-46%2C 54.39%25 id in 239 aa;gbkey=CDS;gene=rph;product=ribonuclease PH;protein_id=CAD67303.1;transl_table=11
BX072543.1	EMBL	sequence_feature	727235	727436	.	-	.	ID=id1291;Note=3' exoribonuclease family%2C domain 2 Score %3D 71.3 E-value %3D 1.4e-18;gbkey=misc_feature;gene=rph
BX072543.1	EMBL	sequence_feature	727478	727877	.	-	.	ID=id1292;Note=3' exoribonuclease family%2C domain 1 Score %3D 164.3 E-value %3D 1.5e-46;gbkey=misc_feature;gene=rph
BX072543.1	EMBL	sequence_feature	727521	727559	.	-	.	ID=id1293;Note=PS01277 Ribonuclease PH signature.;gbkey=misc_feature;gene=rph
BX072543.1	EMBL	sequence_feature	727884	727961	.	-	.	ID=id1294;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.740) with cleavage site probability 0.381 between residues 26 and 27;gbkey=misc_feature;gene=rph
BX072543.1	EMBL	gene	727985	729313	.	+	.	ID=gene615;Name=TW641;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW641
BX072543.1	EMBL	CDS	727985	729313	.	+	0	ID=cds611;Parent=gene615;Dbxref=GOA:Q83HF5,InterPro:IPR002638,InterPro:IPR006405,InterPro:IPR007229,UniProtKB/TrEMBL:Q83HF5,NCBI_GP:CAD67304.1;Name=CAD67304.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO2917 or SCE19A.17 SWALL:Q9S2G4 (EMBL:AL096852) (448 aa) fasta scores: E(): 3.7e-64%2C 48.91%25 id in 415 aa. Note overlap with downstream tRNA.;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67304.1;transl_table=11
BX072543.1	EMBL	sequence_feature	728000	729002	.	+	.	ID=id1295;Note=Nicotinate phosphoribosyltransferase (NAPRTase) Score %3D -267.1 E-value %3D 0.0023;gbkey=misc_feature
BX072543.1	EMBL	tRNA	729293	729366	.	+	.	ID=rna40;Note=tRNA Glu anticodon TTC%2C Cove score 37.59;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	exon	729293	729366	.	+	.	ID=id1296;Parent=rna40;Note=tRNA Glu anticodon TTC%2C Cove score 37.59;gbkey=tRNA;product=tRNA-Glu
BX072543.1	EMBL	tRNA	729376	729449	.	+	.	ID=rna41;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	exon	729376	729449	.	+	.	ID=id1297;Parent=rna41;Note=tRNA Asp anticodon GTC%2C Cove score 87.26;gbkey=tRNA;product=tRNA-Asp
BX072543.1	EMBL	tRNA	729455	729530	.	+	.	ID=rna42;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	exon	729455	729530	.	+	.	ID=id1298;Parent=rna42;Note=tRNA Phe anticodon GAA%2C Cove score 74.74;gbkey=tRNA;product=tRNA-Phe
BX072543.1	EMBL	gene	731623	731694	.	-	.	ID=gene616;Name=TW642;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW642;part=1/2
BX072543.1	EMBL	gene	729543	731621	.	-	.	ID=gene616;Name=TW642;gbkey=Gene;gene_biotype=protein_coding;is_ordered=true;locus_tag=TW642;part=2/2
BX072543.1	EMBL	CDS	731623	731694	.	-	0	ID=cds612;Parent=gene616;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NC2,NCBI_GP:CAD67305.1;Name=CAD67305.1;Note=No significant database matches. Rep6. Frameshifted at potentially variable C(11) tract after aa 24;gbkey=CDS;product=WiSP family protein;protein_id=CAD67305.1;transl_table=11
BX072543.1	EMBL	CDS	729543	731621	.	-	0	ID=cds612;Parent=gene616;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NC2,NCBI_GP:CAD67305.1;Name=CAD67305.1;Note=No significant database matches. Rep6. Frameshifted at potentially variable C(11) tract after aa 24;gbkey=CDS;product=WiSP family protein;protein_id=CAD67305.1;transl_table=11
BX072543.1	EMBL	sequence_feature	729547	729615	.	-	.	ID=id1299;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 694-716;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	731623	731694	.	-	.	ID=id1300;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.994 between residues 60 and 61;gbkey=misc_feature;part=1/2
BX072543.1	EMBL	sequence_feature	731514	731621	.	-	.	ID=id1300;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.994 between residues 60 and 61;gbkey=misc_feature;part=2/2
BX072543.1	EMBL	repeat_region	731617	731627	.	+	.	ID=id1301;Note=(c)11;gbkey=repeat_region
BX072543.1	EMBL	gene	731763	733025	.	-	.	ID=gene617;Name=TW643;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW643
BX072543.1	EMBL	CDS	731763	733025	.	-	0	ID=cds613;Parent=gene617;Dbxref=GOA:Q83NC1,InterPro:IPR001254,InterPro:IPR001478,InterPro:IPR001940,InterPro:IPR009003,UniProtKB/TrEMBL:Q83NC1,NCBI_GP:CAD67306.1;Name=CAD67306.1;Note=No significant database matches. Note possible downstream alternative start codons.;gbkey=CDS;product=putative membrane protein;protein_id=CAD67306.1;transl_table=11
BX072543.1	EMBL	sequence_feature	731825	732080	.	-	.	ID=id1302;Note=PDZ domain (Also known as DHR or GLGF) Score %3D 64.8 E-value %3D 1.3e-16;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	732089	732662	.	-	.	ID=id1303;Note=Trypsin Score %3D 41.7 E-value %3D 1.2e-09;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	732786	732854	.	-	.	ID=id1304;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 58-80;gbkey=misc_feature
BX072543.1	EMBL	tRNA	733163	733236	.	-	.	ID=rna43;Note=tRNA Met anticodon CAT%2C Cove score 82.07;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	exon	733163	733236	.	-	.	ID=id1305;Parent=rna43;Note=tRNA Met anticodon CAT%2C Cove score 82.07;gbkey=tRNA;product=tRNA-Met
BX072543.1	EMBL	gene	733276	736152	.	-	.	ID=gene618;Name=TW644;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW644
BX072543.1	EMBL	CDS	733276	736152	.	-	0	ID=cds614;Parent=gene618;Dbxref=GOA:Q83NC0,InterPro:IPR005372,NCBI_GP:CAD67307.1;Name=CAD67307.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO5204 or 2SC3B6.28 or SC7E4.01 SWALL:YGA4_STRCO (SWALL:Q9FCI4) (1000 aa) fasta scores: E(): 6.2e-99%2C 40.08%25 id in 978 aa%2C and to Bifidobacterium longum NCC2705 narrowly conserved hypothetical protein bl1029 SWALL:AAN24835 (EMBL:AE014726) (1066 aa) fasta scores: E(): 2.9e-86%2C 42.56%25 id in 1015 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67307.1;transl_table=11
BX072543.1	EMBL	sequence_feature	733680	736131	.	-	.	ID=id1306;Note=Uncharacterised protein family (UPF0182) Score %3D 776.6 E-value %3D 7e-231;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	736051	736119	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=1/7;partial=true
BX072543.1	EMBL	sequence_feature	735925	735993	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=2/7;partial=true
BX072543.1	EMBL	sequence_feature	735772	735831	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=3/7;partial=true
BX072543.1	EMBL	sequence_feature	735592	735660	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=4/7;partial=true
BX072543.1	EMBL	sequence_feature	735481	735534	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=5/7;partial=true
BX072543.1	EMBL	sequence_feature	735337	735405	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=6/7;partial=true
BX072543.1	EMBL	sequence_feature	735250	735318	.	-	.	ID=id1307;Note=7 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 12-34%2C 54-76%2C 108-127%2C 165-187%2C 207-224%2C 250-272 and 279-301;gbkey=misc_feature;is_ordered=true;part=7/7;partial=true
BX072543.1	EMBL	sequence_feature	736039	736152	.	-	.	ID=id1308;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.773 between residues 38 and 39;gbkey=misc_feature
BX072543.1	EMBL	gene	736186	737220	.	-	.	ID=gene619;Name=TW645;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW645
BX072543.1	EMBL	CDS	736186	737220	.	-	0	ID=cds615;Parent=gene619;Dbxref=GOA:Q83NB9,InterPro:IPR001478,InterPro:IPR008269,InterPro:IPR014721,InterPro:IPR020568,InterPro:IPR027065,UniProtKB/TrEMBL:Q83NB9,NCBI_GP:CAD67308.1;Name=CAD67308.1;Note=Similar to Corynebacterium glutamicum predicted secreted protein containing a PDZ domain cgl0783 SWALL:Q8NS96 (EMBL:AP005276) (350 aa) fasta scores: E(): 5.2e-19%2C 29.67%25 id in 310 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67308.1;transl_table=11
BX072543.1	EMBL	sequence_feature	736638	736845	.	-	.	ID=id1309;Note=PDZ domain (Also known as DHR or GLGF) Score %3D 11.1 E-value %3D 0.0059;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	737110	737220	.	-	.	ID=id1310;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.572 between residues 37 and 38;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	737116	737184	.	-	.	ID=id1311;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 13-35;gbkey=misc_feature
BX072543.1	EMBL	gene	737310	738668	.	-	.	ID=gene620;Name=pdhD;gbkey=Gene;gene=pdhD;gene_biotype=protein_coding;locus_tag=TW646
BX072543.1	EMBL	CDS	737310	738668	.	-	0	ID=cds616;Parent=gene620;Dbxref=GOA:Q83HF4,InterPro:IPR001327,InterPro:IPR004099,InterPro:IPR012999,InterPro:IPR013027,InterPro:IPR016156,InterPro:IPR023753,UniProtKB/TrEMBL:Q83HF4,NCBI_GP:CAD67309.1;Name=CAD67309.1;Note=Similar to Bacillus stearothermophilus dihydrolipoamide dehydrogenase PdhD SWALL:DLD1_BACST (SWALL:P11959) (470 aa) fasta scores: E(): 4e-32%2C 28.26%25 id in 460 aa%2C and to Corynebacterium glutamicum dihydrolipoamide dehydrogenase/glutathione oxidoreductase and related enzymes cgl2003 SWALL:Q8NP23 (EMBL:AP005280) (465 aa) fasta scores: E(): 8e-36%2C 40.42%25 id in 470 aa;gbkey=CDS;gene=pdhD;product=dihydrolipoamide dehydrogenase;protein_id=CAD67309.1;transl_table=11
BX072543.1	EMBL	sequence_feature	737342	737654	.	-	.	ID=id1312;Note=Pyridine nucleotide-disulphide oxidoreductase%2C dimerisation domain Score %3D 34.0 E-value %3D 1.6e-07;gbkey=misc_feature;gene=pdhD
BX072543.1	EMBL	sequence_feature	737729	738656	.	-	.	ID=id1313;Note=Pyridine nucleotide-disulphide oxidoreductase Score %3D 166.6 E-value %3D 2.9e-47;gbkey=misc_feature;gene=pdhD
BX072543.1	EMBL	sequence_feature	738528	738560	.	-	.	ID=id1314;Note=PS00076 Pyridine nucleotide-disulphide oxidoreductases class-I active site.;gbkey=misc_feature;gene=pdhD
BX072543.1	EMBL	gene	738673	742068	.	-	.	ID=gene621;Name=pyc;gbkey=Gene;gene=pyc;gene_biotype=protein_coding;locus_tag=TW647
BX072543.1	EMBL	CDS	738673	742068	.	-	0	ID=cds617;Parent=gene621;Dbxref=GOA:Q83HF3,InterPro:IPR000089,InterPro:IPR000891,InterPro:IPR001882,InterPro:IPR003379,InterPro:IPR005479,InterPro:IPR005481,InterPro:IPR005482,InterPro:IPR005930,InterPro:IPR011053,InterPro:IPR011054,InterPro:IPR011761,InterPro:IPR011764,InterPro:IPR013785,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,UniProtKB/TrEMBL:Q83HF3,NCBI_GP:CAD67310.1;Name=CAD67310.1;Note=Similar to Mycobacterium smegmatis pyruvate carboxylase Pyc SWALL:Q9F843 (EMBL:AF262949) (1127 aa) fasta scores: E(): 0%2C 59.06%25 id in 1131 aa%2C and to Saccharomyces cerevisiae pyruvate carboxylase 1 Pyc1 or Pyv or ygl062W SWALL:PYC1_YEAST (SWALL:P11154) (1178 aa) fasta scores: E(): 2.9e-168%2C 47.21%25 id in 1150 aa;gbkey=CDS;gene=pyc;product=pyruvate carboxylase;protein_id=CAD67310.1;transl_table=11
BX072543.1	EMBL	sequence_feature	738684	738882	.	-	.	ID=id1315;Note=Biotin-requiring enzyme Score %3D 60.3 E-value %3D 2.9e-15;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	738760	738813	.	-	.	ID=id1316;Note=PS00188 Biotin-requiring enzymes attachment site.;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	739005	739599	.	-	.	ID=id1317;Note=Conserved carboxylase domain Score %3D 188.3 E-value %3D 8.8e-54;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	739614	740466	.	-	.	ID=id1318;Note=HMGL-like Score %3D 98.5 E-value %3D 9.5e-27;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	739786	739821	.	-	.	ID=id1319;Note=PS00141 Eukaryotic and viral aspartyl proteases active site.;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	740733	741054	.	-	.	ID=id1320;Note=Biotin carboxylase C-terminal domain Score %3D 185.0 E-value %3D 8.4e-53;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	741075	741723	.	-	.	ID=id1321;Note=Carbamoyl-phosphate synthase L chain%2C ATP binding domain Score %3D 332.6 E-value %3D 3.3e-97;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	741190	741213	.	-	.	ID=id1322;Note=PS00867 Carbamoyl-phosphate synthase subdomain signature 2.;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	741513	741723	.	-	.	ID=id1323;Note=D-ala D-ala ligase Score %3D 25.2 E-value %3D 4.5e-07;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	sequence_feature	741729	742068	.	-	.	ID=id1324;Note=Carbamoyl-phosphate synthase L chain%2C N-terminal domain Score %3D 131.7 E-value %3D 9.2e-37;gbkey=misc_feature;gene=pyc
BX072543.1	EMBL	gene	742132	742905	.	+	.	ID=gene622;Name=parA2;gbkey=Gene;gene=parA2;gene_biotype=protein_coding;locus_tag=TW648
BX072543.1	EMBL	CDS	742132	742905	.	+	0	ID=cds618;Parent=gene622;Dbxref=InterPro:IPR002586,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NB8,NCBI_GP:CAD67311.1;Name=CAD67311.1;Note=Similar to Caulobacter crescentus chromosome partitioning protein ParA or cc3753 SWALL:PARA_CAUCR (SWALL:O05189) (267 aa) fasta scores: E(): 2.8e-13%2C 30.34%25 id in 234 aa%2C and to Streptomyces coelicolor ParA SWALL:Q9RFM1 (EMBL:AF187159) (357 aa) fasta scores: E(): 2.8e-11%2C 29.2%25 id in 226 aa;gbkey=CDS;gene=parA2;product=chromosome partitioning protein;protein_id=CAD67311.1;transl_table=11
BX072543.1	EMBL	sequence_feature	742384	742711	.	+	.	ID=id1325;Note=ParA family ATPase Score %3D 59.5 E-value %3D 5.2e-15;gbkey=misc_feature;gene=parA2
BX072543.1	EMBL	gene	742928	743734	.	-	.	ID=gene623;Name=TW649;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW649
BX072543.1	EMBL	CDS	742928	743734	.	-	0	ID=cds619;Parent=gene623;Dbxref=UniProtKB/TrEMBL:Q83NB7,NCBI_GP:CAD67312.1;Name=CAD67312.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67312.1;transl_table=11
BX072543.1	EMBL	sequence_feature	743462	743530	.	-	.	ID=id1326;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 69-91%2C 111-133%2C 179-201 and 206-228;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	743336	743404	.	-	.	ID=id1326;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 69-91%2C 111-133%2C 179-201 and 206-228;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	743132	743200	.	-	.	ID=id1326;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 69-91%2C 111-133%2C 179-201 and 206-228;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	743051	743119	.	-	.	ID=id1326;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 69-91%2C 111-133%2C 179-201 and 206-228;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	743942	745456	.	-	.	ID=gene624;Name=TW651;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW651
BX072543.1	EMBL	CDS	743942	745456	.	-	0	ID=cds620;Parent=gene624;Dbxref=GOA:Q83HF2,InterPro:IPR003594,InterPro:IPR005467,InterPro:IPR011495,InterPro:IPR022066,UniProtKB/TrEMBL:Q83HF2,NCBI_GP:CAD67313.1;Name=CAD67313.1;Note=Similar to many predicted histidine kinases eg. Bifidobacterium longum NCC2705 histidine kinase-like protein bl1012 SWALL:AAN24820 (EMBL:AE014724) (510 aa) fasta scores: E(): 6.6e-53%2C 35.72%25 id in 459 aa;gbkey=CDS;product=putative histidine kinase;protein_id=CAD67313.1;transl_table=11
BX072543.1	EMBL	sequence_feature	743968	744292	.	-	.	ID=id1327;Note=Histidine kinase-%2C DNA gyrase B-%2C and HSP90-like ATPase Score %3D 63.1 E-value %3D 4.2e-16;gbkey=misc_feature
BX072543.1	EMBL	gene	746050	747348	.	-	.	ID=gene625;Name=gabT;gbkey=Gene;gene=gabT;gene_biotype=protein_coding;locus_tag=TW652
BX072543.1	EMBL	CDS	746050	747348	.	-	0	ID=cds621;Parent=gene625;Dbxref=GOA:Q83HF1,InterPro:IPR005814,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,UniProtKB/TrEMBL:Q83HF1,NCBI_GP:CAD67314.1;Name=CAD67314.1;Note=Similar to Escherichia coli 4-aminobutyrate aminotransferase GabT or b2662 SWALL:GABT_ECOLI (SWALL:P22256) (426 aa) fasta scores: E(): 2.6e-54%2C 38.88%25 id in 414 aa%2C and to Streptomyces coelicolor putative 4-aminobutyrate aminotransferase GabT or SCO5676 or SC8B7.02 SWALL:O86823 (EMBL:AL031225) (444 aa) fasta scores: E(): 5.6e-65%2C 46.92%25 id in 439 aa;gbkey=CDS;gene=gabT;product=4-aminobutyrate aminotransferase;protein_id=CAD67314.1;transl_table=11
BX072543.1	EMBL	sequence_feature	746055	747276	.	-	.	ID=id1328;Note=Aminotransferase class-III Score %3D 473.8 E-value %3D 9.6e-140;gbkey=misc_feature;gene=gabT
BX072543.1	EMBL	sequence_feature	746494	746607	.	-	.	ID=id1329;Note=PS00600 Aminotransferases class-III pyridoxal-phosphate attachment site.;gbkey=misc_feature;gene=gabT
BX072543.1	EMBL	gene	747349	748224	.	-	.	ID=gene626;Name=folD;gbkey=Gene;gene=folD;gene_biotype=protein_coding;locus_tag=TW653
BX072543.1	EMBL	CDS	747349	748224	.	-	0	ID=cds622;Parent=gene626;Dbxref=GOA:Q83HF0,InterPro:IPR000672,InterPro:IPR016040,InterPro:IPR020630,InterPro:IPR020631,InterPro:IPR020867,NCBI_GP:CAD67315.1;Name=CAD67315.1;Note=Similar to Bacillus subtilis FolD bifunctional protein [includes: methylenetetrahydrofolate dehydrogenase (EC 1.5.1.5)%3B methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9)] FolD SWALL:FOLD_BACSU (SWALL:P54382) (283 aa) fasta scores: E(): 1.9e-37%2C 42.4%25 id in 283 aa%2C and to Streptomyces coelicolor bifunctional protein FolD or SCO4824 or SC2A6.09 SWALL:Q9K3J6 (EMBL:AL389898) (284 aa) fasta scores: E(): 1.9e-46%2C 46.45%25 id in 282 aa;gbkey=CDS;gene=folD;product=FolD bifunctional protein [includes: methylenetetrahydrofolate dehydrogenase (EC 1.5.1.5)%3B methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9)];protein_id=CAD67315.1;transl_table=11
BX072543.1	EMBL	sequence_feature	747375	747873	.	-	.	ID=id1330;Note=Tetrahydrofolate dehydrogenase/cyclohydrolase%2C NAD(P)-binding domain Score %3D 216.8 E-value %3D 2.3e-62;gbkey=misc_feature;gene=folD
BX072543.1	EMBL	sequence_feature	747879	748221	.	-	.	ID=id1331;Note=Tetrahydrofolate dehydrogenase/cyclohydrolase%2C catalytic domain Score %3D 148.0 E-value %3D 1.2e-41;gbkey=misc_feature;gene=folD
BX072543.1	EMBL	gene	748409	749695	.	-	.	ID=gene627;Name=glyA;gbkey=Gene;gene=glyA;gene_biotype=protein_coding;locus_tag=TW655
BX072543.1	EMBL	CDS	748409	749695	.	-	0	ID=cds623;Parent=gene627;Dbxref=GOA:P66806,InterPro:IPR001085,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,InterPro:IPR019798,NCBI_GP:CAD67316.1;Name=CAD67316.1;Note=Similar to Methylobacterium extorquens serine hydroxymethyltransferase GlyA SWALL:GLYA_METEX (SWALL:P50435) (434 aa) fasta scores: E(): 1.3e-75%2C 54.06%25 id in 394 aa;gbkey=CDS;gene=glyA;product=serine hydroxymethyltransferase;protein_id=CAD67316.1;transl_table=11
BX072543.1	EMBL	sequence_feature	748510	749656	.	-	.	ID=id1332;Note=Serine hydroxymethyltransferase Score %3D 674.6 E-value %3D 3.5e-200;gbkey=misc_feature;gene=glyA
BX072543.1	EMBL	sequence_feature	748964	749014	.	-	.	ID=id1333;Note=PS00096 Serine hydroxymethyltransferase pyridoxal-phosphate attachment site.;gbkey=misc_feature;gene=glyA
BX072543.1	EMBL	gene	749768	750331	.	-	.	ID=gene628;Name=TW656;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW656
BX072543.1	EMBL	CDS	749768	750331	.	-	0	ID=cds624;Parent=gene628;Dbxref=GOA:Q83HE8,InterPro:IPR004398,InterPro:IPR029063,UniProtKB/TrEMBL:Q83HE8,NCBI_GP:CAD67317.1;Name=CAD67317.1;Note=Similar to Clostridium perfringens hypothetical protein Cpe1730 SWALL:Q8XJM6 (EMBL:AP003191) (185 aa) fasta scores: E(): 1.7e-16%2C 38.17%25 id in 186 aa%2C and to Escherichia coli putative methylase YhhF or b3465 SWALL:YHHF_ECOLI (SWALL:P10120) (198 aa) fasta scores: E(): 1.1e-11%2C 36.26%25 id in 182 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67317.1;transl_table=11
BX072543.1	EMBL	sequence_feature	749779	750331	.	-	.	ID=id1334;Note=Conserved hypothetical protein 95 Score %3D 165.7 E-value %3D 5.3e-47;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	749951	749971	.	-	.	ID=id1335;Note=PS00092 N-6 Adenine-specific DNA methylases signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	750975	751340	.	-	.	ID=gene629;Name=gcvH;gbkey=Gene;gene=gcvH;gene_biotype=protein_coding;locus_tag=TW658
BX072543.1	EMBL	CDS	750975	751340	.	-	0	ID=cds625;Parent=gene629;Dbxref=GOA:P64216,InterPro:IPR002930,InterPro:IPR003016,InterPro:IPR011053,NCBI_GP:CAD67318.1;Name=CAD67318.1;Note=Similar to Streptomyces coelicolor probable glycine cleavage system H protein GcvH or SCO5471 or SC2A11.05c SWALL:GCSH_STRCO (SWALL:O86566) (125 aa) fasta scores: E(): 3.4e-16%2C 44.26%25 id in 122 aa;gbkey=CDS;gene=gcvH;product=probable glycine cleavage system H protein;protein_id=CAD67318.1;transl_table=11
BX072543.1	EMBL	sequence_feature	750980	751322	.	-	.	ID=id1336;Note=Glycine cleavage H-protein Score %3D 122.7 E-value %3D 4.9e-34;gbkey=misc_feature;gene=gcvH
BX072543.1	EMBL	gene	751396	752466	.	-	.	ID=gene630;Name=gcvT;gbkey=Gene;gene=gcvT;gene_biotype=protein_coding;locus_tag=TW659
BX072543.1	EMBL	CDS	751396	752466	.	-	0	ID=cds626;Parent=gene630;Dbxref=GOA:Q83HE7,InterPro:IPR006222,InterPro:IPR006223,InterPro:IPR013977,InterPro:IPR027266,InterPro:IPR028896,InterPro:IPR029043,UniProtKB/TrEMBL:Q83HE7,NCBI_GP:CAD67319.1;Name=CAD67319.1;Note=Similar to Escherichia coli aminomethyltransferase GcvT or b2905 SWALL:GCST_ECOLI (SWALL:P27248) (363 aa) fasta scores: E(): 2.1e-27%2C 34.9%25 id in 361 aa%2C and to Streptomyces coelicolor probable aminomethyltransferase GcvT or SCO5472 or SC2A11.06c SWALL:GCST_STRCO (SWALL:O86567) (372 aa) fasta scores: E(): 1.9e-39%2C 43.81%25 id in 372 aa;gbkey=CDS;gene=gcvT;product=aminomethyltransferase gcvT;protein_id=CAD67319.1;transl_table=11
BX072543.1	EMBL	sequence_feature	751401	752325	.	-	.	ID=id1337;Note=Glycine cleavage T-protein (aminomethyl transferase) Score %3D 272.4 E-value %3D 4.1e-79;gbkey=misc_feature;gene=gcvT
BX072543.1	EMBL	gene	752772	753806	.	-	.	ID=gene631;Name=TW661;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW661
BX072543.1	EMBL	CDS	752772	753806	.	-	0	ID=cds627;Parent=gene631;Dbxref=GOA:Q83NB5,InterPro:IPR004396,InterPro:IPR006073,InterPro:IPR012675,InterPro:IPR012676,InterPro:IPR013029,InterPro:IPR023192,InterPro:IPR027417,UniProtKB/TrEMBL:Q83NB5,NCBI_GP:CAD67320.1;Name=CAD67320.1;Note=Similar to Corynebacterium glutamicum predicted GTPase cgl1032 SWALL:Q8NRL6 (EMBL:AP005277) (361 aa) fasta scores: E(): 1.4e-30%2C 55.3%25 id in 358 aa%2C and to Yersinia pestis hypothetical protein Ypo2010 SWALL:Q8ZEY5 (EMBL:AJ414151) (363 aa) fasta scores: E(): 2e-25%2C 43.17%25 id in 359 aa;gbkey=CDS;product=conserved ATP/GTP binding protein;protein_id=CAD67320.1;transl_table=11
BX072543.1	EMBL	sequence_feature	753680	753794	.	-	.	ID=id1338;Note=GTP1/OBG family Score %3D 14.6 E-value %3D 0.00039;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	753759	753782	.	-	.	ID=id1339;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	753874	755175	.	+	.	ID=gene632;Name=TW662;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW662
BX072543.1	EMBL	CDS	753874	755175	.	+	0	ID=cds628;Parent=gene632;Dbxref=InterPro:IPR003798,UniProtKB/TrEMBL:Q83NB4,NCBI_GP:CAD67321.1;Name=CAD67321.1;Note=Similar to Zymomonas mobilis DNA recombination protein RmuC homolog SWALL:RMUC_ZYMMO (SWALL:Q9REQ3) (448 aa) fasta scores: E(): 2.3e-22%2C 27.41%25 id in 383 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67321.1;transl_table=11
BX072543.1	EMBL	sequence_feature	753874	753945	.	+	.	ID=id1340;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.951) with cleavage site probability 0.813 between residues 24 and 25;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	754129	755041	.	+	.	ID=id1341;Note=Uncharacterized BCR%2C YigN family%2C COG1322 Score %3D 129.6 E-value %3D 3.9e-36;gbkey=misc_feature
BX072543.1	EMBL	gene	755247	755717	.	-	.	ID=gene633;Name=TW663;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW663
BX072543.1	EMBL	CDS	755247	755717	.	-	0	ID=cds629;Parent=gene633;Dbxref=UniProtKB/TrEMBL:Q83NB3,NCBI_GP:CAD67322.1;Name=CAD67322.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67322.1;transl_table=11
BX072543.1	EMBL	sequence_feature	755523	755582	.	-	.	ID=id1342;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 101-120 and 130-152;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	755358	755417	.	-	.	ID=id1342;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 101-120 and 130-152;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	755262	755330	.	-	.	ID=id1342;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 46-65%2C 101-120 and 130-152;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	755714	756655	.	-	.	ID=gene634;Name=ispH;gbkey=Gene;gene=ispH;gene_biotype=protein_coding;locus_tag=TW664
BX072543.1	EMBL	CDS	755714	756655	.	-	0	ID=cds630;Parent=gene634;Dbxref=GOA:Q83NB2,InterPro:IPR003451,NCBI_GP:CAD67323.1;Name=CAD67323.1;Note=Similar to Escherichia coli IspH protein or LytB or b0029 or z0034 or ecs0032 SWALL:BAB96598 (EMBL:AY062212) (316 aa) fasta scores: E(): 2.5e-51%2C 49.83%25 id in 309 aa%2C and to Mycobacterium tuberculosis IspH protein 1 or LytB1 or Rv1110 or mt1141 or mtv017.63 SWALL:ISH1_MYCTU (SWALL:O53458) (335 aa) fasta scores: E(): 8.4e-75%2C 67.41%25 id in 310 aa;gbkey=CDS;gene=ispH;product=IspH protein;protein_id=CAD67323.1;transl_table=11
BX072543.1	EMBL	sequence_feature	755803	756643	.	-	.	ID=id1343;Note=LytB protein Score %3D 512.1 E-value %3D 2.9e-151;gbkey=misc_feature;gene=ispH
BX072543.1	EMBL	gene	756796	758010	.	+	.	ID=gene635;Name=xseA;gbkey=Gene;gene=xseA;gene_biotype=protein_coding;locus_tag=TW665
BX072543.1	EMBL	CDS	756796	758010	.	+	0	ID=cds631;Parent=gene635;Dbxref=GOA:Q83HE6,InterPro:IPR003753,InterPro:IPR004365,InterPro:IPR020579,NCBI_GP:CAD67324.1;Name=CAD67324.1;Note=Similar to Escherichia coli exodeoxyribonuclease VII large subunit XseA or b2509 SWALL:EX7L_ECOLI (SWALL:P04994) (456 aa) fasta scores: E(): 1.1e-20%2C 26.72%25 id in 434 aa%2C and to Streptomyces coelicolor probable exodeoxyribonuclease VII large subunit XseA or SCO5056 or SCK7.29c SWALL:EX7L_STRCO (SWALL:Q9FBM3) (402 aa) fasta scores: E(): 2.3e-50%2C 39.33%25 id in 389 aa;gbkey=CDS;gene=xseA;product=exodeoxyribonuclease VII large subunit;protein_id=CAD67324.1;transl_table=11
BX072543.1	EMBL	sequence_feature	757405	757972	.	+	.	ID=id1344;Note=Exonuclease VII%2C large subunit Score %3D 103.9 E-value %3D 2.2e-28;gbkey=misc_feature;gene=xseA
BX072543.1	EMBL	gene	758059	758424	.	+	.	ID=gene636;Name=xseB;gbkey=Gene;gene=xseB;gene_biotype=protein_coding;locus_tag=TW666
BX072543.1	EMBL	CDS	758059	758424	.	+	0	ID=cds632;Parent=gene636;Dbxref=GOA:Q83HE5,InterPro:IPR003761,UniProtKB/TrEMBL:Q83HE5,NCBI_GP:CAD67325.1;Name=CAD67325.1;Note=Similar to Streptomyces coelicolor probable exodeoxyribonuclease VII small subunit XseB or SCO5055 or SCK7.28c SWALL:EX7S_STRCO (SWALL:Q9FBM4) (88 aa) fasta scores: E(): 0.0014%2C 40.62%25 id in 64 aa%2C and to Paracoccus zeaxanthinifaciens exonuclease VII small subunit XseB SWALL:CAD24424 (EMBL:AJ431697) (78 aa) fasta scores: E(): 2.7%2C 37.25%25 id in 51 aa;gbkey=CDS;gene=xseB;product=probable exodeoxyribonuclease VII small subunit;protein_id=CAD67325.1;transl_table=11
BX072543.1	EMBL	sequence_feature	758212	758395	.	+	.	ID=id1345;Note=Exonuclease VII small subunit Score %3D 46.2 E-value %3D 5.2e-11;gbkey=misc_feature;gene=xseB
BX072543.1	EMBL	gene	758459	759691	.	-	.	ID=gene637;Name=TW667;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW667
BX072543.1	EMBL	CDS	758459	759691	.	-	0	ID=cds633;Parent=gene637;Dbxref=GOA:Q83HE4,InterPro:IPR011701,InterPro:IPR016196,InterPro:IPR020846,UniProtKB/TrEMBL:Q83HE4,NCBI_GP:CAD67326.1;Name=CAD67326.1;Note=Similar to Escherichia coli probable glucarate transporter GudP or b2789 SWALL:GUDP_ECOLI (SWALL:Q46916) (450 aa) fasta scores: E(): 2.4e-37%2C 32.04%25 id in 415 aa;gbkey=CDS;product=putative integral membrane sugar transport protein;protein_id=CAD67326.1;transl_table=11
BX072543.1	EMBL	sequence_feature	758494	759685	.	-	.	ID=id1346;Note=Sugar (and other) transporter Score %3D -104.7 E-value %3D 0.0004;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	759566	759634	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=1/11;partial=true
BX072543.1	EMBL	sequence_feature	759488	759547	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=2/11;partial=true
BX072543.1	EMBL	sequence_feature	759407	759475	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=3/11;partial=true
BX072543.1	EMBL	sequence_feature	759305	759373	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=4/11;partial=true
BX072543.1	EMBL	sequence_feature	759218	759277	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=5/11;partial=true
BX072543.1	EMBL	sequence_feature	759005	759073	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=6/11;partial=true
BX072543.1	EMBL	sequence_feature	758894	758962	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=7/11;partial=true
BX072543.1	EMBL	sequence_feature	758789	758857	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=8/11;partial=true
BX072543.1	EMBL	sequence_feature	758708	758776	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=9/11;partial=true
BX072543.1	EMBL	sequence_feature	758594	758662	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=10/11;partial=true
BX072543.1	EMBL	sequence_feature	758513	758581	.	-	.	ID=id1347;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 49-68%2C 73-95%2C 107-129%2C 139-158%2C 207-229%2C 244-266%2C 279-301%2C 306-328%2C 344-366 and 371-393;gbkey=misc_feature;is_ordered=true;part=11/11;partial=true
BX072543.1	EMBL	sequence_uncertainty	759724	759797	.	+	.	ID=id1348;Note=single clone region;gbkey=unsure
BX072543.1	EMBL	sequence_uncertainty	759831	759960	.	+	.	ID=id1349;Note=single clone region;gbkey=unsure
BX072543.1	EMBL	gene	760086	761030	.	-	.	ID=gene638;Name=TW668;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW668
BX072543.1	EMBL	CDS	760086	761030	.	-	0	ID=cds634;Parent=gene638;Dbxref=GOA:Q83HE3,InterPro:IPR011611,InterPro:IPR029056,UniProtKB/TrEMBL:Q83HE3,NCBI_GP:CAD67327.1;Name=CAD67327.1;Note=Similar to Haloferax sp. 2-keto-3-deoxygluconate kinase SWALL:P94803 (EMBL:U70664) (318 aa) fasta scores: E(): 3.1e-23%2C 32.43%25 id in 296 aa%2C and to Bacillus stearothermophilus 2-keto-3-deoxy-gluconate kinase KdgK SWALL:Q9ZFM1 (EMBL:AF098273) (314 aa) fasta scores: E(): 3.5e-12%2C 28.3%25 id in 265 aa;gbkey=CDS;product=putative PfkB-family carbohydrate kinase.;protein_id=CAD67327.1;transl_table=11
BX072543.1	EMBL	sequence_feature	760124	761030	.	-	.	ID=id1350;Note=pfkB family carbohydrate kinase Score %3D 116.3 E-value %3D 4e-32;gbkey=misc_feature
BX072543.1	EMBL	gene	761023	761682	.	-	.	ID=gene639;Name=sgaE;gbkey=Gene;gene=sgaE;gene_biotype=protein_coding;locus_tag=TW669
BX072543.1	EMBL	CDS	761023	761682	.	-	0	ID=cds635;Parent=gene639;Dbxref=GOA:Q83HE2,InterPro:IPR001303,UniProtKB/TrEMBL:Q83HE2,NCBI_GP:CAD67328.1;Name=CAD67328.1;Note=Similar to Escherichia coli probable sugar isomerase SgaE or b4198 SWALL:SGAE_ECOLI (SWALL:P39306) (228 aa) fasta scores: E(): 4e-21%2C 47.95%25 id in 196 aa;gbkey=CDS;gene=sgaE;product=putative sugar isomerase;protein_id=CAD67328.1;transl_table=11
BX072543.1	EMBL	sequence_feature	761100	761676	.	-	.	ID=id1351;Note=Class II Aldolase and Adducin N-terminal domain Score %3D 244.3 E-value %3D 1.2e-70;gbkey=misc_feature;gene=sgaE
BX072543.1	EMBL	gene	761688	762542	.	-	.	ID=gene640;Name=sgaU;gbkey=Gene;gene=sgaU;gene_biotype=protein_coding;locus_tag=TW670
BX072543.1	EMBL	CDS	761688	762542	.	-	0	ID=cds636;Parent=gene640;Dbxref=GOA:Q83HE1,InterPro:IPR013022,UniProtKB/TrEMBL:Q83HE1,NCBI_GP:CAD67329.1;Name=CAD67329.1;Note=Similar to Escherichia coli putative hexulose-6-phosphate isomerase SgaU or b4197 SWALL:SGAU_ECOLI (SWALL:P39305) (284 aa) fasta scores: E(): 2.2e-35%2C 36.72%25 id in 275 aa;gbkey=CDS;gene=sgaU;product=putative sugar isomerase;protein_id=CAD67329.1;transl_table=11
BX072543.1	EMBL	sequence_feature	761711	762542	.	-	.	ID=id1352;Note=Putative hexulose-6-phosphate isomerase Score %3D 186.8 E-value %3D 2.5e-53;gbkey=misc_feature;gene=sgaU
BX072543.1	EMBL	gene	762568	763248	.	-	.	ID=gene641;Name=sgaH;gbkey=Gene;gene=sgaH;gene_biotype=protein_coding;locus_tag=TW671
BX072543.1	EMBL	CDS	762568	763248	.	-	0	ID=cds637;Parent=gene641;Dbxref=GOA:Q83HE0,InterPro:IPR001754,InterPro:IPR011060,InterPro:IPR013785,UniProtKB/TrEMBL:Q83HE0,NCBI_GP:CAD67330.1;Name=CAD67330.1;Note=Similar to Escherichia coli probable hexulose-6-phosphate synthase SgaH or b4196 SWALL:SGAH_ECOLI (SWALL:P39304) (216 aa) fasta scores: E(): 9.8e-33%2C 46.75%25 id in 216 aa;gbkey=CDS;gene=sgaH;product=probable hexulose-6-phosphate synthase;protein_id=CAD67330.1;transl_table=11
BX072543.1	EMBL	sequence_feature	762600	763215	.	-	.	ID=id1353;Note=Orotidine 5'-phosphate decarboxylase / HUMPS family Score %3D 50.7 E-value %3D 2.2e-12;gbkey=misc_feature;gene=sgaH
BX072543.1	EMBL	gene	763248	764228	.	-	.	ID=gene642;Name=TW672;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW672
BX072543.1	EMBL	CDS	763248	764228	.	-	0	ID=cds638;Parent=gene642;Dbxref=GOA:Q83HD9,InterPro:IPR001559,InterPro:IPR027280,UniProtKB/TrEMBL:Q83HD9,NCBI_GP:CAD67331.1;Name=CAD67331.1;Note=Similar to Mycoplasma pulmonis hypothetical protein Mypu_5930 SWALL:Q98PX6 (EMBL:AL445565) (351 aa) fasta scores: E(): 4.9e-39%2C 36.02%25 id in 322 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67331.1;transl_table=11
BX072543.1	EMBL	sequence_feature	763253	764219	.	-	.	ID=id1354;Note=Phosphotriesterase family Score %3D 113.1 E-value %3D 3.8e-31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	763665	763712	.	-	.	ID=id1355;Note=PS01323 Phosphotriesterase family signature 2.;gbkey=misc_feature
BX072543.1	EMBL	gene	764591	765151	.	-	.	ID=gene643;Name=pth;gbkey=Gene;gene=pth;gene_biotype=protein_coding;locus_tag=TW673
BX072543.1	EMBL	CDS	764591	765151	.	-	0	ID=cds639;Parent=gene643;Dbxref=GOA:Q83HD8,InterPro:IPR001328,InterPro:IPR018171,NCBI_GP:CAD67332.1;Name=CAD67332.1;Note=Similar to Bacillus subtilis peptidyl-tRNA hydrolase SpoVC or Pth SWALL:PTH_BACSU (SWALL:P37470) (188 aa) fasta scores: E(): 1.6e-21%2C 41.27%25 id in 172 aa%2C and to Staphylococcus aureus peptidyl-tRNA hydrolase Pth SWALL:AAK61416 (EMBL:AY035553) (190 aa) fasta scores: E(): 5e-19%2C 37.95%25 id in 166 aa;gbkey=CDS;gene=pth;product=peptidyl-tRNA hydrolase;protein_id=CAD67332.1;transl_table=11
BX072543.1	EMBL	sequence_feature	764620	765148	.	-	.	ID=id1356;Note=Peptidyl-tRNA hydrolase Score %3D 206.5 E-value %3D 2.9e-59;gbkey=misc_feature;gene=pth
BX072543.1	EMBL	sequence_feature	765065	765106	.	-	.	ID=id1357;Note=PS01195 Peptidyl-tRNA hydrolase signature 1.;gbkey=misc_feature;gene=pth
BX072543.1	EMBL	gene	765382	766143	.	-	.	ID=gene644;Name=TW674;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW674
BX072543.1	EMBL	CDS	765382	766143	.	-	0	ID=cds640;Parent=gene644;Dbxref=UniProtKB/TrEMBL:Q83NB1,NCBI_GP:CAD67333.1;Name=CAD67333.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67333.1;transl_table=11
BX072543.1	EMBL	sequence_feature	766054	766101	.	-	.	ID=id1358;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 51-73%2C 93-115%2C 161-178 and 188-210;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	765925	765993	.	-	.	ID=id1358;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 51-73%2C 93-115%2C 161-178 and 188-210;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	765799	765867	.	-	.	ID=id1358;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 51-73%2C 93-115%2C 161-178 and 188-210;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	765610	765663	.	-	.	ID=id1358;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 51-73%2C 93-115%2C 161-178 and 188-210;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	765514	765582	.	-	.	ID=id1358;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-30%2C 51-73%2C 93-115%2C 161-178 and 188-210;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	gene	766167	766376	.	-	.	ID=gene645;Name=TW675;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW675
BX072543.1	EMBL	CDS	766167	766376	.	-	0	ID=cds641;Parent=gene645;Dbxref=UniProtKB/TrEMBL:Q83HD7,NCBI_GP:CAD67334.1;Name=CAD67334.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67334.1;transl_table=11
BX072543.1	EMBL	gene	766453	766824	.	+	.	ID=gene646;Name=TW676;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW676
BX072543.1	EMBL	CDS	766453	766824	.	+	0	ID=cds642;Parent=gene646;Dbxref=UniProtKB/TrEMBL:Q83NB0,NCBI_GP:CAD67335.1;Name=CAD67335.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67335.1;transl_table=11
BX072543.1	EMBL	sequence_feature	766453	766587	.	+	.	ID=id1359;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.706) with cleavage site probability 0.606 between residues 45 and 46;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	766471	766539	.	+	.	ID=id1360;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66 and 87-109;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	766582	766650	.	+	.	ID=id1360;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66 and 87-109;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	766711	766779	.	+	.	ID=id1360;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66 and 87-109;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	766845	767408	.	-	.	ID=gene647;Name=rplY;gbkey=Gene;gene=rplY;gene_biotype=protein_coding;locus_tag=TW677
BX072543.1	EMBL	CDS	766845	767408	.	-	0	ID=cds643;Parent=gene647;Dbxref=GOA:Q83HD6,InterPro:IPR001021,InterPro:IPR011035,InterPro:IPR020056,InterPro:IPR020057,InterPro:IPR029751,NCBI_GP:CAD67336.1;Name=CAD67336.1;Note=Similar to Escherichia coli 50s ribosomal protein L25 RplY or b2185 SWALL:RL25_ECOLI (SWALL:P02426) (94 aa) fasta scores: E(): 0.0016%2C 33.7%25 id in 89 aa%2C and to Mycobacterium tuberculosis probable 50s ribosomal protein L25 RplY or Rv1015c or mt1043 or mtcy10g2.34 SWALL:RL25_MYCTU (SWALL:P96385) (215 aa) fasta scores: E(): 9.5e-17%2C 38.28%25 id in 175 aa;gbkey=CDS;gene=rplY;product=50s ribosomal protein L25;protein_id=CAD67336.1;transl_table=11
BX072543.1	EMBL	sequence_feature	767141	767393	.	-	.	ID=id1361;Note=Ribosomal L25p family Score %3D 61.3 E-value %3D 1.4e-15;gbkey=misc_feature;gene=rplY
BX072543.1	EMBL	gene	767545	768210	.	-	.	ID=gene648;Name=pgm;gbkey=Gene;gene=pgm;gene_biotype=protein_coding;locus_tag=TW678
BX072543.1	EMBL	CDS	767545	768210	.	-	0	ID=cds644;Parent=gene648;Dbxref=GOA:Q83HD5,InterPro:IPR005952,InterPro:IPR013078,InterPro:IPR029033,NCBI_GP:CAD67337.1;Name=CAD67337.1;Note=Similar to Zymomonas mobilis phosphoglycerate mutase Gpm or Pgm SWALL:PMGY_ZYMMO (SWALL:P30798) (228 aa) fasta scores: E(): 3.5e-37%2C 52.33%25 id in 214 aa;gbkey=CDS;gene=pgm;product=phosphoglycerate mutase;protein_id=CAD67337.1;transl_table=11
BX072543.1	EMBL	sequence_feature	767562	768207	.	-	.	ID=id1362;Note=Phosphoglycerate mutase family Score %3D 343.9 E-value %3D 1.2e-100;gbkey=misc_feature;gene=pgm
BX072543.1	EMBL	gene	768256	769221	.	-	.	ID=gene649;Name=TW679;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW679
BX072543.1	EMBL	CDS	768256	769221	.	-	0	ID=cds645;Parent=gene649;Dbxref=GOA:Q83HD4,InterPro:IPR006222,InterPro:IPR013977,InterPro:IPR017703,InterPro:IPR029043,UniProtKB/TrEMBL:Q83HD4,NCBI_GP:CAD67338.1;Name=CAD67338.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv0811c or mtv043.03c or mt0832 SWALL:O53825 (EMBL:AL022004) (368 aa) fasta scores: E(): 2.9e-17%2C 32.1%25 id in 352 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67338.1;transl_table=11
BX072543.1	EMBL	gene	769353	769517	.	-	.	ID=gene650;Name=TW680;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW680
BX072543.1	EMBL	CDS	769353	769517	.	-	0	ID=cds646;Parent=gene650;Dbxref=UniProtKB/TrEMBL:Q83NA9,NCBI_GP:CAD67339.1;Name=CAD67339.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67339.1;transl_table=11
BX072543.1	EMBL	sequence_feature	769368	769436	.	-	.	ID=id1363;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 28-50;gbkey=misc_feature
BX072543.1	EMBL	gene	769550	770104	.	-	.	ID=gene651;Name=TW681;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW681
BX072543.1	EMBL	CDS	769550	770104	.	-	0	ID=cds647;Parent=gene651;Dbxref=InterPro:IPR012932,UniProtKB/TrEMBL:Q83NA8,NCBI_GP:CAD67340.1;Name=CAD67340.1;Note=Similar to Corynebacterium glutamicum hypothetical membrane protein Cgl0809 SWALL:Q8NS70 (EMBL:AP005276) (196 aa) fasta scores: E(): 3.4e-15%2C 41.73%25 id in 127 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67340.1;transl_table=11
BX072543.1	EMBL	sequence_feature	770012	770080	.	-	.	ID=id1364;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 69-91%2C 98-120%2C 124-146 and 158-180;gbkey=misc_feature;is_ordered=true;part=1/5;partial=true
BX072543.1	EMBL	sequence_feature	769832	769900	.	-	.	ID=id1364;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 69-91%2C 98-120%2C 124-146 and 158-180;gbkey=misc_feature;is_ordered=true;part=2/5;partial=true
BX072543.1	EMBL	sequence_feature	769745	769813	.	-	.	ID=id1364;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 69-91%2C 98-120%2C 124-146 and 158-180;gbkey=misc_feature;is_ordered=true;part=3/5;partial=true
BX072543.1	EMBL	sequence_feature	769667	769735	.	-	.	ID=id1364;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 69-91%2C 98-120%2C 124-146 and 158-180;gbkey=misc_feature;is_ordered=true;part=4/5;partial=true
BX072543.1	EMBL	sequence_feature	769565	769633	.	-	.	ID=id1364;Note=5 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-31%2C 69-91%2C 98-120%2C 124-146 and 158-180;gbkey=misc_feature;is_ordered=true;part=5/5;partial=true
BX072543.1	EMBL	sequence_feature	769991	770104	.	-	.	ID=id1365;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.766) with cleavage site probability 0.530 between residues 38 and 39;gbkey=misc_feature
BX072543.1	EMBL	gene	770211	771188	.	+	.	ID=gene652;Name=TW682;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW682
BX072543.1	EMBL	CDS	770211	771188	.	+	0	ID=cds648;Parent=gene652;Dbxref=GOA:Q83HD3,InterPro:IPR000182,InterPro:IPR016181,UniProtKB/TrEMBL:Q83HD3,NCBI_GP:CAD67341.1;Name=CAD67341.1;Note=Similar to Streptomyces coelicolor putative acetyltransferase SCO4151 or SCD84.18c SWALL:Q9KZV0 (EMBL:AL353816) (309 aa) fasta scores: E(): 5.2e-15%2C 31.9%25 id in 257 aa%2C and to Streptomyces lavendulae streptothricin acetyltransferase Sta SWALL:STA_STRLA (SWALL:P08457) (189 aa) fasta scores: E(): 0.58%2C 27.38%25 id in 84 aa;gbkey=CDS;product=putative acetyltransferase;protein_id=CAD67341.1;transl_table=11
BX072543.1	EMBL	sequence_feature	770913	771141	.	+	.	ID=id1366;Note=Acetyltransferase (GNAT) family Score %3D 56.8 E-value %3D 3.4e-14;gbkey=misc_feature
BX072543.1	EMBL	gene	771236	772135	.	+	.	ID=gene653;Name=TW683;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW683
BX072543.1	EMBL	CDS	771236	772135	.	+	0	ID=cds649;Parent=gene653;Dbxref=GOA:Q83HD2,InterPro:IPR000086,InterPro:IPR013078,InterPro:IPR015797,InterPro:IPR020084,InterPro:IPR029033,UniProtKB/TrEMBL:Q83HD2,NCBI_GP:CAD67342.1;Name=CAD67342.1;Note=Similar to Mycobacterium tuberculosis hypothetical 34.7 kDa protein mutt1 or rv2985 or mtcy349.02c or mt3063 SWALL:P95110 (EMBL:Z83018) (317 aa) fasta scores: E(): 0.013%2C 29.66%25 id in 300 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67342.1;transl_table=11
BX072543.1	EMBL	sequence_feature	771281	771737	.	+	.	ID=id1367;Note=NUDIX domain Score %3D 53.0 E-value %3D 4.7e-13;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	771386	771445	.	+	.	ID=id1368;Note=PS00893 mutT domain signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	771752	771775	.	+	.	ID=id1369;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	tRNA	772144	772216	.	-	.	ID=rna44;Note=tRNA Lys anticodon TTT%2C Cove score 82.30;gbkey=tRNA;product=tRNA-Lys
BX072543.1	EMBL	exon	772144	772216	.	-	.	ID=id1370;Parent=rna44;Note=tRNA Lys anticodon TTT%2C Cove score 82.30;gbkey=tRNA;product=tRNA-Lys
BX072543.1	EMBL	gene	772508	773119	.	+	.	ID=gene654;Name=mscL;gbkey=Gene;gene=mscL;gene_biotype=protein_coding;locus_tag=TW684
BX072543.1	EMBL	CDS	772508	773119	.	+	0	ID=cds650;Parent=gene654;Dbxref=GOA:Q83NA7,InterPro:IPR001185,UniProtKB/TrEMBL:Q83NA7,NCBI_GP:CAD67343.1;Name=CAD67343.1;Note=Similar to Mycobacterium tuberculosis large-conductance mechanosensitive channel MscL or Rv0985c or mt1013 or mtv044.13C SWALL:MSCL_MYCTU (SWALL:O53898) (151 aa) fasta scores: E(): 1.2e-06%2C 37.62%25 id in 101 aa;gbkey=CDS;gene=mscL;product=large-conductance mechanosensitive channel;protein_id=CAD67343.1;transl_table=11
BX072543.1	EMBL	sequence_feature	772508	772835	.	+	.	ID=id1371;Note=Large-conductance mechanosensitive channel%2C MscL Score %3D 26.7 E-value %3D 2.8e-09;gbkey=misc_feature;gene=mscL
BX072543.1	EMBL	sequence_feature	772508	772606	.	+	.	ID=id1372;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.817) with cleavage site probability 0.457 between residues 33 and 34;gbkey=misc_feature;gene=mscL
BX072543.1	EMBL	sequence_feature	772544	772612	.	+	.	ID=id1373;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35 and 73-95;gbkey=misc_feature;gene=mscL;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	772724	772792	.	+	.	ID=id1373;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 13-35 and 73-95;gbkey=misc_feature;gene=mscL;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	773383	774351	.	+	.	ID=gene655;Name=TW685;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW685
BX072543.1	EMBL	CDS	773383	774351	.	+	0	ID=cds651;Parent=gene655;Dbxref=GOA:Q83NA6,InterPro:IPR006127,InterPro:IPR006128,InterPro:IPR006129,UniProtKB/TrEMBL:Q83NA6,NCBI_GP:CAD67344.1;Name=CAD67344.1;Note=Similar to Synechocystis sp. periplasmic-binding protein MntC or sll1598 SWALL:Q55280 (EMBL:L34630) (330 aa) fasta scores: E(): 6.3e-36%2C 38.06%25 id in 289 aa;gbkey=CDS;product=putative ABC-transporter periplasmic solute-binding subunit;protein_id=CAD67344.1;transl_table=11
BX072543.1	EMBL	sequence_feature	773458	774337	.	+	.	ID=id1374;Note=Periplasmic solute binding protein family Score %3D 252.2 E-value %3D 5.1e-73;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	773464	773496	.	+	.	ID=id1375;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	774394	775203	.	+	.	ID=gene656;Name=TW686;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW686
BX072543.1	EMBL	CDS	774394	775203	.	+	0	ID=cds652;Parent=gene656;Dbxref=GOA:Q83HD1,InterPro:IPR003439,InterPro:IPR003593,InterPro:IPR017871,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HD1,NCBI_GP:CAD67345.1;Name=CAD67345.1;Note=Similar to Synechocystis sp. manganese transport system ATP-binding protein MntA or sll1599 SWALL:MNTA_SYNY3 (SWALL:Q55281) (260 aa) fasta scores: E(): 6.6e-34%2C 46.18%25 id in 236 aa;gbkey=CDS;product=putative ABC transporter ATP-binding subunit;protein_id=CAD67345.1;transl_table=11
BX072543.1	EMBL	sequence_feature	774487	775042	.	+	.	ID=id1376;Note=ABC transporter Score %3D 167.0 E-value %3D 2.2e-47;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	774508	774531	.	+	.	ID=id1377;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	774817	774861	.	+	.	ID=id1378;Note=PS00211 ABC transporters family signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	775284	776138	.	+	.	ID=gene657;Name=TW687;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW687
BX072543.1	EMBL	CDS	775284	776138	.	+	0	ID=cds653;Parent=gene657;Dbxref=GOA:Q83NA5,InterPro:IPR001626,InterPro:IPR029022,UniProtKB/TrEMBL:Q83NA5,NCBI_GP:CAD67346.1;Name=CAD67346.1;Note=Similar to Synechocystis sp. manganese transport system membrane protein MntB or sll1600 SWALL:MNTB_SYNY3 (SWALL:Q55282) (306 aa) fasta scores: E(): 6.7e-40%2C 43.41%25 id in 258 aa;gbkey=CDS;product=putative ABC transporter integral membrane subunit;protein_id=CAD67346.1;transl_table=11
BX072543.1	EMBL	sequence_feature	775311	776079	.	+	.	ID=id1379;Note=ABC 3 transport family Score %3D 310.6 E-value %3D 1.4e-90;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	775344	775412	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	775455	775523	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	775560	775628	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	775671	775730	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	775791	775859	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	775869	775928	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	775947	776006	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	776034	776102	.	+	.	ID=id1380;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 58-80%2C 93-115%2C 130-149%2C 170-192%2C 196-215%2C 222-241 and 251-273;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	gene	776233	778524	.	+	.	ID=gene658;Name=TW688;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW688
BX072543.1	EMBL	CDS	776233	778524	.	+	0	ID=cds654;Parent=gene658;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83NA4,NCBI_GP:CAD67347.1;Name=CAD67347.1;Note=No significant database matches.;gbkey=CDS;product=WiSP family protein;protein_id=CAD67347.1;transl_table=11
BX072543.1	EMBL	sequence_feature	776233	776337	.	+	.	ID=id1381;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.804 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	gene	778689	779474	.	-	.	ID=gene659;Name=TW689;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW689
BX072543.1	EMBL	CDS	778689	779474	.	-	0	ID=cds655;Parent=gene659;Dbxref=UniProtKB/TrEMBL:Q83NA3,NCBI_GP:CAD67348.1;Name=CAD67348.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67348.1;transl_table=11
BX072543.1	EMBL	sequence_feature	779397	779465	.	-	.	ID=id1382;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 93-115 and 120-142;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	779130	779198	.	-	.	ID=id1382;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 93-115 and 120-142;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	779049	779117	.	-	.	ID=id1382;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 4-26%2C 93-115 and 120-142;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	779364	779474	.	-	.	ID=id1383;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.673) with cleavage site probability 0.605 between residues 37 and 38;gbkey=misc_feature
BX072543.1	EMBL	gene	779537	780148	.	+	.	ID=gene660;Name=TW690;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW690
BX072543.1	EMBL	CDS	779537	780148	.	+	0	ID=cds656;Parent=gene660;Dbxref=InterPro:IPR002698,InterPro:IPR024185,UniProtKB/TrEMBL:Q83HD0,NCBI_GP:CAD67349.1;Name=CAD67349.1;Note=Similar to Aquifex aeolicus hypothetical protein Aq_1731 SWALL:O67621 (EMBL:AE000753) (186 aa) fasta scores: E(): 2.9e-10%2C 33.71%25 id in 175 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67349.1;transl_table=11
BX072543.1	EMBL	sequence_feature	779540	780086	.	+	.	ID=id1384;Note=5-formyltetrahydrofolate cyclo-ligase family Score %3D 93.8 E-value %3D 2.4e-25;gbkey=misc_feature
BX072543.1	EMBL	gene	780347	783865	.	-	.	ID=gene661;Name=TW691;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW691
BX072543.1	EMBL	CDS	780347	783865	.	-	0	ID=cds657;Parent=gene661;Dbxref=InterPro:IPR027417,UniProtKB/TrEMBL:Q83HC9,NCBI_GP:CAD67350.1;Name=CAD67350.1;Note=Weak but full length similarity to Bifidobacterium longum NCC2705 large hypothetical protein bl1552 SWALL:AAN25344 (EMBL:AE014790) (1207 aa) fasta scores: E(): 1.3e-24%2C 23.73%25 id in 1201 aa;gbkey=CDS;product=conserved large hypothetical protein;protein_id=CAD67350.1;transl_table=11
BX072543.1	EMBL	gene	784091	786109	.	+	.	ID=gene662;Name=TW692;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW692
BX072543.1	EMBL	CDS	784091	786109	.	+	0	ID=cds658;Parent=gene662;Dbxref=UniProtKB/TrEMBL:Q83NA2,NCBI_GP:CAD67351.1;Name=CAD67351.1;Note=Similar to Deinococcus radiodurans hypothetical protein Dr2265 SWALL:Q9RS62 (EMBL:AE002059) (725 aa) fasta scores: E(): 2.1e-42%2C 42.99%25 id in 728 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67351.1;transl_table=11
BX072543.1	EMBL	sequence_feature	784316	784384	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=1/11;partial=true
BX072543.1	EMBL	sequence_feature	784484	784552	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=2/11;partial=true
BX072543.1	EMBL	sequence_feature	784610	784669	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=3/11;partial=true
BX072543.1	EMBL	sequence_feature	784688	784756	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=4/11;partial=true
BX072543.1	EMBL	sequence_feature	784814	784882	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=5/11;partial=true
BX072543.1	EMBL	sequence_feature	785003	785071	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=6/11;partial=true
BX072543.1	EMBL	sequence_feature	785180	785248	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=7/11;partial=true
BX072543.1	EMBL	sequence_feature	785285	785353	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=8/11;partial=true
BX072543.1	EMBL	sequence_feature	785366	785434	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=9/11;partial=true
BX072543.1	EMBL	sequence_feature	785453	785512	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=10/11;partial=true
BX072543.1	EMBL	sequence_feature	785525	785593	.	+	.	ID=id1385;Note=11 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 76-98%2C 132-154%2C 174-193%2C 200-222%2C 242-264%2C 305-327%2C 364-386%2C 399-421%2C 426-448%2C 455-474 and 479-501;gbkey=misc_feature;is_ordered=true;part=11/11;partial=true
BX072543.1	EMBL	gene	786619	787059	.	+	.	ID=gene663;Name=TW693;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW693
BX072543.1	EMBL	CDS	786619	787059	.	+	0	ID=cds659;Parent=gene663;Dbxref=UniProtKB/TrEMBL:Q83NA1,NCBI_GP:CAD67352.1;Name=CAD67352.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67352.1;transl_table=11
BX072543.1	EMBL	sequence_feature	786619	786735	.	+	.	ID=id1386;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.843) with cleavage site probability 0.320 between residues 39 and 40;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	786664	786717	.	+	.	ID=id1387;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 16-33%2C 43-65%2C 85-107 and 117-139;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	786745	786813	.	+	.	ID=id1387;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 16-33%2C 43-65%2C 85-107 and 117-139;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	786871	786939	.	+	.	ID=id1387;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 16-33%2C 43-65%2C 85-107 and 117-139;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	786967	787035	.	+	.	ID=id1387;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 16-33%2C 43-65%2C 85-107 and 117-139;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	787370	789475	.	-	.	ID=gene664;Name=fusA;gbkey=Gene;gene=fusA;gene_biotype=protein_coding;locus_tag=TW694
BX072543.1	EMBL	CDS	787370	789475	.	-	0	ID=cds660;Parent=gene664;Dbxref=GOA:Q83NA0,InterPro:IPR000640,InterPro:IPR000795,InterPro:IPR004161,InterPro:IPR004540,InterPro:IPR005225,InterPro:IPR005517,InterPro:IPR009000,InterPro:IPR009022,InterPro:IPR014721,InterPro:IPR020568,InterPro:IPR027417,NCBI_GP:CAD67353.1;Name=CAD67353.1;Note=Similar to Thermus thermophilus elongation factor G FusA or Fus SWALL:EFG_THETH (SWALL:P13551) (691 aa) fasta scores: E(): 1.5e-146%2C 59.45%25 id in 698 aa;gbkey=CDS;gene=fusA;product=elongation factor G;protein_id=CAD67353.1;transl_table=11
BX072543.1	EMBL	sequence_feature	787396	787657	.	-	.	ID=id1388;Note=Elongation factor G C-terminus Score %3D 162.7 E-value %3D 4.5e-46;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	sequence_feature	787663	788029	.	-	.	ID=id1389;Note=Elongation factor G%2C domain IV Score %3D 236.2 E-value %3D 3.3e-68;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	sequence_feature	788293	788530	.	-	.	ID=id1390;Note=Elongation factor Tu domain 2 Score %3D 68.0 E-value %3D 1.4e-17;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	sequence_feature	788608	789448	.	-	.	ID=id1391;Note=Elongation factor Tu GTP binding domain Score %3D 376.6 E-value %3D 1.8e-110;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	sequence_feature	789272	789319	.	-	.	ID=id1392;Note=PS00301 GTP-binding elongation factors signature.;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	sequence_feature	789398	789421	.	-	.	ID=id1393;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=fusA
BX072543.1	EMBL	gene	789511	789981	.	-	.	ID=gene665;Name=rpsG;gbkey=Gene;gene=rpsG;gene_biotype=protein_coding;locus_tag=TW695
BX072543.1	EMBL	CDS	789511	789981	.	-	0	ID=cds661;Parent=gene665;Dbxref=GOA:Q83HC8,InterPro:IPR000235,InterPro:IPR005717,InterPro:IPR020606,InterPro:IPR023798,NCBI_GP:CAD67354.1;Name=CAD67354.1;Note=Similar to Mycobacterium smegmatis 30s ribosomal protein S7 RpsG SWALL:RS7_MYCSM (SWALL:P41193) (155 aa) fasta scores: E(): 3.1e-38%2C 66.45%25 id in 155 aa;gbkey=CDS;gene=rpsG;product=30S ribosomal protein S7;protein_id=CAD67354.1;transl_table=11
BX072543.1	EMBL	sequence_feature	789516	789981	.	-	.	ID=id1394;Note=Ribosomal protein S7p/S5e Score %3D 276.1 E-value %3D 3.2e-80;gbkey=misc_feature;gene=rpsG
BX072543.1	EMBL	sequence_feature	789844	789924	.	-	.	ID=id1395;Note=PS00052 Ribosomal protein S7 signature.;gbkey=misc_feature;gene=rpsG
BX072543.1	EMBL	gene	789981	790355	.	-	.	ID=gene666;Name=rpsL;gbkey=Gene;gene=rpsL;gene_biotype=protein_coding;locus_tag=TW696
BX072543.1	EMBL	CDS	789981	790355	.	-	0	ID=cds662;Parent=gene666;Dbxref=GOA:Q83HC7,InterPro:IPR005679,InterPro:IPR006032,InterPro:IPR012340,NCBI_GP:CAD67355.1;Name=CAD67355.1;Note=Similar to Mycobacterium tuberculosis 30s ribosomal protein S12 RpsL or Rps12 or Rv0682 or mt0710 or mtv040.10 SWALL:RS12_MYCTU (SWALL:P41196) (124 aa) fasta scores: E(): 3.6e-37%2C 81.3%25 id in 123 aa;gbkey=CDS;gene=rpsL;product=30S ribosomal protein S12;protein_id=CAD67355.1;transl_table=11
BX072543.1	EMBL	sequence_feature	789989	790283	.	-	.	ID=id1396;Note=Ribosomal protein S12 Score %3D 187.0 E-value %3D 2.1e-53;gbkey=misc_feature;gene=rpsL
BX072543.1	EMBL	sequence_feature	790206	790229	.	-	.	ID=id1397;Note=PS00055 Ribosomal protein S12 signature.;gbkey=misc_feature;gene=rpsL
BX072543.1	EMBL	gene	790518	790790	.	+	.	ID=gene667;Name=TW697;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW697
BX072543.1	EMBL	CDS	790518	790790	.	+	0	ID=cds663;Parent=gene667;Dbxref=UniProtKB/TrEMBL:Q83HC6,NCBI_GP:CAD67356.1;Name=CAD67356.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67356.1;transl_table=11
BX072543.1	EMBL	gene	791029	791394	.	+	.	ID=gene668;Name=TW698;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW698
BX072543.1	EMBL	CDS	791029	791394	.	+	0	ID=cds664;Parent=gene668;Dbxref=InterPro:IPR025443,UniProtKB/TrEMBL:Q83N99,NCBI_GP:CAD67357.1;Name=CAD67357.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67357.1;transl_table=11
BX072543.1	EMBL	sequence_feature	791029	791157	.	+	.	ID=id1398;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.995) with cleavage site probability 0.510 between residues 43 and 44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	791071	791139	.	+	.	ID=id1399;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 15-37;gbkey=misc_feature
BX072543.1	EMBL	gene	791384	791872	.	+	.	ID=gene669;Name=greA;gbkey=Gene;gene=greA;gene_biotype=protein_coding;locus_tag=TW699
BX072543.1	EMBL	CDS	791384	791872	.	+	0	ID=cds665;Parent=gene669;Dbxref=GOA:Q83HC5,InterPro:IPR001437,InterPro:IPR018151,InterPro:IPR022691,InterPro:IPR023459,UniProtKB/TrEMBL:Q83HC5,NCBI_GP:CAD67358.1;Name=CAD67358.1;Note=Similar to Escherichia coli transcription elongation factor GreA or b3181 SWALL:GREA_ECOLI (SWALL:P21346) (158 aa) fasta scores: E(): 1.6e-05%2C 30.76%25 id in 143 aa%2C and to Mycobacterium tuberculosis transcription elongation factor GreA or Rv1080c or mt1111 or mtv017.33C SWALL:GREA_MYCTU (SWALL:O53428) (164 aa) fasta scores: E(): 7.4e-18%2C 42.33%25 id in 163 aa;gbkey=CDS;gene=greA;product=transcription elongation factor GreA;protein_id=CAD67358.1;transl_table=11
BX072543.1	EMBL	sequence_feature	791390	791612	.	+	.	ID=id1400;Note=Prokaryotic transcription elongation factor%2C GreA/GreB%2C N-terminal domain Score %3D 90.4 E-value %3D 2.6e-24;gbkey=misc_feature;gene=greA
BX072543.1	EMBL	gene	791981	793264	.	-	.	ID=gene670;Name=tdcB;gbkey=Gene;gene=tdcB;gene_biotype=protein_coding;locus_tag=TW700
BX072543.1	EMBL	CDS	791981	793264	.	-	0	ID=cds666;Parent=gene670;Dbxref=GOA:Q83HC4,InterPro:IPR000634,InterPro:IPR001926,InterPro:IPR002912,InterPro:IPR005789,UniProtKB/TrEMBL:Q83HC4,NCBI_GP:CAD67359.1;Name=CAD67359.1;Note=Similar to Salmonella typhimurium threonine dehydratase catabolic TdcB or stm3244 SWALL:THD2_SALTY (SWALL:P11954) (329 aa) fasta scores: E(): 3.5e-20%2C 36.93%25 id in 333 aa%2C and to Streptomyces coelicolor putative amino acid deaminase SCO4962 or 2SCK31.22 SWALL:Q9EWG3 (EMBL:AL512667) (409 aa) fasta scores: E(): 2.8e-30%2C 41.66%25 id in 420 aa;gbkey=CDS;gene=tdcB;product=threonine dehydratase;protein_id=CAD67359.1;transl_table=11
BX072543.1	EMBL	sequence_feature	791986	792232	.	-	.	ID=id1401;Note=ACT domain Score %3D 25.7 E-value %3D 7.5e-05;gbkey=misc_feature;gene=tdcB
BX072543.1	EMBL	sequence_feature	792298	793213	.	-	.	ID=id1402;Note=Pyridoxal-phosphate dependent enzyme Score %3D 231.9 E-value %3D 6.7e-67;gbkey=misc_feature;gene=tdcB
BX072543.1	EMBL	sequence_feature	792893	792979	.	-	.	ID=id1403;Note=PS00061 Short-chain dehydrogenases/reductases family signature.;gbkey=misc_feature;gene=tdcB
BX072543.1	EMBL	sequence_feature	793088	793129	.	-	.	ID=id1404;Note=PS00165 Serine/threonine dehydratases pyridoxal-phosphate attachment site.;gbkey=misc_feature;gene=tdcB
BX072543.1	EMBL	gene	793275	794258	.	-	.	ID=gene671;Name=TW701;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW701
BX072543.1	EMBL	CDS	793275	794258	.	-	0	ID=cds667;Parent=gene671;Dbxref=GOA:Q83N98,InterPro:IPR000358,InterPro:IPR009078,InterPro:IPR012348,InterPro:IPR026023,UniProtKB/TrEMBL:Q83N98,NCBI_GP:CAD67360.1;Name=CAD67360.1;Note=Similar to Chlamydia muridarum ribonucleoside-diphosphate reductase beta chain NrdB or tc0215 SWALL:RIR2_CHLMU (SWALL:Q9PL92) (346 aa) fasta scores: E(): 3.4e-43%2C 36.39%25 id in 316 aa%2C and to Schizosaccharomyces pombe ribonucleoside-diphosphate reductase small chain Suc22 or spbc25d12.04 SWALL:RIR2_SCHPO (SWALL:P36603) (391 aa) fasta scores: E(): 1.7e-10%2C 27.47%25 id in 313 aa;gbkey=CDS;product=ribonucleotide-diphosphate reductase small chain;protein_id=CAD67360.1;transl_table=11
BX072543.1	EMBL	sequence_feature	793361	794255	.	-	.	ID=id1405;Note=Ribonucleotide reductase%2C small chain Score %3D 130.3 E-value %3D 2.5e-36;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	793695	793763	.	-	.	ID=id1406;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 166-188;gbkey=misc_feature
BX072543.1	EMBL	gene	794354	796732	.	-	.	ID=gene672;Name=TW702;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW702
BX072543.1	EMBL	CDS	794354	796732	.	-	0	ID=cds668;Parent=gene672;Dbxref=GOA:Q83N97,InterPro:IPR000788,InterPro:IPR005144,InterPro:IPR008926,InterPro:IPR013346,InterPro:IPR013509,UniProtKB/TrEMBL:Q83N97,NCBI_GP:CAD67361.1;Name=CAD67361.1;Note=Similar to White spot syndrome virus ribonucleotide reductase large subunit rr1 SWALL:Q91PK3 (EMBL:AF132669) (848 aa) fasta scores: E(): 3.8e-74%2C 32.54%25 id in 799 aa%2C and to Trypanosoma brucei brucei ribonucleoside-diphosphate reductase large chain Rnr1 SWALL:RIR1_TRYBB (SWALL:O15909) (838 aa) fasta scores: E(): 1.4e-73%2C 32.9%25 id in 778 aa;gbkey=CDS;product=ribonucleotide-diphosphate reductase large chain;protein_id=CAD67361.1;transl_table=11
BX072543.1	EMBL	sequence_feature	794455	796069	.	-	.	ID=id1407;Note=Ribonucleotide reductase%2C barrel domain Score %3D 432.1 E-value %3D 3.6e-127;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	794867	794932	.	-	.	ID=id1408;Note=PS00089 Ribonucleotide reductase large subunit signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	796075	796303	.	-	.	ID=id1409;Note=Ribonucleotide reductase%2C all-alpha domain Score %3D 37.0 E-value %3D 3.1e-08;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	796459	796726	.	-	.	ID=id1410;Note=ATP cone domain Score %3D 25.5 E-value %3D 8.9e-05;gbkey=misc_feature
BX072543.1	EMBL	gene	796846	798072	.	+	.	ID=gene673;Name=TW703;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW703
BX072543.1	EMBL	CDS	796846	798072	.	+	0	ID=cds669;Parent=gene673;Dbxref=GOA:Q83N96,InterPro:IPR011701,InterPro:IPR016196,InterPro:IPR020846,UniProtKB/TrEMBL:Q83N96,NCBI_GP:CAD67362.1;Name=CAD67362.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67362.1;transl_table=11
BX072543.1	EMBL	sequence_feature	796906	796974	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	796990	797058	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	797077	797145	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	797158	797226	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	797263	797331	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	797359	797427	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	797485	797553	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	797596	797664	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	797683	797742	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	797755	797823	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	797860	797928	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	797941	798009	.	+	.	ID=id1411;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 21-43%2C 49-71%2C 78-100%2C 105-127%2C 140-162%2C 172-194%2C 214-236%2C 251-273%2C 280-299%2C 304-326%2C 339-361 and 366-388;gbkey=misc_feature;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	gene	798257	799102	.	+	.	ID=gene674;Name=TW704;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW704
BX072543.1	EMBL	CDS	798257	799102	.	+	0	ID=cds670;Parent=gene674;Dbxref=GOA:Q83N95,InterPro:IPR004808,InterPro:IPR005135,UniProtKB/TrEMBL:Q83N95,NCBI_GP:CAD67363.1;Name=CAD67363.1;Note=Similar to Corynebacterium glutamicum exonuclease III cgl0671 SWALL:Q8NSK0 (EMBL:AP005276) (304 aa) fasta scores: E(): 1.6e-10%2C 39.87%25 id in 316 aa%2C and to Bos taurus DNA-(apurinic or apyrimidinic site) lyase ApeX1 or ApeX or Ape or Bap1 SWALL:APE1_BOVIN (SWALL:P23196) (317 aa) fasta scores: E(): 0.002%2C 28.67%25 id in 286 aa;gbkey=CDS;product=putative exodeoxyribonuclease;protein_id=CAD67363.1;transl_table=11
BX072543.1	EMBL	sequence_feature	798260	799091	.	+	.	ID=id1412;Note=Endonuclease/Exonuclease/phosphatase family Score %3D 131.0 E-value %3D 1.5e-36;gbkey=misc_feature
BX072543.1	EMBL	gene	799092	800099	.	+	.	ID=gene675;Name=trpS;gbkey=Gene;gene=trpS;gene_biotype=protein_coding;locus_tag=TW705
BX072543.1	EMBL	CDS	799092	800099	.	+	0	ID=cds671;Parent=gene675;Dbxref=GOA:Q83HC3,InterPro:IPR001412,InterPro:IPR002305,InterPro:IPR002306,InterPro:IPR014729,InterPro:IPR024109,NCBI_GP:CAD67364.1;Name=CAD67364.1;Note=Similar to Escherichia coli tryptophanyl-tRNA synthetase TrpS or b3384 SWALL:SYW_ECOLI (SWALL:P00954) (334 aa) fasta scores: E(): 2.8e-51%2C 44.51%25 id in 328 aa%2C and to Streptomyces coelicolor tryptophanyl-tRNA synthetase TrpS2 or SCO4839 or SC5G8.07 SWALL:Q9KZA7 (EMBL:AL353872) (339 aa) fasta scores: E(): 8.7e-65%2C 52.58%25 id in 329 aa;gbkey=CDS;gene=trpS;product=tryptophanyl-tRNA synthetase;protein_id=CAD67364.1;transl_table=11
BX072543.1	EMBL	sequence_feature	799116	799959	.	+	.	ID=id1413;Note=tRNA synthetases class I (W and Y) Score %3D 268.1 E-value %3D 8.5e-78;gbkey=misc_feature;gene=trpS
BX072543.1	EMBL	sequence_feature	799149	799181	.	+	.	ID=id1414;Note=PS00178 Aminoacyl-transfer RNA synthetases class-I signature.;gbkey=misc_feature;gene=trpS
BX072543.1	EMBL	gene	800071	801186	.	+	.	ID=gene676;Name=ribD;gbkey=Gene;gene=ribD;gene_biotype=protein_coding;locus_tag=TW706
BX072543.1	EMBL	CDS	800071	801186	.	+	0	ID=cds672;Parent=gene676;Dbxref=GOA:Q83HC2,InterPro:IPR002125,InterPro:IPR002734,InterPro:IPR004794,InterPro:IPR016192,InterPro:IPR016193,InterPro:IPR024072,UniProtKB/TrEMBL:Q83HC2,NCBI_GP:CAD67365.1;Name=CAD67365.1;Note=Similar to Escherichia coli riboflavin biosynthesis protein RibD [includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) (riboflavin-specific deaminase)%3B 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193) (htp reductase)] RibD or RibG or b0414 SWALL:RIBD_ECOLI (SWALL:P25539) (367 aa) fasta scores: E(): 4.6e-20%2C 33.52%25 id in 358 aa;gbkey=CDS;gene=ribD;product=riboflavin biosynthesis protein RibD;protein_id=CAD67365.1;transl_table=11
BX072543.1	EMBL	sequence_feature	800095	800398	.	+	.	ID=id1415;Note=Cytidine and deoxycytidylate deaminase zinc-binding region Score %3D 64.0 E-value %3D 2.3e-16;gbkey=misc_feature;gene=ribD
BX072543.1	EMBL	sequence_feature	800245	800364	.	+	.	ID=id1416;Note=PS00903 Cytidine and deoxycytidylate deaminases zinc-binding region signature.;gbkey=misc_feature;gene=ribD
BX072543.1	EMBL	sequence_feature	800530	801079	.	+	.	ID=id1417;Note=RibD C-terminal domain Score %3D 112.1 E-value %3D 7.7e-31;gbkey=misc_feature;gene=ribD
BX072543.1	EMBL	gene	801259	801903	.	+	.	ID=gene677;Name=ribE;gbkey=Gene;gene=ribE;gene_biotype=protein_coding;locus_tag=TW707
BX072543.1	EMBL	CDS	801259	801903	.	+	0	ID=cds673;Parent=gene677;Dbxref=GOA:Q83HC1,InterPro:IPR001783,InterPro:IPR017938,InterPro:IPR023366,InterPro:IPR026017,UniProtKB/TrEMBL:Q83HC1,NCBI_GP:CAD67366.1;Name=CAD67366.1;Note=Similar to Bacillus subtilis riboflavin synthase alpha chain RibE or RibB SWALL:RISA_BACSU (SWALL:P16440) (215 aa) fasta scores: E(): 6.3e-11%2C 32.86%25 id in 213 aa%2C and to Streptococcus agalactiae hypothetical protein gbs0768 SWALL:CAD46412 (EMBL:AL766847) (216 aa) fasta scores: E(): 6.7e-13%2C 36.15%25 id in 213 aa;gbkey=CDS;gene=ribE;product=riboflavin synthase alpha chain;protein_id=CAD67366.1;transl_table=11
BX072543.1	EMBL	sequence_feature	801259	801511	.	+	.	ID=id1418;Note=Lumazine binding domain Score %3D 51.3 E-value %3D 1.5e-12;gbkey=misc_feature;gene=ribE
BX072543.1	EMBL	sequence_feature	801550	801847	.	+	.	ID=id1419;Note=Lumazine binding domain Score %3D 79.9 E-value %3D 3.8e-21;gbkey=misc_feature;gene=ribE
BX072543.1	EMBL	gene	801930	802577	.	+	.	ID=gene678;Name=ribB;gbkey=Gene;gene=ribB;gene_biotype=protein_coding;locus_tag=TW708
BX072543.1	EMBL	CDS	801930	802577	.	+	0	ID=cds674;Parent=gene678;Dbxref=GOA:Q83N94,InterPro:IPR000422,InterPro:IPR017945,UniProtKB/TrEMBL:Q83N94,NCBI_GP:CAD67367.1;Name=CAD67367.1;Note=Similar to Escherichia coli 3%2C4-dihydroxy-2-butanone 4-phosphate synthase RibB SWALL:RIBB_ECO57 (SWALL:P24199) (217 aa) fasta scores: E(): 2.6e-29%2C 43.78%25 id in 201 aa%2C and to Streptomyces coelicolor 3%2C4-dihydroxy-2-butanone 4-phosphate synthase RibA or SCO1441 or SC6D7A.04c SWALL:Q9EWJ8 (EMBL:AL450443) (429 aa) fasta scores: E(): 1.6e-32%2C 47%25 id in 200 aa;gbkey=CDS;gene=ribB;product=3%2C4-dihydroxy-2-butanone 4-phosphate synthase;protein_id=CAD67367.1;transl_table=11
BX072543.1	EMBL	sequence_feature	801939	802527	.	+	.	ID=id1420;Note=3%2C4-dihydroxy-2-butanone 4-phosphate synthase Score %3D 289.6 E-value %3D 2.8e-84;gbkey=misc_feature;gene=ribB
BX072543.1	EMBL	gene	802594	803229	.	+	.	ID=gene679;Name=ribA;gbkey=Gene;gene=ribA;gene_biotype=protein_coding;locus_tag=TW709
BX072543.1	EMBL	CDS	802594	803229	.	+	0	ID=cds675;Parent=gene679;Dbxref=GOA:Q83HC0,InterPro:IPR000926,UniProtKB/TrEMBL:Q83HC0,NCBI_GP:CAD67368.1;Name=CAD67368.1;Note=Similar to Streptomyces coelicolor GTP cyclohydrolase II RibA or SCO6655 or SC5A7.05 SWALL:GCH2_STRCO (SWALL:O88011) (221 aa) fasta scores: E(): 5.3e-34%2C 52.12%25 id in 188 aa%2C and to Arabidopsis thaliana GTP cyclohydrolase II SWALL:GCH2_ARATH (SWALL:P47924) (245 aa) fasta scores: E(): 1.3e-31%2C 47.54%25 id in 183 aa;gbkey=CDS;gene=ribA;product=GTP cyclohydrolase II;protein_id=CAD67368.1;transl_table=11
BX072543.1	EMBL	sequence_feature	802645	803149	.	+	.	ID=id1421;Note=GTP cyclohydrolase II Score %3D 272.7 E-value %3D 3.4e-79;gbkey=misc_feature;gene=ribA
BX072543.1	EMBL	gene	803253	803723	.	+	.	ID=gene680;Name=ribH;gbkey=Gene;gene=ribH;gene_biotype=protein_coding;locus_tag=TW710
BX072543.1	EMBL	CDS	803253	803723	.	+	0	ID=cds676;Parent=gene680;Dbxref=GOA:Q83HB9,InterPro:IPR002180,NCBI_GP:CAD67369.1;Name=CAD67369.1;Note=Similar to Aquifex aeolicus 6%2C7-dimethyl-8-ribityllumazine synthase RibH or aq_132 SWALL:RISB_AQUAE (SWALL:O66529) (154 aa) fasta scores: E(): 1.7e-11%2C 36.69%25 id in 139 aa;gbkey=CDS;gene=ribH;product=6%2C7-dimethyl-8-ribityllumazine synthase;protein_id=CAD67369.1;transl_table=11
BX072543.1	EMBL	sequence_feature	803313	803718	.	+	.	ID=id1422;Note=6%2C7-dimethyl-8-ribityllumazine synthase Score %3D 97.0 E-value %3D 2.6e-26;gbkey=misc_feature;gene=ribH
BX072543.1	EMBL	gene	803796	804407	.	-	.	ID=gene681;Name=pncA;gbkey=Gene;gene=pncA;gene_biotype=protein_coding;locus_tag=TW711
BX072543.1	EMBL	CDS	803796	804407	.	-	0	ID=cds677;Parent=gene681;Dbxref=GOA:Q83N93,InterPro:IPR000868,UniProtKB/TrEMBL:Q83N93,NCBI_GP:CAD67370.1;Name=CAD67370.1;Note=Similar to Mycobacterium tuberculosis pyrazinamidase/nicotinamidase PncA or Rv2043c or mtv018.30c or mt2103 SWALL:Q50575 (EMBL:U59967) (186 aa) fasta scores: E(): 1.6e-28%2C 43.85%25 id in 187 aa;gbkey=CDS;gene=pncA;product=pyrazinamidase/nicotinamidase;protein_id=CAD67370.1;transl_table=11
BX072543.1	EMBL	sequence_feature	803828	804377	.	-	.	ID=id1423;Note=Isochorismatase family Score %3D -6.0 E-value %3D 4.3e-05;gbkey=misc_feature;gene=pncA
BX072543.1	EMBL	tRNA	804530	804603	.	-	.	ID=rna45;Note=tRNA Thr anticodon CGT%2C Cove score 74.72;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	exon	804530	804603	.	-	.	ID=id1424;Parent=rna45;Note=tRNA Thr anticodon CGT%2C Cove score 74.72;gbkey=tRNA;product=tRNA-Thr
BX072543.1	EMBL	gene	804753	806291	.	-	.	ID=gene682;Name=TW712;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW712
BX072543.1	EMBL	CDS	804753	806291	.	-	0	ID=cds678;Parent=gene682;Dbxref=InterPro:IPR000073,InterPro:IPR013595,InterPro:IPR029058,UniProtKB/TrEMBL:Q83N92,NCBI_GP:CAD67371.1;Name=CAD67371.1;Note=Similar to Streptomyces lividans proteinase slpE SWALL:Q54399 (EMBL:L42759) (513 aa) fasta scores: E(): 1.6e-39%2C 34.32%25 id in 536 aa;gbkey=CDS;product=putative secreted proteinase;protein_id=CAD67371.1;transl_table=11
BX072543.1	EMBL	sequence_feature	806196	806291	.	-	.	ID=id1425;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.459 between residues 32 and 33;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	806229	806261	.	-	.	ID=id1426;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	806432	807667	.	-	.	ID=gene683;Name=TW713;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW713
BX072543.1	EMBL	CDS	806432	807667	.	-	0	ID=cds679;Parent=gene683;Dbxref=InterPro:IPR027417,UniProtKB/TrEMBL:Q83N91,NCBI_GP:CAD67372.1;Name=CAD67372.1;Note=Similar to Streptomyces coelicolor putative DNA polymerase SCO3541 or SCH5.03C SWALL:Q9X906 (EMBL:AL035636) (401 aa) fasta scores: E(): 1.2e-25%2C 30.36%25 id in 359 aa;gbkey=CDS;product=putative DNA polymerase;protein_id=CAD67372.1;transl_table=11
BX072543.1	EMBL	gene	807832	808431	.	-	.	ID=gene684;Name=TW714;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW714
BX072543.1	EMBL	CDS	807832	808431	.	-	0	ID=cds680;Parent=gene684;Dbxref=GOA:Q83HB8,InterPro:IPR018094,InterPro:IPR027417,NCBI_GP:CAD67373.1;Name=CAD67373.1;Note=Similar to Bacillus halodurans thymidylate kinase tmk or bh0042 SWALL:KTHY_BACHD (SWALL:Q9KGL9) (210 aa) fasta scores: E(): 1.9e-21%2C 40.39%25 id in 203 aa;gbkey=CDS;product=putative nucleotide kinase;protein_id=CAD67373.1;transl_table=11
BX072543.1	EMBL	sequence_feature	807879	808419	.	-	.	ID=id1427;Note=Thymidylate kinase Score %3D 147.2 E-value %3D 2e-41;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	808390	808413	.	-	.	ID=id1428;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	808491	811016	.	-	.	ID=gene685;Name=topA;gbkey=Gene;gene=topA;gene_biotype=protein_coding;locus_tag=TW715
BX072543.1	EMBL	CDS	808491	811016	.	-	0	ID=cds681;Parent=gene685;Dbxref=GOA:Q83HB7,InterPro:IPR000380,InterPro:IPR003601,InterPro:IPR003602,InterPro:IPR005733,InterPro:IPR006171,InterPro:IPR013497,InterPro:IPR013824,InterPro:IPR013825,InterPro:IPR023405,InterPro:IPR023406,InterPro:IPR025589,InterPro:IPR028612,UniProtKB/TrEMBL:Q83HB7,NCBI_GP:CAD67374.1;Name=CAD67374.1;Note=Similar to Escherichia coli DNA topoisomerase I TopA or SupX or b1274 SWALL:TOP1_ECOLI (SWALL:P06612) (865 aa) fasta scores: E(): 3e-47%2C 36.55%25 id in 766 aa%2C and to Bifidobacterium longum NCC2705 DNA topoisomerase i topA SWALL:AAN24314 (EMBL:AE014668) (1030 aa) fasta scores: E(): 2.9e-49%2C 45.38%25 id in 932 aa;gbkey=CDS;gene=topA;product=DNA topoisomerase I;protein_id=CAD67374.1;transl_table=11
BX072543.1	EMBL	sequence_feature	809351	810611	.	-	.	ID=id1429;Note=DNA topoisomerase Score %3D 570.7 E-value %3D 6.7e-169;gbkey=misc_feature;gene=topA
BX072543.1	EMBL	sequence_feature	810054	810098	.	-	.	ID=id1430;Note=PS00396 Prokaryotic DNA topoisomerase I active site.;gbkey=misc_feature;gene=topA
BX072543.1	EMBL	sequence_feature	810653	811013	.	-	.	ID=id1431;Note=Toprim domain Score %3D 115.0 E-value %3D 1e-31;gbkey=misc_feature;gene=topA
BX072543.1	EMBL	gene	811077	811487	.	-	.	ID=gene686;Name=TW716;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW716
BX072543.1	EMBL	CDS	811077	811487	.	-	0	ID=cds682;Parent=gene686;Dbxref=InterPro:IPR021202,UniProtKB/TrEMBL:Q83N90,NCBI_GP:CAD67375.1;Name=CAD67375.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67375.1;transl_table=11
BX072543.1	EMBL	sequence_feature	811323	811391	.	-	.	ID=id1432;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 33-55;gbkey=misc_feature
BX072543.1	EMBL	gene	811484	811840	.	-	.	ID=gene687;Name=TW717;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW717
BX072543.1	EMBL	CDS	811484	811840	.	-	0	ID=cds683;Parent=gene687;Dbxref=UniProtKB/TrEMBL:Q83N89,NCBI_GP:CAD67376.1;Name=CAD67376.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67376.1;transl_table=11
BX072543.1	EMBL	sequence_feature	811712	811780	.	-	.	ID=id1433;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 21-43;gbkey=misc_feature
BX072543.1	EMBL	gene	811842	812048	.	-	.	ID=gene688;Name=TW718;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW718
BX072543.1	EMBL	CDS	811842	812048	.	-	0	ID=cds684;Parent=gene688;Dbxref=InterPro:IPR025338,UniProtKB/TrEMBL:Q83N88,NCBI_GP:CAD67377.1;Name=CAD67377.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67377.1;transl_table=11
BX072543.1	EMBL	sequence_feature	811908	811976	.	-	.	ID=id1434;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 25-47;gbkey=misc_feature
BX072543.1	EMBL	gene	812076	813008	.	-	.	ID=gene689;Name=TW719;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW719
BX072543.1	EMBL	CDS	812076	813008	.	-	0	ID=cds685;Parent=gene689;Dbxref=UniProtKB/TrEMBL:Q83N87,NCBI_GP:CAD67378.1;Name=CAD67378.1;Note=No significant database matches;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67378.1;transl_table=11
BX072543.1	EMBL	sequence_feature	812556	812609	.	-	.	ID=id1435;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 134-151%2C 155-177 and 280-302;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	812478	812546	.	-	.	ID=id1435;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 134-151%2C 155-177 and 280-302;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	812103	812171	.	-	.	ID=id1435;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 134-151%2C 155-177 and 280-302;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	812904	813008	.	-	.	ID=id1436;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.728) with cleavage site probability 0.656 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	gene	812993	813937	.	-	.	ID=gene690;Name=TW720;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW720
BX072543.1	EMBL	CDS	812993	813937	.	-	0	ID=cds686;Parent=gene690;Dbxref=GOA:Q83N86,InterPro:IPR001482,InterPro:IPR022399,InterPro:IPR027417,UniProtKB/TrEMBL:Q83N86,NCBI_GP:CAD67379.1;Name=CAD67379.1;Note=Similar to Corynebacterium glutamicum predicted ATPases involved in pili and flagella biosynthesis%2C VirB11 family cgl0301 SWALL:Q8NTK6 (EMBL:AP005274) (341 aa) fasta scores: E(): 2.9e-40%2C 43.18%25 id in 301 aa%2C and to Actinobacillus actinomycetemcomitans TadA SWALL:Q9XC06 (EMBL:AF152598) (426 aa) fasta scores: E(): 7e-36%2C 37.33%25 id in 308 aa;gbkey=CDS;product=putative TadA-like protein;protein_id=CAD67379.1;transl_table=11
BX072543.1	EMBL	sequence_feature	813133	813787	.	-	.	ID=id1437;Note=Type II/IV secretion system protein Score %3D -91.3 E-value %3D 5.9e-05;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	813491	813514	.	-	.	ID=id1438;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	814114	814572	.	-	.	ID=gene691;Name=TW721;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW721
BX072543.1	EMBL	CDS	814114	814572	.	-	0	ID=cds687;Parent=gene691;Dbxref=InterPro:IPR006175,InterPro:IPR013813,UniProtKB/TrEMBL:Q83HB6,NCBI_GP:CAD67380.1;Name=CAD67380.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv3678c or Mtv025.026c or mt3779 SWALL:O69646 (EMBL:AL022121) (151 aa) fasta scores: E(): 3e-25%2C 55.47%25 id in 146 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67380.1;transl_table=11
BX072543.1	EMBL	sequence_feature	814125	814527	.	-	.	ID=id1439;Note=Endoribonuclease L-PSP Score %3D 76.4 E-value %3D 4.1e-20;gbkey=misc_feature
BX072543.1	EMBL	gene	815134	817764	.	+	.	ID=gene692;Name=TW722;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW722
BX072543.1	EMBL	CDS	815134	817764	.	+	0	ID=cds688;Parent=gene692;Dbxref=GOA:Q83N85,InterPro:IPR001264,InterPro:IPR001460,InterPro:IPR005543,InterPro:IPR012338,InterPro:IPR023346,UniProtKB/TrEMBL:Q83N85,NCBI_GP:CAD67381.1;Name=CAD67381.1;Note=Similar to Bifidobacterium longum NCC2705 possible penicillin-binding protein bl1215 SWALL:AAN25022 (EMBL:AE014747) (771 aa) fasta scores: E(): 1e-29%2C 32.76%25 id in 766 aa%2C and to Mycobacterium leprae Pbp1 Pon1 SWALL:P72351 (EMBL:S82044) (821 aa) fasta scores: E(): 1.1e-08%2C 27.82%25 id in 823 aa;gbkey=CDS;product=putative penicillin-binding protein/transpeptidase;protein_id=CAD67381.1;transl_table=11
BX072543.1	EMBL	sequence_feature	815134	815217	.	+	.	ID=id1440;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.673 between residues 28 and 29;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	815152	815220	.	+	.	ID=id1441;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-29;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	815296	815953	.	+	.	ID=id1442;Note=Transglycosylase Score %3D 145.9 E-value %3D 5.2e-41;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	816256	817273	.	+	.	ID=id1443;Note=Penicillin binding protein transpeptidase domain Score %3D -38.2 E-value %3D 7.9e-08;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	816520	816543	.	+	.	ID=id1444;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	817363	817558	.	+	.	ID=id1445;Note=PASTA domain Score %3D 41.7 E-value %3D 1.1e-09;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	817564	817753	.	+	.	ID=id1446;Note=PASTA domain Score %3D 46.9 E-value %3D 3.1e-11;gbkey=misc_feature
BX072543.1	EMBL	gene	817873	818757	.	+	.	ID=gene693;Name=TW723;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW723
BX072543.1	EMBL	CDS	817873	818757	.	+	0	ID=cds689;Parent=gene693;Dbxref=GOA:Q83N84,InterPro:IPR004843,InterPro:IPR029052,UniProtKB/TrEMBL:Q83N84,NCBI_GP:CAD67382.1;Name=CAD67382.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv3683 or mtv025.031 or mt3785 SWALL:O69651 (EMBL:AL022121) (319 aa) fasta scores: E(): 1.1e-45%2C 44.29%25 id in 289 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67382.1;transl_table=11
BX072543.1	EMBL	sequence_feature	817891	817947	.	+	.	ID=id1447;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 7-25;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	818011	818566	.	+	.	ID=id1448;Note=Calcineurin-like phosphoesterase Score %3D 38.5 E-value %3D 1.1e-08;gbkey=misc_feature
BX072543.1	EMBL	tRNA	818979	819052	.	+	.	ID=rna46;Note=tRNA Pro anticodon CGG%2C Cove score 81.45;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	exon	818979	819052	.	+	.	ID=id1449;Parent=rna46;Note=tRNA Pro anticodon CGG%2C Cove score 81.45;gbkey=tRNA;product=tRNA-Pro
BX072543.1	EMBL	gene	819127	820140	.	-	.	ID=gene694;Name=asd;gbkey=Gene;gene=asd;gene_biotype=protein_coding;locus_tag=TW724
BX072543.1	EMBL	CDS	819127	820140	.	-	0	ID=cds690;Parent=gene694;Dbxref=GOA:Q83HB5,InterPro:IPR000319,InterPro:IPR000534,InterPro:IPR005986,InterPro:IPR012080,InterPro:IPR012280,InterPro:IPR016040,UniProtKB/TrEMBL:Q83HB5,NCBI_GP:CAD67383.1;Name=CAD67383.1;Note=Similar to Mycobacterium bovis aspartate-semialdehyde dehydrogenase Asd SWALL:DHAS_MYCBO (SWALL:P47730) (345 aa) fasta scores: E(): 5.7e-62%2C 54.89%25 id in 337 aa;gbkey=CDS;gene=asd;product=aspartate-semialdehyde dehydrogenase;protein_id=CAD67383.1;transl_table=11
BX072543.1	EMBL	sequence_feature	819183	819750	.	-	.	ID=id1450;Note=Semialdehyde dehydrogenase%2C dimerisation domain Score %3D 198.6 E-value %3D 7.1e-57;gbkey=misc_feature;gene=asd
BX072543.1	EMBL	sequence_feature	819394	819438	.	-	.	ID=id1451;Note=PS01103 Aspartate-semialdehyde dehydrogenase signature.;gbkey=misc_feature;gene=asd
BX072543.1	EMBL	sequence_feature	819777	820140	.	-	.	ID=id1452;Note=Semialdehyde dehydrogenase%2C NAD binding domain Score %3D 133.9 E-value %3D 2.1e-37;gbkey=misc_feature;gene=asd
BX072543.1	EMBL	gene	820137	821393	.	-	.	ID=gene695;Name=lysC;gbkey=Gene;gene=lysC;gene_biotype=protein_coding;locus_tag=TW725
BX072543.1	EMBL	CDS	820137	821393	.	-	0	ID=cds691;Parent=gene695;Dbxref=GOA:Q83HB4,InterPro:IPR001048,InterPro:IPR001341,InterPro:IPR002912,InterPro:IPR005260,InterPro:IPR018042,InterPro:IPR027795,UniProtKB/TrEMBL:Q83HB4,NCBI_GP:CAD67384.1;Name=CAD67384.1;Note=Similar to Corynebacterium glutamicum aspartokinase LysC or cgl0251 SWALL:AK_CORGL (SWALL:P26512) (421 aa) fasta scores: E(): 9.8e-73%2C 49.4%25 id in 421 aa;gbkey=CDS;gene=lysC;product=aspartokinase;protein_id=CAD67384.1;transl_table=11
BX072543.1	EMBL	sequence_feature	820166	820361	.	-	.	ID=id1453;Note=ACT domain Score %3D 27.6 E-value %3D 2e-05;gbkey=misc_feature;gene=lysC
BX072543.1	EMBL	sequence_feature	820323	820355	.	-	.	ID=id1454;Note=PS00626 Regulator of chromosome condensation (RCC1) signature 2.;gbkey=misc_feature;gene=lysC
BX072543.1	EMBL	sequence_feature	820382	820607	.	-	.	ID=id1455;Note=ACT domain Score %3D 22.3 E-value %3D 0.0008;gbkey=misc_feature;gene=lysC
BX072543.1	EMBL	sequence_feature	820706	821390	.	-	.	ID=id1456;Note=Amino acid kinase family Score %3D 253.1 E-value %3D 2.6e-73;gbkey=misc_feature;gene=lysC
BX072543.1	EMBL	sequence_feature	821355	821381	.	-	.	ID=id1457;Note=PS00324 Aspartokinase signature.;gbkey=misc_feature;gene=lysC
BX072543.1	EMBL	gene	821589	822185	.	-	.	ID=gene696;Name=recR;gbkey=Gene;gene=recR;gene_biotype=protein_coding;locus_tag=TW726
BX072543.1	EMBL	CDS	821589	822185	.	-	0	ID=cds692;Parent=gene696;Dbxref=GOA:Q83N83,InterPro:IPR000093,InterPro:IPR003583,InterPro:IPR006171,InterPro:IPR015967,InterPro:IPR023627,InterPro:IPR023628,NCBI_GP:CAD67385.1;Name=CAD67385.1;Note=Similar to Bacillus subtilis recombination protein RecR or RecM or RecD SWALL:RECR_BACSU (SWALL:P24277) (198 aa) fasta scores: E(): 1.1e-39%2C 53.09%25 id in 194 aa%2C and to Streptomyces coelicolor recombination protein RecR or SCO3618 or SC66T3.29c SWALL:RECR_STRCO (SWALL:Q9XAI4) (199 aa) fasta scores: E(): 1.1e-52%2C 68.68%25 id in 198 aa;gbkey=CDS;gene=recR;product=recombination protein RecR;protein_id=CAD67385.1;transl_table=11
BX072543.1	EMBL	sequence_feature	821672	821951	.	-	.	ID=id1458;Note=Toprim domain Score %3D 57.2 E-value %3D 2.6e-14;gbkey=misc_feature;gene=recR
BX072543.1	EMBL	sequence_feature	821954	822077	.	-	.	ID=id1459;Note=RecR protein Score %3D 54.8 E-value %3D 1.3e-13;gbkey=misc_feature;gene=recR
BX072543.1	EMBL	sequence_feature	821958	822020	.	-	.	ID=id1460;Note=PS01300 RecR protein signature.;gbkey=misc_feature;gene=recR
BX072543.1	EMBL	gene	822194	823762	.	-	.	ID=gene697;Name=dnaX;gbkey=Gene;gene=dnaX;gene_biotype=protein_coding;locus_tag=TW727
BX072543.1	EMBL	CDS	822194	823762	.	-	0	ID=cds693;Parent=gene697;Dbxref=GOA:Q83HB3,InterPro:IPR003593,InterPro:IPR008921,InterPro:IPR012763,InterPro:IPR022754,InterPro:IPR027417,UniProtKB/TrEMBL:Q83HB3,NCBI_GP:CAD67386.1;Name=CAD67386.1;Note=Similar to Bacillus subtilis DNA polymerase III subunit gamma/tau DnaX or DnaH SWALL:DP3X_BACSU (SWALL:P09122) (563 aa) fasta scores: E(): 2e-40%2C 36.18%25 id in 362 aa%2C and to Bifidobacterium longum NCC2705 DNA polymerase III subunit gamma/tau DnaX SWALL:AAN24329 (EMBL:AE014670) (970 aa) fasta scores: E(): 1.3e-71%2C 57.61%25 id in 361 aa;gbkey=CDS;gene=dnaX;product=DNA polymerase III subunit gamma/tau;protein_id=CAD67386.1;transl_table=11
BX072543.1	EMBL	sequence_feature	823601	823624	.	-	.	ID=id1461;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=dnaX
BX072543.1	EMBL	gene	823996	824376	.	-	.	ID=gene698;Name=rplL;gbkey=Gene;gene=rplL;gene_biotype=protein_coding;locus_tag=TW728
BX072543.1	EMBL	CDS	823996	824376	.	-	0	ID=cds694;Parent=gene698;Dbxref=GOA:Q83HB2,InterPro:IPR000206,InterPro:IPR008932,InterPro:IPR013823,InterPro:IPR014719,NCBI_GP:CAD67387.1;Name=CAD67387.1;Note=Similar to Mycobacterium tuberculosis 50s ribosomal protein L7/L12 RplL or Rv0652 or mt0681 or mtcy20h10.33 SWALL:RL7_MYCTU (SWALL:P37381) (130 aa) fasta scores: E(): 7.9e-23%2C 68.46%25 id in 130 aa;gbkey=CDS;gene=rplL;product=50s ribosomal protein L7/L12;protein_id=CAD67387.1;transl_table=11
BX072543.1	EMBL	sequence_feature	824001	824199	.	-	.	ID=id1462;Note=Ribosomal protein L7/L12 C-terminal domain Score %3D 118.1 E-value %3D 1.2e-32;gbkey=misc_feature;gene=rplL
BX072543.1	EMBL	gene	824388	824888	.	-	.	ID=gene699;Name=rplJ;gbkey=Gene;gene=rplJ;gene_biotype=protein_coding;locus_tag=TW729
BX072543.1	EMBL	CDS	824388	824888	.	-	0	ID=cds695;Parent=gene699;Dbxref=GOA:Q83HB1,InterPro:IPR001790,InterPro:IPR002363,InterPro:IPR022973,NCBI_GP:CAD67388.1;Name=CAD67388.1;Note=Similar to Streptomyces antibioticus 50s ribosomal protein L10 RplJ SWALL:RL10_STRAT (SWALL:P29343) (176 aa) fasta scores: E(): 9.3e-17%2C 40.99%25 id in 161 aa;gbkey=CDS;gene=rplJ;product=50s ribosomal protein L10;protein_id=CAD67388.1;transl_table=11
BX072543.1	EMBL	sequence_feature	824606	824885	.	-	.	ID=id1463;Note=Ribosomal protein L10 Score %3D 99.6 E-value %3D 4.4e-27;gbkey=misc_feature;gene=rplJ
BX072543.1	EMBL	sequence_feature	824778	824819	.	-	.	ID=id1464;Note=PS01109 Ribosomal protein L10 signature.;gbkey=misc_feature;gene=rplJ
BX072543.1	EMBL	gene	825023	825706	.	-	.	ID=gene700;Name=rplA;gbkey=Gene;gene=rplA;gene_biotype=protein_coding;locus_tag=TW730
BX072543.1	EMBL	CDS	825023	825706	.	-	0	ID=cds696;Parent=gene700;Dbxref=GOA:P66100,InterPro:IPR002143,InterPro:IPR005878,InterPro:IPR016094,InterPro:IPR016095,InterPro:IPR023673,InterPro:IPR023674,InterPro:IPR028364,NCBI_GP:CAD67389.1;Name=CAD67389.1;Note=Similar to Streptomyces sp. 50s ribosomal protein L1 RplA SWALL:RL1_STRSQ (SWALL:Q07976) (242 aa) fasta scores: E(): 9.3e-43%2C 57.14%25 id in 224 aa;gbkey=CDS;gene=rplA;product=50S ribosomal protein L1;protein_id=CAD67389.1;transl_table=11
BX072543.1	EMBL	sequence_feature	825046	825664	.	-	.	ID=id1465;Note=Ribosomal protein L1p/L10e family Score %3D 298.3 E-value %3D 6.9e-87;gbkey=misc_feature;gene=rplA
BX072543.1	EMBL	sequence_feature	825290	825346	.	-	.	ID=id1466;Note=PS01199 Ribosomal protein L1 signature.;gbkey=misc_feature;gene=rplA
BX072543.1	EMBL	gene	825703	826128	.	-	.	ID=gene701;Name=rplK;gbkey=Gene;gene=rplK;gene_biotype=protein_coding;locus_tag=TW731
BX072543.1	EMBL	CDS	825703	826128	.	-	0	ID=cds697;Parent=gene701;Dbxref=GOA:Q83HA9,InterPro:IPR000911,InterPro:IPR006519,InterPro:IPR020783,InterPro:IPR020784,NCBI_GP:CAD67390.1;Name=CAD67390.1;Note=Similar to Streptomyces lavendulae 50s ribosomal protein L11 RplK or RelC SWALL:RL11_STRLA (SWALL:O87733) (144 aa) fasta scores: E(): 6.8e-36%2C 76.64%25 id in 137 aa;gbkey=CDS;gene=rplK;product=50S ribosomal protein L11;protein_id=CAD67390.1;transl_table=11
BX072543.1	EMBL	sequence_feature	825711	825915	.	-	.	ID=id1467;Note=Ribosomal protein L11%2C RNA binding domain Score %3D 102.6 E-value %3D 5.5e-28;gbkey=misc_feature;gene=rplK
BX072543.1	EMBL	sequence_feature	825930	826104	.	-	.	ID=id1468;Note=Ribosomal protein L11%2C N-terminal domain Score %3D 134.9 E-value %3D 1e-37;gbkey=misc_feature;gene=rplK
BX072543.1	EMBL	gene	826165	826782	.	-	.	ID=gene702;Name=nusG;gbkey=Gene;gene=nusG;gene_biotype=protein_coding;locus_tag=TW732
BX072543.1	EMBL	CDS	826165	826782	.	-	0	ID=cds698;Parent=gene702;Dbxref=GOA:Q83N82,InterPro:IPR001062,InterPro:IPR005824,InterPro:IPR006645,InterPro:IPR008991,InterPro:IPR014722,UniProtKB/TrEMBL:Q83N82,NCBI_GP:CAD67391.1;Name=CAD67391.1;Note=Similar to Streptomyces griseus transcription antitermination protein NusG SWALL:NUSG_STRGR (SWALL:P36260) (294 aa) fasta scores: E(): 3e-35%2C 48.27%25 id in 203 aa;gbkey=CDS;gene=nusG;product=transcription antitermination protein NusG;protein_id=CAD67391.1;transl_table=11
BX072543.1	EMBL	sequence_feature	826221	826332	.	-	.	ID=id1469;Note=KOW motif Score %3D 36.8 E-value %3D 3.6e-08;gbkey=misc_feature;gene=nusG
BX072543.1	EMBL	sequence_feature	826590	826719	.	-	.	ID=id1470;Note=Transcription termination factor nusG Score %3D 53.4 E-value %3D 3.6e-13;gbkey=misc_feature;gene=nusG
BX072543.1	EMBL	tRNA	827040	827112	.	-	.	ID=rna47;Note=tRNA Trp anticodon CCA%2C Cove score 80.91;gbkey=tRNA;product=tRNA-Trp
BX072543.1	EMBL	exon	827040	827112	.	-	.	ID=id1471;Parent=rna47;Note=tRNA Trp anticodon CCA%2C Cove score 80.91;gbkey=tRNA;product=tRNA-Trp
BX072543.1	EMBL	gene	827185	828399	.	+	.	ID=gene703;Name=aspC;gbkey=Gene;gene=aspC;gene_biotype=protein_coding;locus_tag=TW733
BX072543.1	EMBL	CDS	827185	828399	.	+	0	ID=cds699;Parent=gene703;Dbxref=GOA:Q83HA8,InterPro:IPR004838,InterPro:IPR004839,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,UniProtKB/TrEMBL:Q83HA8,NCBI_GP:CAD67392.1;Name=CAD67392.1;Note=Similar to Bacillus stearothermophilus aspartate aminotransferase aspC SWALL:AAT_BACST (SWALL:Q59228) (393 aa) fasta scores: E(): 7.5e-50%2C 38.71%25 id in 372 aa;gbkey=CDS;gene=aspC;product=aspartate aminotransferase;protein_id=CAD67392.1;transl_table=11
BX072543.1	EMBL	sequence_feature	827443	828361	.	+	.	ID=id1472;Note=Aminotransferase class I and II Score %3D 187.7 E-value %3D 1.3e-53;gbkey=misc_feature;gene=aspC
BX072543.1	EMBL	sequence_feature	827884	827925	.	+	.	ID=id1473;Note=PS00105 Aminotransferases class-I pyridoxal-phosphate attachment site.;gbkey=misc_feature;gene=aspC
BX072543.1	EMBL	gene	828402	829457	.	-	.	ID=gene704;Name=murB;gbkey=Gene;gene=murB;gene_biotype=protein_coding;locus_tag=TW734
BX072543.1	EMBL	CDS	828402	829457	.	-	0	ID=cds700;Parent=gene704;Dbxref=GOA:Q83HA7,InterPro:IPR003170,InterPro:IPR006094,InterPro:IPR011601,InterPro:IPR016166,InterPro:IPR016167,InterPro:IPR016169,NCBI_GP:CAD67393.1;Name=CAD67393.1;Note=Similar to Escherichia coli UDP-N-acetylenolpyruvoylglucosamine reductase MurB or b3972 SWALL:MURB_ECOLI (SWALL:P08373) (342 aa) fasta scores: E(): 1.4e-08%2C 31.05%25 id in 351 aa%2C and to Mycobacterium tuberculosis UDP-N-acetylenolpyruvoylglucosamine reductase MurB or Rv0482 or mt0500 or mtcy20g9.08 SWALL:MURB_MYCTU (SWALL:Q11148) (369 aa) fasta scores: E(): 6.7e-32%2C 38.04%25 id in 368 aa;gbkey=CDS;gene=murB;product=UDP-N-acetylenolpyruvoylglucosamine reductase;protein_id=CAD67393.1;transl_table=11
BX072543.1	EMBL	sequence_feature	828416	828851	.	-	.	ID=id1474;Note=UDP-N-acetylenolpyruvoylglucosamine reductase%2C C-terminal domain Score %3D 83.6 E-value %3D 2.9e-22;gbkey=misc_feature;gene=murB
BX072543.1	EMBL	sequence_feature	828935	829367	.	-	.	ID=id1475;Note=FAD binding domain Score %3D 15.9 E-value %3D 2e-05;gbkey=misc_feature;gene=murB
BX072543.1	EMBL	gene	829742	830185	.	-	.	ID=gene705;Name=TW735;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW735
BX072543.1	EMBL	CDS	829742	830185	.	-	0	ID=cds701;Parent=gene705;Dbxref=GOA:Q83HA6,InterPro:IPR002539,InterPro:IPR003965,InterPro:IPR029069,UniProtKB/TrEMBL:Q83HA6,NCBI_GP:CAD67394.1;Name=CAD67394.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO4637 or SCD82.08 SWALL:Q9L0M3 (EMBL:AL160431) (142 aa) fasta scores: E(): 6e-11%2C 38.4%25 id in 138 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67394.1;transl_table=11
BX072543.1	EMBL	sequence_feature	829780	830179	.	-	.	ID=id1476;Note=MaoC like domain Score %3D 68.3 E-value %3D 1.1e-17;gbkey=misc_feature
BX072543.1	EMBL	gene	830331	830753	.	-	.	ID=gene706;Name=TW736;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW736
BX072543.1	EMBL	CDS	830331	830753	.	-	0	ID=cds702;Parent=gene706;Dbxref=InterPro:IPR016709,InterPro:IPR029069,NCBI_GP:CAD67395.1;Name=CAD67395.1;Note=Similar to Streptomyces coelicolor hypothetical protein sco4636 sco4636 or scd82.07 SWALL:Q9L0M4 (EMBL:AL160431) (150 aa) fasta scores: E(): 8.7e-08%2C 42.22%25 id in 90 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67395.1;transl_table=11
BX072543.1	EMBL	gene	831128	832588	.	-	.	ID=gene707;Name=purF;gbkey=Gene;gene=purF;gene_biotype=protein_coding;locus_tag=TW737
BX072543.1	EMBL	CDS	831128	832588	.	-	0	ID=cds703;Parent=gene707;Dbxref=GOA:Q83HA4,InterPro:IPR000836,InterPro:IPR005854,InterPro:IPR017932,InterPro:IPR029055,InterPro:IPR029057,UniProtKB/TrEMBL:Q83HA4,NCBI_GP:CAD67396.1;Name=CAD67396.1;Note=Similar to Escherichia coli amidophosphoribosyltransferase PurF or b2312 SWALL:PUR1_ECOLI (SWALL:P00496) (504 aa) fasta scores: E(): 2.1e-101%2C 54.73%25 id in 486 aa;gbkey=CDS;gene=purF;product=amidophosphoribosyltransferase;protein_id=CAD67396.1;transl_table=11
BX072543.1	EMBL	sequence_feature	831328	831796	.	-	.	ID=id1477;Note=Phosphoribosyl transferase domain Score %3D 20.4 E-value %3D 2.4e-05;gbkey=misc_feature;gene=purF
BX072543.1	EMBL	sequence_feature	831458	831496	.	-	.	ID=id1478;Note=PS00103 Purine/pyrimidine phosphoribosyl transferases signature.;gbkey=misc_feature;gene=purF
BX072543.1	EMBL	sequence_feature	832006	832585	.	-	.	ID=id1479;Note=Glutamine amidotransferases class-II Score %3D 245.1 E-value %3D 6.8e-71;gbkey=misc_feature;gene=purF
BX072543.1	EMBL	gene	832699	833712	.	-	.	ID=gene708;Name=purM;gbkey=Gene;gene=purM;gene_biotype=protein_coding;locus_tag=TW738
BX072543.1	EMBL	CDS	832699	833712	.	-	0	ID=cds704;Parent=gene708;Dbxref=GOA:Q83HA3,InterPro:IPR000728,InterPro:IPR004733,InterPro:IPR010918,InterPro:IPR016188,UniProtKB/TrEMBL:Q83HA3,NCBI_GP:CAD67397.1;Name=CAD67397.1;Note=Similar to Bacillus subtilis phosphoribosylformylglycinamidine cyclo-ligase PurM or Ath SWALL:PUR5_BACSU (SWALL:P12043) (346 aa) fasta scores: E(): 5e-47%2C 43.96%25 id in 348 aa;gbkey=CDS;gene=purM;product=phosphoribosylformylglycinamidine cyclo-ligase;protein_id=CAD67397.1;transl_table=11
BX072543.1	EMBL	sequence_feature	832716	833193	.	-	.	ID=id1480;Note=AIR synthase related protein%2C C-terminal domain Score %3D 90.1 E-value %3D 3.1e-24;gbkey=misc_feature;gene=purM
BX072543.1	EMBL	sequence_feature	833226	833712	.	-	.	ID=id1481;Note=AIR synthase related protein%2C N-terminal domain Score %3D 179.9 E-value %3D 2.9e-51;gbkey=misc_feature;gene=purM
BX072543.1	EMBL	gene	834385	835644	.	+	.	ID=gene709;Name=purD;gbkey=Gene;gene=purD;gene_biotype=protein_coding;locus_tag=TW739
BX072543.1	EMBL	CDS	834385	835644	.	+	0	ID=cds705;Parent=gene709;Dbxref=GOA:Q83HA2,InterPro:IPR000115,InterPro:IPR011054,InterPro:IPR011761,InterPro:IPR013815,InterPro:IPR013816,InterPro:IPR016185,InterPro:IPR020559,InterPro:IPR020560,InterPro:IPR020561,InterPro:IPR020562,UniProtKB/TrEMBL:Q83HA2,NCBI_GP:CAD67398.1;Name=CAD67398.1;Note=Similar to Bacillus subtilis phosphoribosylamine--glycine ligase purD SWALL:PUR2_BACSU (SWALL:P12039) (422 aa) fasta scores: E(): 4.5e-44%2C 41.19%25 id in 420 aa;gbkey=CDS;gene=purD;product=phosphoribosylamine--glycine ligase;protein_id=CAD67398.1;transl_table=11
BX072543.1	EMBL	sequence_feature	834385	834667	.	+	.	ID=id1482;Note=Phosphoribosylglycinamide synthetase%2C N domain Score %3D 104.5 E-value %3D 1.5e-28;gbkey=misc_feature;gene=purD
BX072543.1	EMBL	sequence_feature	834673	834898	.	+	.	ID=id1483;Note=Phosphoribosylglycinamide synthetase%2C B domain Score %3D 51.9 E-value %3D 9.8e-13;gbkey=misc_feature;gene=purD
BX072543.1	EMBL	sequence_feature	834901	835315	.	+	.	ID=id1484;Note=Phosphoribosylglycinamide synthetase%2C ATP-grasp (A) domain Score %3D 218.0 E-value %3D 1e-62;gbkey=misc_feature;gene=purD
BX072543.1	EMBL	sequence_feature	835207	835230	.	+	.	ID=id1485;Note=PS00184 Phosphoribosylglycinamide synthetase signature.;gbkey=misc_feature;gene=purD
BX072543.1	EMBL	sequence_feature	835330	835609	.	+	.	ID=id1486;Note=Phosphoribosylglycinamide synthetase%2C C domain Score %3D 73.6 E-value %3D 2.9e-19;gbkey=misc_feature;gene=purD
BX072543.1	EMBL	gene	835755	837008	.	+	.	ID=gene710;Name=serS;gbkey=Gene;gene=serS;gene_biotype=protein_coding;locus_tag=TW740
BX072543.1	EMBL	CDS	835755	837008	.	+	0	ID=cds706;Parent=gene710;Dbxref=GOA:Q83HA1,InterPro:IPR002314,InterPro:IPR002317,InterPro:IPR006195,InterPro:IPR010978,InterPro:IPR015866,NCBI_GP:CAD67399.1;Name=CAD67399.1;Note=Similar to Staphylococcus aureus seryl-tRNA synthetase SerS SWALL:SYS_STAAU (SWALL:P95689) (428 aa) fasta scores: E(): 1.2e-51%2C 36.19%25 id in 420 aa%2C and to Corynebacterium glutamicum seryl-tRNA synthetase cgl2893 SWALL:Q8NLP6 (EMBL:AP005283) (422 aa) fasta scores: E(): 3.8e-88%2C 53.47%25 id in 417 aa;gbkey=CDS;gene=serS;product=seryl-tRNA synthetase;protein_id=CAD67399.1;transl_table=11
BX072543.1	EMBL	sequence_feature	836229	836688	.	+	.	ID=id1487;Note=tRNA synthetase class II core domain (G%2C H%2C P%2C S and T) Score %3D 155.5 E-value %3D 6.5e-44;gbkey=misc_feature;gene=serS
BX072543.1	EMBL	sequence_feature	836520	836594	.	+	.	ID=id1488;Note=PS00179 Aminoacyl-transfer RNA synthetases class-II signature 1.;gbkey=misc_feature;gene=serS
BX072543.1	EMBL	gene	837031	837822	.	+	.	ID=gene711;Name=TW741;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW741
BX072543.1	EMBL	CDS	837031	837822	.	+	0	ID=cds707;Parent=gene711;Dbxref=GOA:Q83HA0,InterPro:IPR000150,InterPro:IPR006379,InterPro:IPR023214,UniProtKB/TrEMBL:Q83HA0,NCBI_GP:CAD67400.1;Name=CAD67400.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO4581 or SCD16A.02c SWALL:Q9XAS3 (EMBL:AL078618) (269 aa) fasta scores: E(): 6.9e-07%2C 27.2%25 id in 272 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67400.1;transl_table=11
BX072543.1	EMBL	tRNA	837870	837954	.	+	.	ID=rna48;Note=tRNA Ser anticodon TGA%2C Cove score 57.77;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	exon	837870	837954	.	+	.	ID=id1489;Parent=rna48;Note=tRNA Ser anticodon TGA%2C Cove score 57.77;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	gene	838028	839191	.	+	.	ID=gene712;Name=TW742;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW742
BX072543.1	EMBL	CDS	838028	839191	.	+	0	ID=cds708;Parent=gene712;Dbxref=InterPro:IPR004474,UniProtKB/TrEMBL:Q83H99,NCBI_GP:CAD67401.1;Name=CAD67401.1;Note=Similar to Streptomyces coelicolor putative transcriptional regulator SCO6020 or SC1C3.08c SWALL:O69850 (EMBL:AL023702) (366 aa) fasta scores: E(): 1.1e-30%2C 34.68%25 id in 346 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67401.1;transl_table=11
BX072543.1	EMBL	sequence_feature	838028	838117	.	+	.	ID=id1490;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.373 between residues 30 and 31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	838061	838129	.	+	.	ID=id1491;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 12-34;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	838280	838751	.	+	.	ID=id1492;Note=Cell envelope-related transcriptional attenuator domain Score %3D 167.1 E-value %3D 2.1e-47;gbkey=misc_feature
BX072543.1	EMBL	tRNA	839215	839303	.	+	.	ID=rna49;Note=tRNA Ser anticodon GCT%2C Cove score 56.59;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	exon	839215	839303	.	+	.	ID=id1493;Parent=rna49;Note=tRNA Ser anticodon GCT%2C Cove score 56.59;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	tRNA	839328	839400	.	+	.	ID=rna50;Note=tRNA Arg anticodon ACG%2C Cove score 76.90;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	exon	839328	839400	.	+	.	ID=id1494;Parent=rna50;Note=tRNA Arg anticodon ACG%2C Cove score 76.90;gbkey=tRNA;product=tRNA-Arg
BX072543.1	EMBL	gene	839366	840766	.	-	.	ID=gene713;Name=hemL;gbkey=Gene;gene=hemL;gene_biotype=protein_coding;locus_tag=TW743
BX072543.1	EMBL	CDS	839366	840766	.	-	0	ID=cds709;Parent=gene713;Dbxref=GOA:Q83H98,InterPro:IPR004639,InterPro:IPR005814,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,NCBI_GP:CAD67402.1;Name=CAD67402.1;Note=Similar to Escherichia coli glutamate-1-semialdehyde 2%2C1-aminomutase HemL or Gsa or PopC or b0154 SWALL:GSA_ECOLI (SWALL:P23893) (426 aa) fasta scores: E(): 2.3e-45%2C 45.47%25 id in 453 aa;gbkey=CDS;gene=hemL;product=glutamate-1-semialdehyde 2%2C1-aminomutase;protein_id=CAD67402.1;transl_table=11
BX072543.1	EMBL	sequence_feature	839413	840700	.	-	.	ID=id1495;Note=Aminotransferase class-III Score %3D 317.9 E-value %3D 8.1e-93;gbkey=misc_feature;gene=hemL
BX072543.1	EMBL	gene	840770	841741	.	-	.	ID=gene714;Name=hemB;gbkey=Gene;gene=hemB;gene_biotype=protein_coding;locus_tag=TW744
BX072543.1	EMBL	CDS	840770	841741	.	-	0	ID=cds710;Parent=gene714;Dbxref=GOA:Q83H97,InterPro:IPR001731,InterPro:IPR013785,UniProtKB/TrEMBL:Q83H97,NCBI_GP:CAD67403.1;Name=CAD67403.1;Note=Similar to Propionibacterium freudenreichii shermanii delta-aminolevulinic acid dehydratase HemB SWALL:HEM2_PROFR (SWALL:P77923) (332 aa) fasta scores: E(): 2.6e-58%2C 51.41%25 id in 319 aa;gbkey=CDS;gene=hemB;product=delta-aminolevulinic acid dehydratase;protein_id=CAD67403.1;transl_table=11
BX072543.1	EMBL	sequence_feature	840784	841741	.	-	.	ID=id1496;Note=Delta-aminolevulinic acid dehydratase Score %3D 489.8 E-value %3D 1.6e-144;gbkey=misc_feature;gene=hemB
BX072543.1	EMBL	sequence_feature	840986	841024	.	-	.	ID=id1497;Note=PS00169 Delta-aminolevulinic acid dehydratase active site.;gbkey=misc_feature;gene=hemB
BX072543.1	EMBL	gene	841752	842477	.	-	.	ID=gene715;Name=TW745;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW745
BX072543.1	EMBL	CDS	841752	842477	.	-	0	ID=cds711;Parent=gene715;Dbxref=GOA:Q83H96,InterPro:IPR003754,UniProtKB/TrEMBL:Q83H96,NCBI_GP:CAD67404.1;Name=CAD67404.1;Note=Similar to Clostridium josui porphyrin biosynthesis protein HemD [includes: uroporphyrin-iii c-methyltransferase (EC 2.1.1.107) (urogen iii methylase)(sumt)(uroporphyrinogen iii methylase) (urom)%3B uroporphyrinogen-iii synthase (EC 4.2.1.75) (uros) (uroporphyrinogen-iii cosynthetase) (hydroxymethylbilane hydrolyase [cyclizing])] SWALL:HEM4_CLOJO (SWALL:Q59294) (504 aa) fasta scores: E(): 0.57%2C 23.22%25 id in 254 aa%2C and to Deinococcus radiodurans uroporphyrinogen-III synthase%2C putative dr0786 SWALL:Q9RW83 (EMBL:AE001933) (257 aa) fasta scores: E(): 1.8e-06%2C 29.08%25 id in 251 aa;gbkey=CDS;product=porphyrin biosynthesis protein;protein_id=CAD67404.1;transl_table=11
BX072543.1	EMBL	sequence_feature	841772	842435	.	-	.	ID=id1498;Note=Uroporphyrinogen-III synthase HemD Score %3D 34.1 E-value %3D 2.8e-08;gbkey=misc_feature
BX072543.1	EMBL	gene	842474	843439	.	-	.	ID=gene716;Name=hemC;gbkey=Gene;gene=hemC;gene_biotype=protein_coding;locus_tag=TW746
BX072543.1	EMBL	CDS	842474	843439	.	-	0	ID=cds712;Parent=gene716;Dbxref=GOA:Q83H95,InterPro:IPR000860,InterPro:IPR022417,InterPro:IPR022418,InterPro:IPR022419,UniProtKB/TrEMBL:Q83H95,NCBI_GP:CAD67405.1;Name=CAD67405.1;Note=Similar to Escherichia coli porphobilinogen deaminase HemC or PopE or b3805 SWALL:HEM3_ECOLI (SWALL:P06983) (313 aa) fasta scores: E(): 1.1e-20%2C 34.84%25 id in 330 aa;gbkey=CDS;gene=hemC;product=porphobilinogen deaminase;protein_id=CAD67405.1;transl_table=11
BX072543.1	EMBL	sequence_feature	842500	842797	.	-	.	ID=id1499;Note=Porphobilinogen deaminase%2C C-terminal domain Score %3D 16.3 E-value %3D 2.7e-05;gbkey=misc_feature;gene=hemC
BX072543.1	EMBL	sequence_feature	842851	843433	.	-	.	ID=id1500;Note=Porphobilinogen deaminase%2C dipyromethane cofactor binding domain Score %3D 184.4 E-value %3D 1.3e-52;gbkey=misc_feature;gene=hemC
BX072543.1	EMBL	gene	843450	844625	.	-	.	ID=gene717;Name=hemH;gbkey=Gene;gene=hemH;gene_biotype=protein_coding;locus_tag=TW747
BX072543.1	EMBL	CDS	843450	844625	.	-	0	ID=cds713;Parent=gene717;Dbxref=GOA:Q83H94,InterPro:IPR001015,InterPro:IPR019772,NCBI_GP:CAD67406.1;Name=CAD67406.1;Note=Similar to Propionibacterium freudenreichii shermanii ferrochelatase HemH SWALL:HEMZ_PROFR (SWALL:P72183) (352 aa) fasta scores: E(): 8.7e-19%2C 38.69%25 id in 367 aa;gbkey=CDS;gene=hemH;product=ferrochelatase;protein_id=CAD67406.1;transl_table=11
BX072543.1	EMBL	sequence_feature	843581	844538	.	-	.	ID=id1501;Note=Ferrochelatase Score %3D 279.4 E-value %3D 3.2e-81;gbkey=misc_feature;gene=hemH
BX072543.1	EMBL	gene	844622	845269	.	-	.	ID=gene718;Name=TW748;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW748
BX072543.1	EMBL	CDS	844622	845269	.	-	0	ID=cds714;Parent=gene718;Dbxref=InterPro:IPR010644,InterPro:IPR011008,UniProtKB/TrEMBL:Q83H93,NCBI_GP:CAD67407.1;Name=CAD67407.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO6042 or SC1B5.02 SWALL:O69830 (EMBL:AL023517) (243 aa) fasta scores: E(): 5.8e-36%2C 49.45%25 id in 184 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67407.1;transl_table=11
BX072543.1	EMBL	gene	845400	846557	.	-	.	ID=gene719;Name=hemE;gbkey=Gene;gene=hemE;gene_biotype=protein_coding;locus_tag=TW749
BX072543.1	EMBL	CDS	845400	846557	.	-	0	ID=cds715;Parent=gene719;Dbxref=GOA:Q83H92,InterPro:IPR000257,InterPro:IPR006361,NCBI_GP:CAD67408.1;Name=CAD67408.1;Note=Similar to Mycobacterium tuberculosis uroporphyrinogen decarboxylase HemE or Rv2678c or mt2752 or mtv010.02C SWALL:DCUP_MYCTU (SWALL:O53231) (357 aa) fasta scores: E(): 5.9e-45%2C 42.81%25 id in 362 aa%2C and to Mus musculus uroporphyrinogen decarboxylase UroD SWALL:Q91VW4 (EMBL:BC008109) (367 aa) fasta scores: E(): 2.9e-36%2C 35.59%25 id in 354 aa;gbkey=CDS;gene=hemE;product=uroporphyrinogen decarboxylase;protein_id=CAD67408.1;transl_table=11
BX072543.1	EMBL	sequence_feature	845408	846470	.	-	.	ID=id1502;Note=Uroporphyrinogen decarboxylase (URO-D) Score %3D 388.0 E-value %3D 6.5e-114;gbkey=misc_feature;gene=hemE
BX072543.1	EMBL	sequence_feature	846009	846056	.	-	.	ID=id1503;Note=PS00907 Uroporphyrinogen decarboxylase signature 2.;gbkey=misc_feature;gene=hemE
BX072543.1	EMBL	sequence_feature	846387	846416	.	-	.	ID=id1504;Note=PS00906 Uroporphyrinogen decarboxylase signature 1.;gbkey=misc_feature;gene=hemE
BX072543.1	EMBL	gene	846577	847920	.	+	.	ID=gene720;Name=hemA;gbkey=Gene;gene=hemA;gene_biotype=protein_coding;locus_tag=TW750
BX072543.1	EMBL	CDS	846577	847920	.	+	0	ID=cds716;Parent=gene720;Dbxref=GOA:Q83H91,InterPro:IPR000343,InterPro:IPR006151,InterPro:IPR015895,InterPro:IPR015896,InterPro:IPR016040,InterPro:IPR018214,NCBI_GP:CAD67409.1;Name=CAD67409.1;Note=Similar to Escherichia coli glutamyl-tRNA reductase HemA or b1210 or z1981 or ecs1715 SWALL:HEM1_ECOLI (SWALL:P13580) (418 aa) fasta scores: E(): 3.1e-12%2C 25.5%25 id in 447 aa%2C and to Mycobacterium tuberculosis glutamyl-tRNA reductase HemA or Rv0509 or mt0530 or mtcy20g9.36 SWALL:HEM1_MYCTU (SWALL:Q11139) (468 aa) fasta scores: E(): 2.5e-19%2C 28.09%25 id in 452 aa;gbkey=CDS;gene=hemA;product=glutamyl-tRNA reductase;protein_id=CAD67409.1;transl_table=11
BX072543.1	EMBL	sequence_feature	846577	847861	.	+	.	ID=id1505;Note=Glutamyl-tRNAGlu reductase Score %3D 63.3 E-value %3D 3e-17;gbkey=misc_feature;gene=hemA
BX072543.1	EMBL	gene	847917	849119	.	+	.	ID=gene721;Name=TW751;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW751
BX072543.1	EMBL	CDS	847917	849119	.	+	0	ID=cds717;Parent=gene721;Dbxref=GOA:Q83H90,InterPro:IPR001354,InterPro:IPR013342,InterPro:IPR029017,InterPro:IPR029065,UniProtKB/TrEMBL:Q83H90,NCBI_GP:CAD67410.1;Name=CAD67410.1;Note=Similar to Corynebacterium glutamicum O-succinylbenzoate synthase and related enzymes cgl0466 SWALL:Q8NT44 (EMBL:AP005275) (338 aa) fasta scores: E(): 1e-06%2C 29.63%25 id in 405 aa%2C and to Acinetobacter calcoaceticus muconate cycloisomerase I CatB SWALL:CATB_ACICA (SWALL:Q43931) (370 aa) fasta scores: E(): 0.5%2C 21.71%25 id in 198 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67410.1;transl_table=11
BX072543.1	EMBL	gene	849132	850457	.	+	.	ID=gene722;Name=dnaB;gbkey=Gene;gene=dnaB;gene_biotype=protein_coding;locus_tag=TW752
BX072543.1	EMBL	CDS	849132	850457	.	+	0	ID=cds718;Parent=gene722;Dbxref=GOA:Q83H89,InterPro:IPR003593,InterPro:IPR007692,InterPro:IPR007693,InterPro:IPR007694,InterPro:IPR016136,InterPro:IPR027417,UniProtKB/TrEMBL:Q83H89,NCBI_GP:CAD67411.1;Name=CAD67411.1;Note=Similar to Escherichia coli replicative DNA helicase DnaB or GroP or GrpA or b4052 SWALL:DNAB_ECOLI (SWALL:P03005) (471 aa) fasta scores: E(): 4.2e-57%2C 38.39%25 id in 448 aa%2C and to Streptomyces coelicolor putative replicative DNA helicase DnaB or SCO3911 or SCH24.33 SWALL:Q9X8U7 (EMBL:AL049826) (491 aa) fasta scores: E(): 9.8e-88%2C 53.34%25 id in 433 aa;gbkey=CDS;gene=dnaB;product=replicative DNA helicase;protein_id=CAD67411.1;transl_table=11
BX072543.1	EMBL	sequence_feature	849144	849453	.	+	.	ID=id1506;Note=DnaB-like helicase N terminal domain Score %3D 126.0 E-value %3D 4.8e-35;gbkey=misc_feature;gene=dnaB
BX072543.1	EMBL	sequence_feature	849666	850254	.	+	.	ID=id1507;Note=DnaB-like helicase C terminal domain Score %3D 368.0 E-value %3D 6.8e-108;gbkey=misc_feature;gene=dnaB
BX072543.1	EMBL	sequence_feature	849750	849773	.	+	.	ID=id1508;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=dnaB
BX072543.1	EMBL	gene	850732	851337	.	+	.	ID=gene723;Name=TW753;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW753
BX072543.1	EMBL	CDS	850732	851337	.	+	0	ID=cds719;Parent=gene723;Dbxref=GOA:Q83N81,InterPro:IPR007348,InterPro:IPR014755,InterPro:IPR014756,UniProtKB/TrEMBL:Q83N81,NCBI_GP:CAD67412.1;Name=CAD67412.1;Note=Similar to Oceanobacillus iheyensis hypothetical conserved protein ob2412 SWALL:BAC14368 (EMBL:AP004601) (194 aa) fasta scores: E(): 0.00011%2C 23.56%25 id in 191 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67412.1;transl_table=11
BX072543.1	EMBL	sequence_feature	850732	850803	.	+	.	ID=id1509;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.734 between residues 24 and 25;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	850750	850818	.	+	.	ID=id1510;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29 and 169-191;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	851236	851304	.	+	.	ID=id1510;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29 and 169-191;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	gene	851640	852425	.	+	.	ID=gene724;Name=nagD;gbkey=Gene;gene=nagD;gene_biotype=protein_coding;locus_tag=TW754
BX072543.1	EMBL	CDS	851640	852425	.	+	0	ID=cds720;Parent=gene724;Dbxref=GOA:Q83N80,InterPro:IPR006357,InterPro:IPR006439,InterPro:IPR023214,InterPro:IPR023215,UniProtKB/TrEMBL:Q83N80,NCBI_GP:CAD67413.1;Name=CAD67413.1;Note=Similar to Escherichia coli NagD protein NagD or b0675 or z0822 or ecs0705 SWALL:NAGD_ECOLI (SWALL:P15302) (250 aa) fasta scores: E(): 1.8e-34%2C 41.46%25 id in 246 aa%2C and to Streptomyces coelicolor hypothetical protein SCO2843 or SCE20.17c SWALL:Q9RDA8 (EMBL:AL136058) (259 aa) fasta scores: E(): 9.8e-58%2C 57.81%25 id in 256 aa;gbkey=CDS;gene=nagD;product=putative N-acetylglucosamine-6-phosphate deacetylase NagD;protein_id=CAD67413.1;transl_table=11
BX072543.1	EMBL	sequence_feature	851655	852327	.	+	.	ID=id1511;Note=haloacid dehalogenase-like hydrolase Score %3D 45.9 E-value %3D 6.5e-11;gbkey=misc_feature;gene=nagD
BX072543.1	EMBL	gene	852422	853066	.	-	.	ID=gene725;Name=pyrE;gbkey=Gene;gene=pyrE;gene_biotype=protein_coding;locus_tag=TW755
BX072543.1	EMBL	CDS	852422	853066	.	-	0	ID=cds721;Parent=gene725;Dbxref=GOA:Q83H88,InterPro:IPR000836,InterPro:IPR004467,InterPro:IPR023031,InterPro:IPR029057,NCBI_GP:CAD67414.1;Name=CAD67414.1;Note=Similar to Pyrococcus abyssi orotate phosphoribosyltransferase PyrE or Pab2430 SWALL:PYRE_PYRAB (SWALL:P56814) (182 aa) fasta scores: E(): 8e-18%2C 39.44%25 id in 180 aa%2C and to Streptomyces coelicolor orotate phosphoribosyltransferase PyrE or SCO3650 or SCH10.28c SWALL:PYRE_STRCO (SWALL:Q9X8R7) (182 aa) fasta scores: E(): 3.1e-32%2C 55.55%25 id in 171 aa. Note possible alternative downstream start sites.;gbkey=CDS;gene=pyrE;product=orotate phosphoribosyltransferase;protein_id=CAD67414.1;transl_table=11
BX072543.1	EMBL	sequence_feature	852454	852892	.	-	.	ID=id1512;Note=Phosphoribosyl transferase domain Score %3D 58.3 E-value %3D 1.2e-14;gbkey=misc_feature;gene=pyrE
BX072543.1	EMBL	gene	853087	853896	.	+	.	ID=gene726;Name=xthA1;gbkey=Gene;gene=xthA1;gene_biotype=protein_coding;locus_tag=TW756
BX072543.1	EMBL	CDS	853087	853896	.	+	0	ID=cds722;Parent=gene726;Dbxref=GOA:Q83H87,InterPro:IPR004808,InterPro:IPR005135,UniProtKB/TrEMBL:Q83H87,NCBI_GP:CAD67415.1;Name=CAD67415.1;Note=Similar to Escherichia coli exodeoxyribonuclease III XthA or Xth or b1749 SWALL:EX3_ECOLI (SWALL:P09030) (268 aa) fasta scores: E(): 6.5e-17%2C 29.93%25 id in 284 aa%2C and to Caulobacter crescentus exodeoxyribonuclease III cc2011 SWALL:Q9A6S2 (EMBL:AE005874) (262 aa) fasta scores: E(): 4.8e-33%2C 39.41%25 id in 274 aa;gbkey=CDS;gene=xthA1;product=exodeoxyribonuclease III;protein_id=CAD67415.1;transl_table=11
BX072543.1	EMBL	sequence_feature	853087	853888	.	+	.	ID=id1513;Note=Endonuclease/Exonuclease/phosphatase family Score %3D 160.2 E-value %3D 2.5e-45;gbkey=misc_feature;gene=xthA1
BX072543.1	EMBL	gene	853877	854614	.	-	.	ID=gene727;Name=TW757;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW757
BX072543.1	EMBL	CDS	853877	854614	.	-	0	ID=cds723;Parent=gene727;Dbxref=UniProtKB/TrEMBL:Q83N79,NCBI_GP:CAD67416.1;Name=CAD67416.1;Note=No significant database matches. Note overlap with downstteam CDS.;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67416.1;transl_table=11
BX072543.1	EMBL	sequence_feature	854303	854371	.	-	.	ID=id1514;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 101-123%2C 143-165%2C 185-207 and 217-239;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	854177	854245	.	-	.	ID=id1514;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 101-123%2C 143-165%2C 185-207 and 217-239;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	854051	854119	.	-	.	ID=id1514;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 101-123%2C 143-165%2C 185-207 and 217-239;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	853955	854023	.	-	.	ID=id1514;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 101-123%2C 143-165%2C 185-207 and 217-239;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	854662	856761	.	-	.	ID=gene728;Name=clpB;gbkey=Gene;gene=clpB;gene_biotype=protein_coding;locus_tag=TW758
BX072543.1	EMBL	CDS	854662	856761	.	-	0	ID=cds724;Parent=gene728;Dbxref=GOA:Q83N78,InterPro:IPR001270,InterPro:IPR003593,InterPro:IPR003959,InterPro:IPR018368,InterPro:IPR019489,InterPro:IPR027417,InterPro:IPR028299,NCBI_GP:CAD67417.1;Name=CAD67417.1;Note=Similar to Streptomyces albus G heat shock protein ClpB SWALL:Q9Z6E4 (EMBL:AF076980) (857 aa) fasta scores: E(): 2.9e-134%2C 59.62%25 id in 686 aa. Note approx 150 residue N-termunal truncation relative to all homologues.;gbkey=CDS;gene=clpB;product=heat shock protein ClpB;protein_id=CAD67417.1;transl_table=11
BX072543.1	EMBL	sequence_feature	855289	855345	.	-	.	ID=id1515;Note=PS00871 Chaperonins clpA/B signature 2.;gbkey=misc_feature;gene=clpB
BX072543.1	EMBL	sequence_feature	855394	855417	.	-	.	ID=id1516;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=clpB
BX072543.1	EMBL	sequence_feature	856044	856620	.	-	.	ID=id1517;Note=ATPase family associated with various cellular activities (AAA) Score %3D 53.5 E-value %3D 3.2e-13;gbkey=misc_feature;gene=clpB
BX072543.1	EMBL	sequence_feature	856582	856605	.	-	.	ID=id1518;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=clpB
BX072543.1	EMBL	gene	856754	857146	.	-	.	ID=gene729;Name=hspR;gbkey=Gene;gene=hspR;gene_biotype=protein_coding;locus_tag=TW759
BX072543.1	EMBL	CDS	856754	857146	.	-	0	ID=cds725;Parent=gene729;Dbxref=GOA:Q83N77,InterPro:IPR000551,InterPro:IPR009061,UniProtKB/TrEMBL:Q83N77,NCBI_GP:CAD67418.1;Name=CAD67418.1;Note=Similar to Streptomyces coelicolor putative heat shock protein HspR or SCO3668 or SCH44.08c SWALL:HSPR_STRCO (SWALL:P40183) (151 aa) fasta scores: E(): 2.6e-11%2C 40.15%25 id in 132 aa%2C and to Streptomyces albus G HspR SWALL:P96458 (EMBL:U43299) (154 aa) fasta scores: E(): 5.6e-10%2C 39.41%25 id in 137 aa;gbkey=CDS;gene=hspR;product=heat shock regulator protein HspR;protein_id=CAD67418.1;transl_table=11
BX072543.1	EMBL	sequence_feature	857017	857119	.	-	.	ID=id1519;Note=Bacterial regulatory proteins%2C merR family Score %3D 23.4 E-value %3D 0.00023;gbkey=misc_feature;gene=hspR
BX072543.1	EMBL	sequence_feature	857063	857128	.	-	.	ID=id1520;Note=Predicted helix-turn-helix motif with score 1107.000%2C SD 2.96 at aa 7-28%2C sequence FTVTVAAALSGMHPQTLRKLDR;gbkey=misc_feature;gene=hspR
BX072543.1	EMBL	gene	857155	858018	.	-	.	ID=gene730;Name=dnaJ2;gbkey=Gene;gene=dnaJ2;gene_biotype=protein_coding;locus_tag=TW760
BX072543.1	EMBL	CDS	857155	858018	.	-	0	ID=cds726;Parent=gene730;Dbxref=GOA:Q83N76,InterPro:IPR001623,InterPro:IPR002939,InterPro:IPR008971,UniProtKB/TrEMBL:Q83N76,NCBI_GP:CAD67419.1;Name=CAD67419.1;Note=Similar to Streptomyces coelicolor chaperone protein DnaJ or SCO3669 or SCH44.09c SWALL:DNAJ_STRCO (SWALL:P40170) (399 aa) fasta scores: E(): 3.5e-17%2C 30.82%25 id in 399 aa%2C and to Escherichia coli curved DNA-binding protein CbpA or b1000 SWALL:CBPA_ECOLI (SWALL:P36659) (306 aa) fasta scores: E(): 1.5e-20%2C 40.19%25 id in 301 aa%2C and to Escherichia coli chaperone protein DnaJ or GroP or b0015 SWALL:DNAJ_ECOLI (SWALL:P08622) (375 aa) fasta scores: E(): 5.1e-13%2C 31.32%25 id in 348 aa;gbkey=CDS;gene=dnaJ2;product=molecular chaperone DnaJ;protein_id=CAD67419.1;transl_table=11
BX072543.1	EMBL	sequence_feature	857223	857580	.	-	.	ID=id1521;Note=DnaJ C terminal region Score %3D 115.5 E-value %3D 6.9e-32;gbkey=misc_feature;gene=dnaJ2
BX072543.1	EMBL	sequence_feature	857796	857991	.	-	.	ID=id1522;Note=DnaJ domain Score %3D 120.0 E-value %3D 3.1e-33;gbkey=misc_feature;gene=dnaJ2
BX072543.1	EMBL	gene	858011	858580	.	-	.	ID=gene731;Name=grpE;gbkey=Gene;gene=grpE;gene_biotype=protein_coding;locus_tag=TW761
BX072543.1	EMBL	CDS	858011	858580	.	-	0	ID=cds727;Parent=gene731;Dbxref=GOA:Q83N75,InterPro:IPR000740,InterPro:IPR009012,InterPro:IPR013805,NCBI_GP:CAD67420.1;Name=CAD67420.1;Note=Similar to Streptomyces coelicolor GrpE protein or SCO3670 or SCH44.10c SWALL:GRPE_STRCO (SWALL:Q05562) (225 aa) fasta scores: E(): 1.3e-12%2C 33.16%25 id in 196 aa%2C and to Bacillus thermoglucosidasius GrpE protein SWALL:Q9KWS8 (EMBL:AB017035) (224 aa) fasta scores: E(): 2.8e-08%2C 30.81%25 id in 185 aa%2C and to Leptospira interrogans GrpE protein SWALL:GRPE_LEPIN (SWALL:O51868) (212 aa) fasta scores: E(): 1.6e-07%2C 28.85%25 id in 201 aa;gbkey=CDS;gene=grpE;product=heat shock protein GrpE;protein_id=CAD67420.1;transl_table=11
BX072543.1	EMBL	sequence_feature	858025	858505	.	-	.	ID=id1523;Note=GrpE Score %3D 67.1 E-value %3D 2.6e-17;gbkey=misc_feature;gene=grpE
BX072543.1	EMBL	sequence_feature	858029	858160	.	-	.	ID=id1524;Note=PS01071 grpE protein signature.;gbkey=misc_feature;gene=grpE
BX072543.1	EMBL	gene	858605	860416	.	-	.	ID=gene732;Name=dnaK;gbkey=Gene;gene=dnaK;gene_biotype=protein_coding;locus_tag=TW762
BX072543.1	EMBL	CDS	858605	860416	.	-	0	ID=cds728;Parent=gene732;Dbxref=GOA:P64410,InterPro:IPR012725,InterPro:IPR013126,InterPro:IPR018181,InterPro:IPR029047,InterPro:IPR029048,NCBI_GP:CAD67421.1;Name=CAD67421.1;Note=Similar to Mycobacterium paratuberculosis chaperone protein DnaK SWALL:DNAK_MYCPA (SWALL:Q00488) (622 aa) fasta scores: E(): 2e-134%2C 66.72%25 id in 625 aa;gbkey=CDS;gene=dnaK;product=chaperone protein DnaK;protein_id=CAD67421.1;transl_table=11
BX072543.1	EMBL	sequence_feature	858682	860407	.	-	.	ID=id1525;Note=Hsp70 protein Score %3D 1198.7 E-value %3D 0;gbkey=misc_feature;gene=dnaK
BX072543.1	EMBL	sequence_feature	859436	859480	.	-	.	ID=id1526;Note=PS01036 Heat shock hsp70 proteins family signature 3.;gbkey=misc_feature;gene=dnaK
BX072543.1	EMBL	sequence_feature	859874	859915	.	-	.	ID=id1527;Note=PS00329 Heat shock hsp70 proteins family signature 2.;gbkey=misc_feature;gene=dnaK
BX072543.1	EMBL	sequence_feature	860375	860398	.	-	.	ID=id1528;Note=PS00297 Heat shock hsp70 proteins family signature 1.;gbkey=misc_feature;gene=dnaK
BX072543.1	EMBL	gene	860629	861141	.	+	.	ID=gene733;Name=TW763;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW763
BX072543.1	EMBL	CDS	860629	861141	.	+	0	ID=cds729;Parent=gene733;Dbxref=GOA:Q820Y6,InterPro:IPR002125,InterPro:IPR016192,InterPro:IPR016193,InterPro:IPR028883,UniProtKB/TrEMBL:Q820Y6,NCBI_GP:CAD67422.1;Name=CAD67422.1;Note=Similar to many of undefined function eg. Streptomyces coelicolor putative deaminase SCO4038 or 2SCD60.04c SWALL:Q9AK79 (EMBL:AL583944) (143 aa) fasta scores: E(): 4.2e-25%2C 52.11%25 id in 142 aa%2C and to Mycobacterium tuberculosis hypothetical 15.9 kDa protein Rv3752c or mtv025.100c or mt3859 SWALL:O69719 (EMBL:AL022121) (152 aa) fasta scores: E(): 1.3e-24%2C 52%25 id in 150 aa;gbkey=CDS;product=conserved hypothetical protein (putative deaminase);protein_id=CAD67422.1;transl_table=11
BX072543.1	EMBL	sequence_feature	860689	860995	.	+	.	ID=id1529;Note=Cytidine and deoxycytidylate deaminase zinc-binding region Score %3D 138.2 E-value %3D 1.1e-38;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	860848	860961	.	+	.	ID=id1530;Note=PS00903 Cytidine and deoxycytidylate deaminases zinc-binding region signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	861255	862145	.	+	.	ID=gene734;Name=proC;gbkey=Gene;gene=proC;gene_biotype=protein_coding;locus_tag=TW764
BX072543.1	EMBL	CDS	861255	862145	.	+	0	ID=cds730;Parent=gene734;Dbxref=GOA:Q83H86,InterPro:IPR000304,InterPro:IPR008927,InterPro:IPR016040,InterPro:IPR028939,InterPro:IPR029036,UniProtKB/TrEMBL:Q83H86,NCBI_GP:CAD67423.1;Name=CAD67423.1;Note=Similar to Escherichia coli pyrroline-5-carboxylate reductase ProC or b0386 SWALL:PROC_ECOLI (SWALL:P00373) (269 aa) fasta scores: E(): 5.8e-11%2C 25.45%25 id in 275 aa;gbkey=CDS;gene=proC;product=pyrroline-5-carboxylate reductase;protein_id=CAD67423.1;transl_table=11
BX072543.1	EMBL	sequence_feature	861303	862035	.	+	.	ID=id1531;Note=Delta 1-pyrroline-5-carboxylate reductase Score %3D 73.8 E-value %3D 2.5e-19;gbkey=misc_feature;gene=proC
BX072543.1	EMBL	gene	862538	862864	.	+	.	ID=gene735;Name=TW765;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW765
BX072543.1	EMBL	CDS	862538	862864	.	+	0	ID=cds731;Parent=gene735;Dbxref=InterPro:IPR008554,InterPro:IPR012336,UniProtKB/TrEMBL:Q83H85,NCBI_GP:CAD67424.1;Name=CAD67424.1;Note=No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67424.1;transl_table=11
BX072543.1	EMBL	gene	862885	864183	.	-	.	ID=gene736;Name=aspS;gbkey=Gene;gene=aspS;gene_biotype=protein_coding;locus_tag=TW766
BX072543.1	EMBL	CDS	862885	864183	.	-	0	ID=cds732;Parent=gene736;Dbxref=GOA:Q83H84,InterPro:IPR002312,InterPro:IPR004364,InterPro:IPR004365,InterPro:IPR004523,InterPro:IPR006195,InterPro:IPR012340,InterPro:IPR018150,UniProtKB/TrEMBL:Q83H84,NCBI_GP:CAD67425.1;Name=CAD67425.1;Note=Similar to Pyrococcus kodakaraensis aspartyl-tRNA synthetase AspS SWALL:SYD_PYRKO (SWALL:Q52428) (438 aa) fasta scores: E(): 1.8e-60%2C 39.63%25 id in 434 aa;gbkey=CDS;gene=aspS;product=aspartyl-tRNA synthetase;protein_id=CAD67425.1;transl_table=11
BX072543.1	EMBL	sequence_feature	862899	863850	.	-	.	ID=id1532;Note=tRNA synthetases class II (D%2C K and N) Score %3D 212.8 E-value %3D 3.6e-61;gbkey=misc_feature;gene=aspS
BX072543.1	EMBL	sequence_feature	863889	864132	.	-	.	ID=id1533;Note=OB-fold nucleic acid binding domain Score %3D 39.6 E-value %3D 4.9e-09;gbkey=misc_feature;gene=aspS
BX072543.1	EMBL	gene	864255	864863	.	+	.	ID=gene737;Name=TW767;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW767
BX072543.1	EMBL	CDS	864255	864863	.	+	0	ID=cds733;Parent=gene737;Dbxref=InterPro:IPR013078,InterPro:IPR029033,UniProtKB/TrEMBL:Q83N73,NCBI_GP:CAD67426.1;Name=CAD67426.1;Note=Similar to Streptomyces coelicolor putative phosphoglycerate mutase SCO4470 or SCD65.13 SWALL:Q9F2R9 (EMBL:AL392176) (233 aa) fasta scores: E(): 9.5e-34%2C 45.12%25 id in 195 aa;gbkey=CDS;product=putative phosphoglycerate mutase;protein_id=CAD67426.1;transl_table=11
BX072543.1	EMBL	sequence_feature	864258	864780	.	+	.	ID=id1534;Note=Phosphoglycerate mutase family Score %3D -64.0 E-value %3D 3.5e-06;gbkey=misc_feature
BX072543.1	EMBL	gene	864901	865533	.	+	.	ID=gene738;Name=TW768;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW768
BX072543.1	EMBL	CDS	864901	865533	.	+	0	ID=cds734;Parent=gene738;Dbxref=GOA:Q83H83,InterPro:IPR000866,InterPro:IPR012336,UniProtKB/TrEMBL:Q83H83,NCBI_GP:CAD67427.1;Name=CAD67427.1;Note=No significant database matches;gbkey=CDS;product=putative lipoprotein;protein_id=CAD67427.1;transl_table=11
BX072543.1	EMBL	sequence_feature	864901	864996	.	+	.	ID=id1535;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.764 between residues 50 and 51;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	864928	864996	.	+	.	ID=id1536;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 28-50;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	864955	864987	.	+	.	ID=id1537;Note=PS00013 Prokaryotic membrane lipoprotein lipid attachment site.;gbkey=misc_feature
BX072543.1	EMBL	gene	865758	866444	.	+	.	ID=gene739;Name=ccdA;gbkey=Gene;gene=ccdA;gene_biotype=protein_coding;locus_tag=TW769
BX072543.1	EMBL	CDS	865758	866444	.	+	0	ID=cds735;Parent=gene739;Dbxref=GOA:Q83N72,InterPro:IPR003834,UniProtKB/TrEMBL:Q83N72,NCBI_GP:CAD67428.1;Name=CAD67428.1;Note=Similar to Bacillus subtilis cytochrome c-type biogenesis protein CcdA SWALL:CCDA_BACSU (SWALL:P45706) (235 aa) fasta scores: E(): 1.7e-09%2C 26.4%25 id in 231 aa%2C and to Rhodobacter capsulatus c-type cytochrome biogenesis protein CcdA SWALL:Q9LA04 (EMBL:AF156103) (252 aa) fasta scores: E(): 2.7e-12%2C 32.8%25 id in 253 aa;gbkey=CDS;gene=ccdA;product=cytochrome c-type biogenesis protein CcdA;protein_id=CAD67428.1;transl_table=11
BX072543.1	EMBL	sequence_feature	865758	865841	.	+	.	ID=id1538;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.965) with cleavage site probability 0.585 between residues 28 and 29;gbkey=misc_feature;gene=ccdA
BX072543.1	EMBL	sequence_feature	865800	865868	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=1/6;partial=true
BX072543.1	EMBL	sequence_feature	865926	865994	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=2/6;partial=true
BX072543.1	EMBL	sequence_feature	866007	866075	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=3/6;partial=true
BX072543.1	EMBL	sequence_feature	866112	866180	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=4/6;partial=true
BX072543.1	EMBL	sequence_feature	866223	866291	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=5/6;partial=true
BX072543.1	EMBL	sequence_feature	866328	866396	.	+	.	ID=id1539;Note=6 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 57-79%2C 84-106%2C 119-141%2C 156-178 and 191-213;gbkey=misc_feature;gene=ccdA;is_ordered=true;part=6/6;partial=true
BX072543.1	EMBL	sequence_feature	865812	866379	.	+	.	ID=id1540;Note=Cytochrome C biogenesis protein transmembrane region Score %3D 125.3 E-value %3D 8e-35;gbkey=misc_feature;gene=ccdA
BX072543.1	EMBL	sequence_feature	866133	866162	.	+	.	ID=id1541;Note=PS00086 Cytochrome P450 cysteine heme-iron ligand signature.;gbkey=misc_feature;gene=ccdA
BX072543.1	EMBL	gene	866473	868056	.	+	.	ID=gene740;Name=TW770;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW770
BX072543.1	EMBL	CDS	866473	868056	.	+	0	ID=cds736;Parent=gene740;Dbxref=InterPro:IPR007816,UniProtKB/TrEMBL:Q83N71,NCBI_GP:CAD67429.1;Name=CAD67429.1;Note=Similar to Streptomyces coelicolor putative integral membrane protein SCO4474 or SCD65.17 SWALL:Q9F2R5 (EMBL:AL392176) (574 aa) fasta scores: E(): 1.8e-16%2C 37.09%25 id in 523 aa;gbkey=CDS;product=putative integral membrane protein;protein_id=CAD67429.1;transl_table=11
BX072543.1	EMBL	sequence_feature	866473	866550	.	+	.	ID=id1542;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.999) with cleavage site probability 0.679 between residues 26 and 27;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	866485	866544	.	+	.	ID=id1543;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 54-76%2C 173-195 and 450-472;gbkey=misc_feature;is_ordered=true;part=1/4;partial=true
BX072543.1	EMBL	sequence_feature	866632	866700	.	+	.	ID=id1543;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 54-76%2C 173-195 and 450-472;gbkey=misc_feature;is_ordered=true;part=2/4;partial=true
BX072543.1	EMBL	sequence_feature	866989	867057	.	+	.	ID=id1543;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 54-76%2C 173-195 and 450-472;gbkey=misc_feature;is_ordered=true;part=3/4;partial=true
BX072543.1	EMBL	sequence_feature	867820	867888	.	+	.	ID=id1543;Note=4 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 5-24%2C 54-76%2C 173-195 and 450-472;gbkey=misc_feature;is_ordered=true;part=4/4;partial=true
BX072543.1	EMBL	gene	868063	869034	.	+	.	ID=gene741;Name=TW771;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW771
BX072543.1	EMBL	CDS	868063	869034	.	+	0	ID=cds737;Parent=gene741;Dbxref=GOA:Q83N70,InterPro:IPR002541,InterPro:IPR017562,UniProtKB/TrEMBL:Q83N70,NCBI_GP:CAD67430.1;Name=CAD67430.1;Note=Similar to Aquifex aeolicus cytochrome c biogenesis protein HemX2 or aq_2043 SWALL:O67831 (EMBL:AE000769) (312 aa) fasta scores: E(): 3.7e-27%2C 33.58%25 id in 262 aa%2C and to Chlamydomonas reinhardtii cytochrome c biogenesis protein CcsA SWALL:CCSA_CHLRE (SWALL:P48269) (353 aa) fasta scores: E(): 4.9e-22%2C 29.43%25 id in 299 aa;gbkey=CDS;product=putative cytochrome biogenesis protein;protein_id=CAD67430.1;transl_table=11
BX072543.1	EMBL	sequence_feature	868063	868152	.	+	.	ID=id1544;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.740) with cleavage site probability 0.316 between residues 30 and 31;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	868105	868173	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	868330	868398	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	868411	868479	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	868498	868566	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	868609	868677	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	868756	868815	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	868858	868917	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	868936	869004	.	+	.	ID=id1545;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-37%2C 90-112%2C 117-139%2C 146-168%2C 183-205%2C 232-251%2C 266-285 and 292-314;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	868297	868954	.	+	.	ID=id1546;Note=Cytochrome C assembly protein Score %3D 64.4 E-value %3D 1.7e-16;gbkey=misc_feature
BX072543.1	EMBL	gene	869029	871320	.	-	.	ID=gene742;Name=TW772;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW772
BX072543.1	EMBL	CDS	869029	871320	.	-	0	ID=cds738;Parent=gene742;Dbxref=InterPro:IPR008009,InterPro:IPR012503,UniProtKB/TrEMBL:Q83N69,NCBI_GP:CAD67431.1;Name=CAD67431.1;Note=No significant database matches. Rep6.;gbkey=CDS;product=WiSP family protein;protein_id=CAD67431.1;transl_table=11
BX072543.1	EMBL	sequence_feature	871216	871320	.	-	.	ID=id1547;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.998) with cleavage site probability 0.804 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	gene	871415	871729	.	-	.	ID=gene743;Name=TW773;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW773
BX072543.1	EMBL	CDS	871415	871729	.	-	0	ID=cds739;Parent=gene743;Dbxref=GOA:Q83N68,InterPro:IPR001626,InterPro:IPR029022,UniProtKB/TrEMBL:Q83N68,NCBI_GP:CAD67432.1;Name=CAD67432.1;Note=No significant database matches;gbkey=CDS;product=putative membrane protein;protein_id=CAD67432.1;transl_table=11
BX072543.1	EMBL	sequence_feature	871628	871687	.	-	.	ID=id1548;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 41-61 and 71-93;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	871547	871609	.	-	.	ID=id1548;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 41-61 and 71-93;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	871451	871519	.	-	.	ID=id1548;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 15-34%2C 41-61 and 71-93;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	sequence_feature	871474	871693	.	-	.	ID=id1549;Note=ABC 3 transport family Score %3D 65.4 E-value %3D 2.9e-17;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	871637	871729	.	-	.	ID=id1550;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.725) with cleavage site probability 0.502 between residues 31 and 32;gbkey=misc_feature
BX072543.1	EMBL	repeat_region	871689	871807	.	+	.	ID=id1551;Note=rep12;gbkey=repeat_region
BX072543.1	EMBL	gene	871798	872406	.	-	.	ID=gene744;Name=TW774;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW774
BX072543.1	EMBL	CDS	871798	872406	.	-	0	ID=cds740;Parent=gene744;Dbxref=InterPro:IPR012421,UniProtKB/TrEMBL:Q83N67,NCBI_GP:CAD67433.1;Name=CAD67433.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD67433.1;transl_table=11
BX072543.1	EMBL	repeat_region	872006	872329	.	+	.	ID=id1552;Note=rep10;gbkey=repeat_region
BX072543.1	EMBL	gene	872789	874540	.	+	.	ID=gene745;Name=metG;gbkey=Gene;gene=metG;gene_biotype=protein_coding;gene_synonym=metS;locus_tag=TW775
BX072543.1	EMBL	CDS	872789	874540	.	+	0	ID=cds741;Parent=gene745;Dbxref=GOA:Q83H82,InterPro:IPR009080,InterPro:IPR013155,InterPro:IPR014729,InterPro:IPR014758,InterPro:IPR015413,InterPro:IPR023457,UniProtKB/TrEMBL:Q83H82,NCBI_GP:CAD67434.1;Name=CAD67434.1;Note=Similar to Bacillus stearothermophilus methionyl-tRNA synthetase MetG or MetS SWALL:SYM_BACST (SWALL:P23920) (649 aa) fasta scores: E(): 1e-30%2C 36.62%25 id in 598 aa;gbkey=CDS;gene=metG;product=methionyl-tRNA synthetase;protein_id=CAD67434.1;transl_table=11
BX072543.1	EMBL	sequence_feature	872792	874019	.	+	.	ID=id1553;Note=tRNA synthetases class I (I%2C L%2C M and V) Score %3D -142.1 E-value %3D 1.2e-11;gbkey=misc_feature;gene=metG
BX072543.1	EMBL	repeat_region	874563	875027	.	+	.	ID=id1554;Note=rep11 inverted/repeated at 121738..121274;gbkey=repeat_region
BX072543.1	EMBL	gene	875052	881462	.	-	.	ID=gene746;Name=TW776;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW776
BX072543.1	EMBL	CDS	875052	881462	.	-	0	ID=cds742;Parent=gene746;Dbxref=GOA:Q83N66,InterPro:IPR008009,InterPro:IPR012421,InterPro:IPR013783,InterPro:IPR015919,UniProtKB/TrEMBL:Q83N66,NCBI_GP:CAD67435.1;Name=CAD67435.1;Note=No significant database matches;gbkey=CDS;product=WiSP family protein;protein_id=CAD67435.1;transl_table=11
BX072543.1	EMBL	gene	881548	882351	.	-	.	ID=gene747;Name=TW777;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW777
BX072543.1	EMBL	CDS	881548	882351	.	-	0	ID=cds743;Parent=gene747;Dbxref=GOA:Q83H81,InterPro:IPR001173,InterPro:IPR029044,UniProtKB/TrEMBL:Q83H81,NCBI_GP:CAD67436.1;Name=CAD67436.1;Note=Similar to Streptomyces coelicolor putative glycosyl transferase SCO1423 or SC6D7.16 SWALL:Q9RKY2 (EMBL:AL133213) (302 aa) fasta scores: E(): 6.1e-44%2C 49.15%25 id in 236 aa%2C and to Mus musculus dolichol-phosphate mannosyltransferase Dpm1 SWALL:DPM1_MOUSE (SWALL:O70152) (260 aa) fasta scores: E(): 3.7e-24%2C 37.6%25 id in 234 aa;gbkey=CDS;product=putative glycosyl transferase;protein_id=CAD67436.1;transl_table=11
BX072543.1	EMBL	sequence_feature	881829	882327	.	-	.	ID=id1555;Note=Glycosyl transferase Score %3D 97.1 E-value %3D 2.4e-26;gbkey=misc_feature
BX072543.1	EMBL	gene	882521	882823	.	+	.	ID=gene748;Name=TW778;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW778
BX072543.1	EMBL	CDS	882521	882823	.	+	0	ID=cds744;Parent=gene748;Dbxref=UniProtKB/TrEMBL:Q83H80,NCBI_GP:CAD67437.1;Name=CAD67437.1;Note=Doubtful CDS. No significant database matches. Note possible doubtful CDS on opposite strand.;gbkey=CDS;product=hypothetical protein;protein_id=CAD67437.1;transl_table=11
BX072543.1	EMBL	gene	882892	883335	.	-	.	ID=gene749;Name=TW779;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW779
BX072543.1	EMBL	CDS	882892	883335	.	-	0	ID=cds745;Parent=gene749;Dbxref=InterPro:IPR009937,UniProtKB/TrEMBL:Q83N65,NCBI_GP:CAD67438.1;Name=CAD67438.1;Note=Weakly similar to Mycobacterium leprae putative membrane protein Ml2296 SWALL:Q9CB97 (EMBL:AL583925) (181 aa) fasta scores: E(): 0.039%2C 32.06%25 id in 131 aa;gbkey=CDS;product=putative membrane protein;protein_id=CAD67438.1;transl_table=11
BX072543.1	EMBL	sequence_feature	883153	883221	.	-	.	ID=id1556;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-61 and 76-98;gbkey=misc_feature;is_ordered=true;part=1/2;partial=true
BX072543.1	EMBL	sequence_feature	883042	883110	.	-	.	ID=id1556;Note=2 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 39-61 and 76-98;gbkey=misc_feature;is_ordered=true;part=2/2;partial=true
BX072543.1	EMBL	sequence_feature	883264	883335	.	-	.	ID=id1557;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.970) with cleavage site probability 0.605 between residues 24 and 25;gbkey=misc_feature
BX072543.1	EMBL	gene	883348	883710	.	-	.	ID=gene750;Name=TW780;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW780
BX072543.1	EMBL	CDS	883348	883710	.	-	0	ID=cds746;Parent=gene750;Dbxref=UniProtKB/TrEMBL:Q83N64,NCBI_GP:CAD67439.1;Name=CAD67439.1;Note=N-terminus similar to that of Streptomyces coelicolor putative secreted protein SCO2461 or SCC24.32 SWALL:Q9L085 (EMBL:AL163003) (108 aa) fasta scores: E(): 0.73%2C 39.13%25 id in 46 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67439.1;transl_table=11
BX072543.1	EMBL	sequence_feature	883648	883701	.	-	.	ID=id1558;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 4-21;gbkey=misc_feature
BX072543.1	EMBL	gene	883834	885900	.	-	.	ID=gene751;Name=TW781;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW781
BX072543.1	EMBL	CDS	883834	885900	.	-	0	ID=cds747;Parent=gene751;Dbxref=GOA:Q83N63,InterPro:IPR000718,InterPro:IPR008753,InterPro:IPR018497,InterPro:IPR024079,UniProtKB/TrEMBL:Q83N63,NCBI_GP:CAD67440.1;Name=CAD67440.1;Note=Similar to many predicted peptidases eg. Mycobacterium tuberculosis zinc metalloprotease Rv0198c or mtv033.06c or mt0208 SWALL:O53649 (EMBL:AL021928) (663 aa) fasta scores: E(): 8e-92%2C 44.16%25 id in 668 aa;gbkey=CDS;product=putative peptidase;protein_id=CAD67440.1;transl_table=11
BX072543.1	EMBL	sequence_feature	883848	884454	.	-	.	ID=id1559;Note=Peptidase family M13 Score %3D 248.2 E-value %3D 8.3e-72;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	884311	884340	.	-	.	ID=id1560;Note=PS00142 Neutral zinc metallopeptidases%2C zinc-binding region signature.;gbkey=misc_feature
BX072543.1	EMBL	gene	885973	886731	.	+	.	ID=gene752;Name=TW782;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW782
BX072543.1	EMBL	CDS	885973	886731	.	+	0	ID=cds748;Parent=gene752;Dbxref=GOA:Q83H79,InterPro:IPR023198,InterPro:IPR023214,UniProtKB/TrEMBL:Q83H79,NCBI_GP:CAD67441.1;Name=CAD67441.1;Note=Similar to Alcaligenes eutrophus phosphoglycolate phosphatase%2C chromosomal CbbZC SWALL:GPHC_ALCEU (SWALL:P40852) (231 aa) fasta scores: E(): 1.1e-12%2C 33.33%25 id in 228 aa;gbkey=CDS;product=putative hydrolase;protein_id=CAD67441.1;transl_table=11
BX072543.1	EMBL	sequence_feature	886084	886642	.	+	.	ID=id1561;Note=haloacid dehalogenase-like hydrolase Score %3D 64.8 E-value %3D 1.3e-16;gbkey=misc_feature
BX072543.1	EMBL	tRNA	886799	886883	.	+	.	ID=rna51;Note=tRNA Ser anticodon GGA%2C Cove score 60.29;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	exon	886799	886883	.	+	.	ID=id1562;Parent=rna51;Note=tRNA Ser anticodon GGA%2C Cove score 60.29;gbkey=tRNA;product=tRNA-Ser
BX072543.1	EMBL	gene	887009	887890	.	+	.	ID=gene753;Name=TW783;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW783
BX072543.1	EMBL	CDS	887009	887890	.	+	0	ID=cds749;Parent=gene753;Dbxref=GOA:Q83H78,InterPro:IPR002052,InterPro:IPR002295,InterPro:IPR002941,InterPro:IPR029063,UniProtKB/TrEMBL:Q83H78,NCBI_GP:CAD67442.1;Name=CAD67442.1;Note=Similar to Rhodobacter sphaeroides modification methylase RsrI RsrIM SWALL:MTR1_RHOSH (SWALL:P14751) (319 aa) fasta scores: E(): 3.3e-14%2C 32.82%25 id in 262 aa;gbkey=CDS;product=putative DNA methylase;protein_id=CAD67442.1;transl_table=11
BX072543.1	EMBL	sequence_feature	887114	887134	.	+	.	ID=id1563;Note=PS00092 N-6 Adenine-specific DNA methylases signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	887303	887840	.	+	.	ID=id1564;Note=DNA methylase Score %3D 112.9 E-value %3D 4.3e-31;gbkey=misc_feature
BX072543.1	EMBL	tRNA	888014	888097	.	-	.	ID=rna52;Note=tRNA Leu anticodon CAG%2C Cove score 64.33;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	exon	888014	888097	.	-	.	ID=id1565;Parent=rna52;Note=tRNA Leu anticodon CAG%2C Cove score 64.33;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	gene	888171	888836	.	+	.	ID=gene754;Name=TW784;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW784
BX072543.1	EMBL	CDS	888171	888836	.	+	0	ID=cds750;Parent=gene754;Dbxref=InterPro:IPR000253,InterPro:IPR008984,InterPro:IPR022128,UniProtKB/TrEMBL:Q83H77,NCBI_GP:CAD67443.1;Name=CAD67443.1;Note=Similar to Bifidobacterium longum NCC2705 hypothetical protein with Fha domain bl0583 SWALL:AAN24407 (EMBL:AE014680) (233 aa) fasta scores: E(): 8.6e-05%2C 29.51%25 id in 227 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67443.1;transl_table=11
BX072543.1	EMBL	sequence_feature	888603	888792	.	+	.	ID=id1566;Note=FHA domain Score %3D 73.2 E-value %3D 3.8e-19;gbkey=misc_feature
BX072543.1	EMBL	gene	889052	889501	.	+	.	ID=gene755;Name=TW785;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW785
BX072543.1	EMBL	CDS	889052	889501	.	+	0	ID=cds751;Parent=gene755;Dbxref=InterPro:IPR000253,InterPro:IPR008984,UniProtKB/TrEMBL:Q83N62,NCBI_GP:CAD67444.1;Name=CAD67444.1;Note=Similar to Corynebacterium glutamicum FHA-domain-containing proteins cgl0046 SWALL:Q8NU93 (EMBL:AP005274) (154 aa) fasta scores: E(): 3.9e-10%2C 29.67%25 id in 155 aa;gbkey=CDS;product=putative secreted protein;protein_id=CAD67444.1;transl_table=11
BX072543.1	EMBL	sequence_feature	889277	889475	.	+	.	ID=id1567;Note=FHA domain Score %3D 82.2 E-value %3D 7.7e-22;gbkey=misc_feature
BX072543.1	EMBL	gene	889664	891010	.	+	.	ID=gene756;Name=TW786;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW786
BX072543.1	EMBL	CDS	889664	891010	.	+	0	ID=cds752;Parent=gene756;Dbxref=GOA:Q83MI3,InterPro:IPR001182,UniProtKB/TrEMBL:Q83MI3,NCBI_GP:CAD67445.1;Name=CAD67445.1;Note=Similar to Streptomyces coelicolor putative FtsW/RodA/SpoVE family cell cycle protein SCO3846 or SCH69.16 SWALL:Q9XA18 (EMBL:AL079308) (479 aa) fasta scores: E(): 6.7e-49%2C 38.46%25 id in 442 aa%2C and to Bacillus subtilis stage V sporulation protein E SpoVE SWALL:SP5E_BACSU (SWALL:P07373) (366 aa) fasta scores: E(): 6.2e-21%2C 30.13%25 id in 365 aa;gbkey=CDS;product=putative FtsW/RodA/SpoVE family cell cycle protein;protein_id=CAD67445.1;transl_table=11
BX072543.1	EMBL	sequence_feature	889664	889795	.	+	.	ID=id1568;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.753) with cleavage site probability 0.324 between residues 44 and 45;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	889721	889789	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	889802	889870	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	889889	889957	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	889985	890053	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	890072	890131	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	890174	890242	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	890300	890353	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	890363	890422	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	890435	890503	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	890705	890773	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	890792	890860	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	890888	890956	.	+	.	ID=id1569;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 20-42%2C 47-69%2C 76-98%2C 108-130%2C 137-156%2C 171-193%2C 213-230%2C 234-253%2C 258-280%2C 348-370%2C 377-399 and 409-431;gbkey=misc_feature;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	sequence_feature	889889	890978	.	+	.	ID=id1570;Note=Cell cycle protein Score %3D 186.8 E-value %3D 2.4e-53;gbkey=misc_feature
BX072543.1	EMBL	gene	891053	892510	.	+	.	ID=gene757;Name=TW787;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW787
BX072543.1	EMBL	CDS	891053	892510	.	+	0	ID=cds753;Parent=gene757;Dbxref=GOA:Q83N61,InterPro:IPR001460,InterPro:IPR005311,InterPro:IPR012338,UniProtKB/TrEMBL:Q83N61,NCBI_GP:CAD67446.1;Name=CAD67446.1;Note=Similar to Streptomyces griseus PbpA SWALL:Q9L656 (EMBL:AF241575) (485 aa) fasta scores: E(): 1.3e-40%2C 33.47%25 id in 487 aa;gbkey=CDS;product=putative penicillin-binding protein;protein_id=CAD67446.1;transl_table=11
BX072543.1	EMBL	sequence_feature	891119	891187	.	+	.	ID=id1571;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 23-45;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	891506	892478	.	+	.	ID=id1572;Note=Penicillin binding protein transpeptidase domain Score %3D 269.1 E-value %3D 4e-78;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	892313	892336	.	+	.	ID=id1573;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature
BX072543.1	EMBL	gene	892514	894271	.	+	.	ID=gene758;Name=TW788;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW788
BX072543.1	EMBL	CDS	892514	894271	.	+	0	ID=cds754;Parent=gene758;Dbxref=GOA:Q83H76,InterPro:IPR000719,InterPro:IPR008271,InterPro:IPR011009,UniProtKB/TrEMBL:Q83H76,NCBI_GP:CAD67447.1;Name=CAD67447.1;Note=Similar to many predicted serine/threonine-protein kinases eg. Mycobacterium tuberculosis probable serine/threonine-protein kinase PknA or Rv0015c or mt0018 or mtcy10h4.15C SWALL:PKNA_MYCTU (SWALL:P71585) (431 aa) fasta scores: E(): 1.1e-39%2C 44.9%25 id in 363 aa;gbkey=CDS;product=putative serine/threonine-protein kinase;protein_id=CAD67447.1;transl_table=11
BX072543.1	EMBL	sequence_feature	892550	893336	.	+	.	ID=id1574;Note=Protein kinase domain Score %3D 183.5 E-value %3D 2.4e-52;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	892760	892783	.	+	.	ID=id1575;Note=PS00030 Eukaryotic putative RNA-binding region RNP-1 signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	892907	892945	.	+	.	ID=id1576;Note=PS00108 Serine/Threonine protein kinases active-site signature.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	893546	893614	.	+	.	ID=id1577;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 345-367;gbkey=misc_feature
BX072543.1	EMBL	gene	894276	895928	.	+	.	ID=gene759;Name=TW789;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW789
BX072543.1	EMBL	CDS	894276	895928	.	+	0	ID=cds755;Parent=gene759;Dbxref=GOA:Q83H75,InterPro:IPR000719,InterPro:IPR005543,InterPro:IPR011009,UniProtKB/TrEMBL:Q83H75,NCBI_GP:CAD67448.1;Name=CAD67448.1;Note=Similar to many predicted serine/threonine-protein kinases eg. Mycobacterium leprae probable serine/threonine-protein kinase pknb pknb or ml0016 SWALL:PKNB_MYCLE (SWALL:P54744) (622 aa) fasta scores: E(): 7.7e-08%2C 25.27%25 id in 459 aa;gbkey=CDS;product=putative serine/threonine-protein kinase;protein_id=CAD67448.1;transl_table=11
BX072543.1	EMBL	sequence_feature	895191	895259	.	+	.	ID=id1578;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 306-328;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	895302	895500	.	+	.	ID=id1579;Note=PASTA domain Score %3D 45.4 E-value %3D 9.3e-11;gbkey=misc_feature
BX072543.1	EMBL	sequence_uncertainty	896107	896148	.	+	.	ID=id1580;Note=single read region;gbkey=unsure
BX072543.1	EMBL	tRNA	896275	896348	.	-	.	ID=rna53;Note=tRNA Leu anticodon TAA%2C Cove score 55.22;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	exon	896275	896348	.	-	.	ID=id1581;Parent=rna53;Note=tRNA Leu anticodon TAA%2C Cove score 55.22;gbkey=tRNA;product=tRNA-Leu
BX072543.1	EMBL	gene	896339	897667	.	-	.	ID=gene760;Name=TW790;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW790
BX072543.1	EMBL	CDS	896339	897667	.	-	0	ID=cds756;Parent=gene760;Dbxref=GOA:Q83N60,InterPro:IPR001327,InterPro:IPR013027,InterPro:IPR023753,UniProtKB/TrEMBL:Q83N60,NCBI_GP:CAD67449.1;Name=CAD67449.1;Note=Similar to Streptomyces coelicolor putative dehydrogenase SCO7101 or SC4B10.02 SWALL:Q9FC85 (EMBL:AL391515) (451 aa) fasta scores: E(): 2.8e-78%2C 48.95%25 id in 429 aa%2C and to Escherichia coli NADH dehydrogenase Ndh or b1109 SWALL:DHNA_ECOLI (SWALL:P00393) (433 aa) fasta scores: E(): 5.9e-20%2C 31.05%25 id in 409 aa;gbkey=CDS;product=putative NADH dehydrogenase;protein_id=CAD67449.1;transl_table=11
BX072543.1	EMBL	sequence_feature	896719	897658	.	-	.	ID=id1582;Note=Pyridine nucleotide-disulphide oxidoreductase Score %3D 104.5 E-value %3D 1.5e-28;gbkey=misc_feature
BX072543.1	EMBL	gene	897747	898235	.	-	.	ID=gene761;Name=TW791;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW791
BX072543.1	EMBL	CDS	897747	898235	.	-	0	ID=cds757;Parent=gene761;Dbxref=InterPro:IPR007511,UniProtKB/TrEMBL:Q83H74,NCBI_GP:CAD67450.1;Name=CAD67450.1;Note=Similar to Mycobacterium tuberculosis hypothetical protein Rv1025 or mt1053 or mtcy10g2.24C SWALL:P96375 (EMBL:Z92539) (163 aa) fasta scores: E(): 1.3e-26%2C 54.11%25 id in 146 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67450.1;transl_table=11
BX072543.1	EMBL	sequence_feature	897779	898154	.	-	.	ID=id1583;Note=Protein of unknown function (DUF501) Score %3D 152.0 E-value %3D 7.5e-43;gbkey=misc_feature
BX072543.1	EMBL	gene	898237	898647	.	-	.	ID=gene762;Name=TW792;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW792
BX072543.1	EMBL	CDS	898237	898647	.	-	0	ID=cds758;Parent=gene762;Dbxref=GOA:Q83N59,InterPro:IPR007060,UniProtKB/TrEMBL:Q83N59,NCBI_GP:CAD67451.1;Name=CAD67451.1;Note=No significant database matches;gbkey=CDS;product=putative secreted protein;protein_id=CAD67451.1;transl_table=11
BX072543.1	EMBL	sequence_feature	898543	898647	.	-	.	ID=id1584;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.990) with cleavage site probability 0.650 between residues 35 and 36;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	898546	898614	.	-	.	ID=id1585;Note=1 probable transmembrane helix predicted for Unknown_CDS by TMHMM2.0 at aa 12-34;gbkey=misc_feature
BX072543.1	EMBL	gene	898644	899930	.	-	.	ID=gene763;Name=eno;gbkey=Gene;gene=eno;gene_biotype=protein_coding;locus_tag=TW793
BX072543.1	EMBL	CDS	898644	899930	.	-	0	ID=cds759;Parent=gene763;Dbxref=GOA:Q83H73,InterPro:IPR000941,InterPro:IPR020809,InterPro:IPR020810,InterPro:IPR020811,InterPro:IPR029017,InterPro:IPR029065,NCBI_GP:CAD67452.1;Name=CAD67452.1;Note=Similar to Bacillus subtilis Enolase Eno SWALL:ENO_BACSU (SWALL:P37869) (430 aa) fasta scores: E(): 2e-101%2C 62.11%25 id in 425 aa;gbkey=CDS;gene=eno;product=enolase;protein_id=CAD67452.1;transl_table=11
BX072543.1	EMBL	sequence_feature	898658	899516	.	-	.	ID=id1586;Note=Enolase%2C C-terminal TIM barrel domain Score %3D 542.5 E-value %3D 2e-160;gbkey=misc_feature;gene=eno
BX072543.1	EMBL	sequence_feature	898893	898934	.	-	.	ID=id1587;Note=PS00164 Enolase signature.;gbkey=misc_feature;gene=eno
BX072543.1	EMBL	sequence_feature	899531	899924	.	-	.	ID=id1588;Note=Enolase%2C N-terminal domain Score %3D 215.3 E-value %3D 6.4e-62;gbkey=misc_feature;gene=eno
BX072543.1	EMBL	gene	900245	901525	.	-	.	ID=gene764;Name=hisS;gbkey=Gene;gene=hisS;gene_biotype=protein_coding;locus_tag=TW794
BX072543.1	EMBL	CDS	900245	901525	.	-	0	ID=cds760;Parent=gene764;Dbxref=GOA:Q83H72,InterPro:IPR004516,InterPro:IPR006195,InterPro:IPR015807,NCBI_GP:CAD67453.1;Name=CAD67453.1;Note=Similar to Xanthomonas axonopodis histidyl-tRNA synthetase HisS or xac1826 SWALL:Q8PLH2 (EMBL:AE011816) (478 aa) fasta scores: E(): 6e-24%2C 28.8%25 id in 427 aa%2C and to Oryza sativa histidyl-trna synthetase SWALL:SYH_ORYSA (SWALL:P93422) (494 aa) fasta scores: E(): 4.9e-19%2C 28.29%25 id in 410 aa;gbkey=CDS;gene=hisS;product=histidyl-tRNA synthetase;protein_id=CAD67453.1;transl_table=11
BX072543.1	EMBL	sequence_feature	900497	900526	.	-	.	ID=id1589;Note=PS00339 Aminoacyl-transfer RNA synthetases class-II signature 2.;gbkey=misc_feature;gene=hisS
BX072543.1	EMBL	sequence_feature	901039	901504	.	-	.	ID=id1590;Note=tRNA synthetase class II core domain (G%2C H%2C P%2C S and T) Score %3D 71.4 E-value %3D 1.4e-18;gbkey=misc_feature;gene=hisS
BX072543.1	EMBL	gene	901522	902679	.	-	.	ID=gene765;Name=TW795;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW795
BX072543.1	EMBL	CDS	901522	902679	.	-	0	ID=cds761;Parent=gene765;Dbxref=GOA:Q83N58,InterPro:IPR004670,InterPro:IPR023171,NCBI_GP:CAD67454.1;Name=CAD67454.1;Note=Similar to Escherichia coli sodium/proton antiporter 1 NhaA or Ant or b0019 SWALL:NHAA_ECOLI (SWALL:P13738) (388 aa) fasta scores: E(): 7.6e-35%2C 35.26%25 id in 380 aa%2C and to Streptomyces coelicolor putative sodium/proton antiporter SCO3564 or SCH5.27 SWALL:Q9X929 (EMBL:AL035636) (474 aa) fasta scores: E(): 3.7e-36%2C 38.24%25 id in 387 aa;gbkey=CDS;product=putative sodium/proton antiporter;protein_id=CAD67454.1;transl_table=11
BX072543.1	EMBL	sequence_feature	901566	902646	.	-	.	ID=id1591;Note=Sodium/hydrogen exchanger family Score %3D -105.4 E-value %3D 0.0041;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	902596	902655	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=1/12;partial=true
BX072543.1	EMBL	sequence_feature	902485	902553	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=2/12;partial=true
BX072543.1	EMBL	sequence_feature	902356	902424	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=3/12;partial=true
BX072543.1	EMBL	sequence_feature	902269	902328	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=4/12;partial=true
BX072543.1	EMBL	sequence_feature	902182	902250	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=5/12;partial=true
BX072543.1	EMBL	sequence_feature	902104	902172	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=6/12;partial=true
BX072543.1	EMBL	sequence_feature	902032	902085	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=7/12;partial=true
BX072543.1	EMBL	sequence_feature	901975	902022	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=8/12;partial=true
BX072543.1	EMBL	sequence_feature	901870	901938	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=9/12;partial=true
BX072543.1	EMBL	sequence_feature	901774	901842	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=10/12;partial=true
BX072543.1	EMBL	sequence_feature	901687	901755	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=11/12;partial=true
BX072543.1	EMBL	sequence_feature	901576	901644	.	-	.	ID=id1592;Note=12 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 9-28%2C 43-65%2C 86-108%2C 118-137%2C 144-166%2C 170-192%2C 199-216%2C 220-235%2C 248-270%2C 280-302%2C 309-331 and 346-368;gbkey=misc_feature;is_ordered=true;part=12/12;partial=true
BX072543.1	EMBL	sequence_feature	902605	902679	.	-	.	ID=id1593;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.986) with cleavage site probability 0.618 between residues 25 and 26;gbkey=misc_feature
BX072543.1	EMBL	gene	902676	903266	.	-	.	ID=gene766;Name=dcd;gbkey=Gene;gene=dcd;gene_biotype=protein_coding;locus_tag=TW796
BX072543.1	EMBL	CDS	902676	903266	.	-	0	ID=cds762;Parent=gene766;Dbxref=GOA:Q83H71,InterPro:IPR008180,InterPro:IPR011962,InterPro:IPR029054,NCBI_GP:CAD67455.1;Name=CAD67455.1;Note=Similar to Escherichia coli deoxycytidine triphosphate deaminase Dcd or Dus or PaxA or b2065 SWALL:DCD_ECOLI (SWALL:P28248) (193 aa) fasta scores: E(): 1.2e-19%2C 44.97%25 id in 189 aa;gbkey=CDS;gene=dcd;product=deoxycytidine triphosphate deaminase;protein_id=CAD67455.1;transl_table=11
BX072543.1	EMBL	sequence_feature	902726	903122	.	-	.	ID=id1594;Note=dUTPase Score %3D 40.9 E-value %3D 2.1e-09;gbkey=misc_feature;gene=dcd
BX072543.1	EMBL	sequence_feature	902961	902984	.	-	.	ID=id1595;Note=PS00017 ATP/GTP-binding site motif A (P-loop).;gbkey=misc_feature;gene=dcd
BX072543.1	EMBL	tRNA	903296	903369	.	+	.	ID=rna54;Note=tRNA Gly anticodon CCC%2C Cove score 72.23;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	exon	903296	903369	.	+	.	ID=id1596;Parent=rna54;Note=tRNA Gly anticodon CCC%2C Cove score 72.23;gbkey=tRNA;product=tRNA-Gly
BX072543.1	EMBL	gene	903614	904936	.	-	.	ID=gene767;Name=pdhC;gbkey=Gene;gene=pdhC;gene_biotype=protein_coding;locus_tag=TW797
BX072543.1	EMBL	CDS	903614	904936	.	-	0	ID=cds763;Parent=gene767;Dbxref=GOA:Q820B9,InterPro:IPR000089,InterPro:IPR001078,InterPro:IPR004167,InterPro:IPR011053,InterPro:IPR023213,UniProtKB/TrEMBL:Q820B9,NCBI_GP:CAD67456.1;Name=CAD67456.1;Note=Similar to Bacillus subtilis dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex PdhC or AceC SWALL:ODP2_BACSU (SWALL:P21883) (441 aa) fasta scores: E(): 1.5e-29%2C 29.53%25 id in 447 aa%2C and to Streptomyces coelicolor putative dihydrolipoamide acyltransferase component bkdc1 or sco3815 or scgd3.16C SWALL:Q9XA62 (EMBL:AL096822) (469 aa) fasta scores: E(): 1e-39%2C 42.07%25 id in 473 aa;gbkey=CDS;gene=pdhC;product=dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex;protein_id=CAD67456.1;transl_table=11
BX072543.1	EMBL	sequence_feature	903619	904306	.	-	.	ID=id1597;Note=2-oxo acid dehydrogenases acyltransferase (catalytic domain) Score %3D 295.9 E-value %3D 3.4e-86;gbkey=misc_feature;gene=pdhC
BX072543.1	EMBL	sequence_feature	904318	904432	.	-	.	ID=id1598;Note=e3 binding domain Score %3D 53.9 E-value %3D 2.5e-13;gbkey=misc_feature;gene=pdhC
BX072543.1	EMBL	sequence_feature	904708	904927	.	-	.	ID=id1599;Note=Biotin-requiring enzyme Score %3D 69.7 E-value %3D 4.3e-18;gbkey=misc_feature;gene=pdhC
BX072543.1	EMBL	gene	904954	905958	.	-	.	ID=gene768;Name=pdhB;gbkey=Gene;gene=pdhB;gene_biotype=protein_coding;locus_tag=TW798
BX072543.1	EMBL	CDS	904954	905958	.	-	0	ID=cds764;Parent=gene768;Dbxref=GOA:Q83H70,InterPro:IPR005475,InterPro:IPR005476,InterPro:IPR009014,InterPro:IPR029061,UniProtKB/TrEMBL:Q83H70,NCBI_GP:CAD67457.1;Name=CAD67457.1;Note=Similar to Bacillus subtilis pyruvate dehydrogenase E1 component%2C beta subunit PdhB or AceB SWALL:ODPB_BACSU (SWALL:P21882) (324 aa) fasta scores: E(): 1.1e-43%2C 41.3%25 id in 322 aa%2C and to Streptomyces coelicolor putative branched-chain alpha keto acid dehydrogenase E1 beta subunit BkdB1 or SCO3816 or SCGD3.17C SWALL:Q9XA61 (EMBL:AL096822) (326 aa) fasta scores: E(): 3.1e-68%2C 57.72%25 id in 317 aa;gbkey=CDS;gene=pdhB;product=pyruvate dehydrogenase E1 component%2C beta subunit;protein_id=CAD67457.1;transl_table=11
BX072543.1	EMBL	sequence_feature	904989	905346	.	-	.	ID=id1600;Note=Transketolase%2C C-terminal domain Score %3D 148.4 E-value %3D 9.2e-42;gbkey=misc_feature;gene=pdhB
BX072543.1	EMBL	sequence_feature	905385	905910	.	-	.	ID=id1601;Note=Transketolase%2C pyridine binding domain Score %3D 217.9 E-value %3D 1.1e-62;gbkey=misc_feature;gene=pdhB
BX072543.1	EMBL	gene	905955	907067	.	-	.	ID=gene769;Name=pdhA;gbkey=Gene;gene=pdhA;gene_biotype=protein_coding;locus_tag=TW799
BX072543.1	EMBL	CDS	905955	907067	.	-	0	ID=cds765;Parent=gene769;Dbxref=GOA:Q83H69,InterPro:IPR001017,InterPro:IPR017596,InterPro:IPR029061,UniProtKB/TrEMBL:Q83H69,NCBI_GP:CAD67458.1;Name=CAD67458.1;Note=Similar to Bacillus subtilis 2-oxoisovalerate dehydrogenase alpha subunit BfmBaa or BfmB1A SWALL:ODBA_BACSU (SWALL:P37940) (330 aa) fasta scores: E(): 4e-30%2C 34.13%25 id in 334 aa%2C and to Streptomyces coelicolor putative branched-chain alpha keto acid dehydrogenase E1 alpha subunit BkdA1 or SCO3817 or SCGD3.18C SWALL:Q9XA60 (EMBL:AL096822) (417 aa) fasta scores: E(): 4.3e-35%2C 44.62%25 id in 363 aa;gbkey=CDS;gene=pdhA;product=pyruvate dehydrogenase E1 component%2C alpha subunit;protein_id=CAD67458.1;transl_table=11
BX072543.1	EMBL	sequence_feature	906047	906941	.	-	.	ID=id1602;Note=Dehydrogenase E1 component Score %3D 234.4 E-value %3D 1.2e-67;gbkey=misc_feature;gene=pdhA
BX072543.1	EMBL	gene	907280	908725	.	+	.	ID=gene770;Name=purB;gbkey=Gene;gene=purB;gene_biotype=protein_coding;locus_tag=TW800
BX072543.1	EMBL	CDS	907280	908725	.	+	0	ID=cds766;Parent=gene770;Dbxref=GOA:Q83H68,InterPro:IPR000362,InterPro:IPR008948,InterPro:IPR013539,InterPro:IPR020557,InterPro:IPR022761,InterPro:IPR024083,UniProtKB/TrEMBL:Q83H68,NCBI_GP:CAD67459.1;Name=CAD67459.1;Note=Similar to Escherichia coli adenylosuccinate lyase PurB or b1131 SWALL:PUR8_ECOLI (SWALL:P25739) (456 aa) fasta scores: E(): 8.2e-73%2C 43.01%25 id in 451 aa;gbkey=CDS;gene=purB;product=adenylosuccinate lyase;protein_id=CAD67459.1;transl_table=11
BX072543.1	EMBL	sequence_feature	907319	908576	.	+	.	ID=id1603;Note=Lyase Score %3D 110.3 E-value %3D 2.7e-30;gbkey=misc_feature;gene=purB
BX072543.1	EMBL	sequence_feature	908150	908179	.	+	.	ID=id1604;Note=PS00163 Fumarate lyases signature.;gbkey=misc_feature;gene=purB
BX072543.1	EMBL	gene	908787	910076	.	+	.	ID=gene771;Name=purA;gbkey=Gene;gene=purA;gene_biotype=protein_coding;locus_tag=TW801
BX072543.1	EMBL	CDS	908787	910076	.	+	0	ID=cds767;Parent=gene771;Dbxref=GOA:Q83H67,InterPro:IPR001114,InterPro:IPR018220,InterPro:IPR027417,NCBI_GP:CAD67460.1;Name=CAD67460.1;Note=Similar to Escherichia coli adenylosuccinate synthetase PurA or AdeK or b4177 or z5784 or ecs5153 SWALL:PURA_ECOLI (SWALL:P12283) (431 aa) fasta scores: E(): 1.3e-76%2C 46.6%25 id in 427 aa;gbkey=CDS;gene=purA;product=adenylosuccinate synthetase;protein_id=CAD67460.1;transl_table=11
BX072543.1	EMBL	sequence_feature	908790	910050	.	+	.	ID=id1605;Note=Adenylosuccinate synthetase Score %3D 715.7 E-value %3D 1.5e-212;gbkey=misc_feature;gene=purA
BX072543.1	EMBL	sequence_feature	908814	908837	.	+	.	ID=id1606;Note=PS01266 Adenylosuccinate synthetase GTP-binding site.;gbkey=misc_feature;gene=purA
BX072543.1	EMBL	sequence_feature	909177	909212	.	+	.	ID=id1607;Note=PS00513 Adenylosuccinate synthetase active site.;gbkey=misc_feature;gene=purA
BX072543.1	EMBL	gene	910180	910497	.	+	.	ID=gene772;Name=TW802;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW802
BX072543.1	EMBL	CDS	910180	910497	.	+	0	ID=cds768;Parent=gene772;Dbxref=GOA:Q83N57,InterPro:IPR002701,InterPro:IPR020822,UniProtKB/TrEMBL:Q83N57,NCBI_GP:CAD67461.1;Name=CAD67461.1;Note=Similar to Rhizobium meliloti putative chorismate mutase protein PheAa or r03241 or smc03858 SWALL:Q92L44 (EMBL:AL591793) (111 aa) fasta scores: E(): 3.2e-05%2C 33.7%25 id in 89 aa%2C and to N-terminal portion of Escherichia coli P-protein [includes: chorismate mutase (EC 5.4.99.5) (cm)%3B prephenate dehydratase (EC 4.2.1.51) (pdt)] PheA or b2599 or z3891 or ecs3462 SWALL:PHEA_ECOLI (SWALL:P07022) (386 aa) fasta scores: E(): 0.18%2C 31.76%25 id in 85 aa;gbkey=CDS;product=putative chorismate mutase;protein_id=CAD67461.1;transl_table=11
BX072543.1	EMBL	sequence_feature	910228	910486	.	+	.	ID=id1608;Note=Chorismate mutase Score %3D 33.5 E-value %3D 3.3e-07;gbkey=misc_feature
BX072543.1	EMBL	gene	910537	912819	.	-	.	ID=gene773;Name=purL;gbkey=Gene;gene=purL;gene_biotype=protein_coding;locus_tag=TW803
BX072543.1	EMBL	CDS	910537	912819	.	-	0	ID=cds769;Parent=gene773;Dbxref=GOA:Q83H66,InterPro:IPR000728,InterPro:IPR010074,InterPro:IPR010918,InterPro:IPR016188,NCBI_GP:CAD67462.1;Name=CAD67462.1;Note=Similar to Mycobacterium tuberculosis phosphoribosylformylglycinamidine synthase II PurL or Rv0803 or mt0823 or mtcy07h7a.06C SWALL:PURL_MYCTU (SWALL:P54876) (754 aa) fasta scores: E(): 2.8e-149%2C 54.12%25 id in 739 aa;gbkey=CDS;gene=purL;product=phosphoribosylformylglycinamidine synthase II;protein_id=CAD67462.1;transl_table=11
BX072543.1	EMBL	sequence_feature	910608	911040	.	-	.	ID=id1609;Note=AIR synthase related protein%2C C-terminal domain Score %3D 53.4 E-value %3D 3.5e-13;gbkey=misc_feature;gene=purL
BX072543.1	EMBL	sequence_feature	911076	911544	.	-	.	ID=id1610;Note=AIR synthase related protein%2C N-terminal domain Score %3D 134.3 E-value %3D 1.6e-37;gbkey=misc_feature;gene=purL
BX072543.1	EMBL	sequence_feature	911676	912147	.	-	.	ID=id1611;Note=AIR synthase related protein%2C C-terminal domain Score %3D 147.5 E-value %3D 1.7e-41;gbkey=misc_feature;gene=purL
BX072543.1	EMBL	sequence_feature	912180	912639	.	-	.	ID=id1612;Note=AIR synthase related protein%2C N-terminal domain Score %3D 177.1 E-value %3D 2.1e-50;gbkey=misc_feature;gene=purL
BX072543.1	EMBL	sequence_feature	912475	912537	.	-	.	ID=id1613;Note=PS00107 Protein kinases ATP-binding region signature.;gbkey=misc_feature;gene=purL
BX072543.1	EMBL	gene	912816	913088	.	-	.	ID=gene774;Name=TW804;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW804
BX072543.1	EMBL	CDS	912816	913088	.	-	0	ID=cds770;Parent=gene774;Dbxref=UniProtKB/TrEMBL:Q83H65,NCBI_GP:CAD67463.1;Name=CAD67463.1;Note=Doubtful CDS. No significant database matches;gbkey=CDS;product=hypothetical protein;protein_id=CAD67463.1;transl_table=11
BX072543.1	EMBL	gene	913300	913980	.	-	.	ID=gene775;Name=purQ;gbkey=Gene;gene=purQ;gene_biotype=protein_coding;locus_tag=TW805
BX072543.1	EMBL	CDS	913300	913980	.	-	0	ID=cds771;Parent=gene775;Dbxref=GOA:Q83H64,InterPro:IPR010075,InterPro:IPR017926,InterPro:IPR029062,UniProtKB/TrEMBL:Q83H64,NCBI_GP:CAD67464.1;Name=CAD67464.1;Note=Similar to Lactococcus lactis phosphoribosylformylglycinamidine synthase I PurQ SWALL:PURQ_LACLC (SWALL:Q9ZB07) (226 aa) fasta scores: E(): 3.5e-32%2C 44.49%25 id in 218 aa;gbkey=CDS;gene=purQ;product=phosphoribosylformylglycinamidine synthase I;protein_id=CAD67464.1;transl_table=11
BX072543.1	EMBL	sequence_feature	913705	913740	.	-	.	ID=id1614;Note=PS00442 Glutamine amidotransferases class-I active site.;gbkey=misc_feature;gene=purQ
BX072543.1	EMBL	gene	913984	914232	.	-	.	ID=gene776;Name=TW806;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW806
BX072543.1	EMBL	CDS	913984	914232	.	-	0	ID=cds772;Parent=gene776;Dbxref=InterPro:IPR003850,UniProtKB/TrEMBL:Q83H63,NCBI_GP:CAD67465.1;Name=CAD67465.1;Note=Similar to many CDSs found directly upstream of purQ eg. Streptomyces coelicolor hypothetical protein SCO4077 or SCD25.13 SWALL:Q9RKK7 (EMBL:AL118514) (90 aa) fasta scores: E(): 1.5e-08%2C 46.34%25 id in 82 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67465.1;transl_table=11
BX072543.1	EMBL	gene	914410	915627	.	+	.	ID=gene777;Name=TW807;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW807
BX072543.1	EMBL	CDS	914410	915627	.	+	0	ID=cds773;Parent=gene777;Dbxref=GOA:Q83H62,InterPro:IPR001296,InterPro:IPR028098,UniProtKB/TrEMBL:Q83H62,NCBI_GP:CAD67466.1;Name=CAD67466.1;Note=Similar to many predicted glycosyltransferases eg. Corynebacterium glutamicum predicted glycosyltransferases cgl0401 SWALL:Q8NTA6 (EMBL:AP005275) (418 aa) fasta scores: E(): 2.3e-39%2C 33.97%25 id in 415 aa;gbkey=CDS;product=putative glycosyltransferase;protein_id=CAD67466.1;transl_table=11
BX072543.1	EMBL	sequence_feature	915028	915559	.	+	.	ID=id1615;Note=Glycosyl transferases group 1 Score %3D 93.9 E-value %3D 2.3e-25;gbkey=misc_feature
BX072543.1	EMBL	gene	915642	916367	.	-	.	ID=gene778;Name=TW808;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW808
BX072543.1	EMBL	CDS	915642	916367	.	-	0	ID=cds774;Parent=gene778;Dbxref=InterPro:IPR003737,InterPro:IPR024078,UniProtKB/TrEMBL:Q83H61,NCBI_GP:CAD67467.1;Name=CAD67467.1;Note=N-terminal region similar to many eg. Mycobacterium leprae hypothetical protein Ml1495 SWALL:Q9CBX4 (EMBL:AL583922) (308 aa) fasta scores: E(): 1.9e-13%2C 33.19%25 id in 241 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67467.1;transl_table=11
BX072543.1	EMBL	sequence_feature	915659	916352	.	-	.	ID=id1616;Note=Uncharacterized LmbE-like protein%2C COG2120 Score %3D 27.9 E-value %3D 3.2e-09;gbkey=misc_feature
BX072543.1	EMBL	gene	916433	917989	.	+	.	ID=gene779;Name=TW809;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW809
BX072543.1	EMBL	CDS	916433	917989	.	+	0	ID=cds775;Parent=gene779;Dbxref=InterPro:IPR004268,UniProtKB/TrEMBL:Q83MI2,NCBI_GP:CAD67468.1;Name=CAD67468.1;Note=Similar to Bifidobacterium longum NCC2705 conserved hypothetical membrane protein MviN family bl0651 SWALL:AAN24473 (EMBL:AE014686) (575 aa) fasta scores: E(): 5.4e-29%2C 32.78%25 id in 482 aa%2C and to Vibrio cholerae virulence factor MviN homolog or vc0680 SWALL:MVIN_VIBCH (SWALL:O34238) (525 aa) fasta scores: E(): 7.9e-16%2C 22.96%25 id in 527 aa;gbkey=CDS;product=conserved integral membrane protein (possible virulence factor);protein_id=CAD67468.1;transl_table=11
BX072543.1	EMBL	sequence_feature	916433	916561	.	+	.	ID=id1617;Note=Signal peptide predicted for Unknown_CDS by SignalP 2.0 HMM (Signal peptide probabilty 0.978) with cleavage site probability 0.446 between residues 43 and 44;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	916451	916519	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=1/14;partial=true
BX072543.1	EMBL	sequence_feature	916562	916630	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=2/14;partial=true
BX072543.1	EMBL	sequence_feature	916691	916750	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=3/14;partial=true
BX072543.1	EMBL	sequence_feature	916793	916861	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=4/14;partial=true
BX072543.1	EMBL	sequence_feature	916898	916966	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=5/14;partial=true
BX072543.1	EMBL	sequence_feature	917009	917077	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=6/14;partial=true
BX072543.1	EMBL	sequence_feature	917135	917203	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=7/14;partial=true
BX072543.1	EMBL	sequence_feature	917261	917329	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=8/14;partial=true
BX072543.1	EMBL	sequence_feature	917390	917458	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=9/14;partial=true
BX072543.1	EMBL	sequence_feature	917495	917563	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=10/14;partial=true
BX072543.1	EMBL	sequence_feature	917600	917668	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=11/14;partial=true
BX072543.1	EMBL	sequence_feature	917678	917746	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=12/14;partial=true
BX072543.1	EMBL	sequence_feature	917807	917875	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=13/14;partial=true
BX072543.1	EMBL	sequence_feature	917888	917956	.	+	.	ID=id1618;Note=14 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 7-29%2C 44-66%2C 87-106%2C 121-143%2C 156-178%2C 193-215%2C 235-257%2C 277-299%2C 320-342%2C 355-377%2C 390-412%2C 416-438%2C 459-481 and 486-508;gbkey=misc_feature;is_ordered=true;part=14/14;partial=true
BX072543.1	EMBL	sequence_feature	916514	917900	.	+	.	ID=id1619;Note=Virulence factor MVIN Score %3D 167.8 E-value %3D 1.3e-47;gbkey=misc_feature
BX072543.1	EMBL	gene	918020	919456	.	+	.	ID=gene780;Name=TW810;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW810
BX072543.1	EMBL	CDS	918020	919456	.	+	0	ID=cds776;Parent=gene780;Dbxref=GOA:Q83H60,InterPro:IPR002646,InterPro:IPR003607,InterPro:IPR006674,InterPro:IPR006675,InterPro:IPR014065,UniProtKB/TrEMBL:Q83H60,NCBI_GP:CAD67469.1;Name=CAD67469.1;Note=Similar to Streptomyces coelicolor putative RNA nucleotidyltransferase SCO3896 or SCH24.18 SWALL:Q9X8T2 (EMBL:AL049826) (483 aa) fasta scores: E(): 2.3e-97%2C 55.35%25 id in 448 aa%2C and to Bacillus subtilis poly(a) polymerase PapS SWALL:PAPS_BACSU (SWALL:P42977) (397 aa) fasta scores: E(): 5.5e-20%2C 39.9%25 id in 208 aa;gbkey=CDS;product=putative RNA nucleotidyltransferase;protein_id=CAD67469.1;transl_table=11
BX072543.1	EMBL	sequence_feature	918314	918776	.	+	.	ID=id1620;Note=Poly A polymerase family Score %3D 186.8 E-value %3D 2.5e-53;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	918806	919193	.	+	.	ID=id1621;Note=HD domain Score %3D 60.2 E-value %3D 3.1e-15;gbkey=misc_feature
BX072543.1	EMBL	gene	919509	920384	.	-	.	ID=gene781;Name=parB;gbkey=Gene;gene=parB;gene_biotype=protein_coding;locus_tag=TW811
BX072543.1	EMBL	CDS	919509	920384	.	-	0	ID=cds777;Parent=gene781;Dbxref=GOA:Q83N56,InterPro:IPR003115,InterPro:IPR004437,UniProtKB/TrEMBL:Q83N56,NCBI_GP:CAD67470.1;Name=CAD67470.1;Note=Similar to Streptomyces coelicolor ParB SWALL:Q9RFM2 (EMBL:AF187159) (368 aa) fasta scores: E(): 9.2e-40%2C 46.38%25 id in 263 aa;gbkey=CDS;gene=parB;product=putative chromosome partitioning protein ParB;protein_id=CAD67470.1;transl_table=11
BX072543.1	EMBL	sequence_feature	919881	919946	.	-	.	ID=id1622;Note=Predicted helix-turn-helix motif with score 1320.000%2C SD 3.68 at aa 147-168%2C sequence VSQDELGQTLGKSRPYVTNTIR;gbkey=misc_feature;gene=parB
BX072543.1	EMBL	sequence_feature	920015	920282	.	-	.	ID=id1623;Note=ParB-like nuclease domain Score %3D 124.4 E-value %3D 1.5e-34;gbkey=misc_feature;gene=parB
BX072543.1	EMBL	gene	920395	921297	.	-	.	ID=gene782;Name=parA1;gbkey=Gene;gene=parA1;gene_biotype=protein_coding;locus_tag=TW812
BX072543.1	EMBL	CDS	920395	921297	.	-	0	ID=cds778;Parent=gene782;Dbxref=InterPro:IPR002586,InterPro:IPR027417,UniProtKB/TrEMBL:Q83N55,NCBI_GP:CAD67471.1;Name=CAD67471.1;Note=Similar to Streptomyces coelicolor ParA SWALL:Q9RFM1 (EMBL:AF187159) (357 aa) fasta scores: E(): 2.1e-44%2C 49.49%25 id in 295 aa;gbkey=CDS;gene=parA1;product=putative chromosome partitioning protein ParA;protein_id=CAD67471.1;transl_table=11
BX072543.1	EMBL	sequence_feature	920592	920937	.	-	.	ID=id1624;Note=ParA family ATPase Score %3D 96.3 E-value %3D 4.3e-26;gbkey=misc_feature;gene=parA1
BX072543.1	EMBL	gene	921486	923636	.	-	.	ID=gene783;Name=TW813;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW813
BX072543.1	EMBL	CDS	921486	923636	.	-	0	ID=cds779;Parent=gene783;Dbxref=GOA:Q83N54,InterPro:IPR001757,InterPro:IPR006121,InterPro:IPR008250,InterPro:IPR018303,InterPro:IPR023214,InterPro:IPR023299,InterPro:IPR027256,UniProtKB/TrEMBL:Q83N54,NCBI_GP:CAD67472.1;Name=CAD67472.1;Note=Similar to Streptomyces coelicolor probable cation-transporting P-type ATPase SCO2731 or SCC57A.02 SWALL:Q9RDJ4 (EMBL:AL136519) (760 aa) fasta scores: E(): 2.1e-76%2C 42.31%25 id in 761 aa%2C and to Enterococcus hirae probable copper importing ATPase A CopA SWALL:COPA_ENTHR (SWALL:P32113) (727 aa) fasta scores: E(): 1e-65%2C 36.03%25 id in 741 aa;gbkey=CDS;product=putative metal cation-transporting ATPase;protein_id=CAD67472.1;transl_table=11
BX072543.1	EMBL	sequence_feature	923334	923402	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=1/8;partial=true
BX072543.1	EMBL	sequence_feature	923238	923306	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=2/8;partial=true
BX072543.1	EMBL	sequence_feature	923121	923189	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=3/8;partial=true
BX072543.1	EMBL	sequence_feature	923037	923093	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=4/8;partial=true
BX072543.1	EMBL	sequence_feature	922581	922649	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=5/8;partial=true
BX072543.1	EMBL	sequence_feature	922485	922553	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=6/8;partial=true
BX072543.1	EMBL	sequence_feature	921585	921644	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=7/8;partial=true
BX072543.1	EMBL	sequence_feature	921522	921575	.	-	.	ID=id1625;Note=8 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 79-101%2C 111-133%2C 150-172%2C 182-200%2C 330-352%2C 362-384%2C 665-684 and 688-705;gbkey=misc_feature;is_ordered=true;part=8/8;partial=true
BX072543.1	EMBL	sequence_feature	921755	922418	.	-	.	ID=id1626;Note=haloacid dehalogenase-like hydrolase Score %3D 110.6 E-value %3D 2.1e-30;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	921756	921824	.	-	.	ID=id1627;Note=PS01229 Hypothetical cof family signature 2.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	922380	922400	.	-	.	ID=id1628;Note=PS00154 E1-E2 ATPases phosphorylation site.;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	922424	923072	.	-	.	ID=id1629;Note=E1-E2 ATPase Score %3D 230.9 E-value %3D 1.3e-66;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	923432	923615	.	-	.	ID=id1630;Note=Heavy-metal-associated domain Score %3D 53.0 E-value %3D 4.7e-13;gbkey=misc_feature
BX072543.1	EMBL	gene	923696	924196	.	-	.	ID=gene784;Name=TW814;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW814
BX072543.1	EMBL	CDS	923696	924196	.	-	0	ID=cds780;Parent=gene784;Dbxref=GOA:Q83H59,InterPro:IPR001374,UniProtKB/TrEMBL:Q83H59,NCBI_GP:CAD67473.1;Name=CAD67473.1;Note=Similar to Streptomyces coelicolor JAG-like protein Jag or SCO3884 or SCH24.06 SWALL:O54595 (EMBL:Y16311) (170 aa) fasta scores: E(): 6.7e-10%2C 31.13%25 id in 167 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67473.1;transl_table=11
BX072543.1	EMBL	sequence_feature	923713	923881	.	-	.	ID=id1631;Note=R3H domain Score %3D 32.1 E-value %3D 9.1e-07;gbkey=misc_feature
BX072543.1	EMBL	gene	924201	925133	.	-	.	ID=gene785;Name=TW815;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW815
BX072543.1	EMBL	CDS	924201	925133	.	-	0	ID=cds781;Parent=gene785;Dbxref=GOA:Q83N53,InterPro:IPR001708,InterPro:IPR028055,NCBI_GP:CAD67474.1;Name=CAD67474.1;Note=Similar to Streptomyces coelicolor inner membrane protein SCO3883 or SCH24.05 SWALL:O54569 (EMBL:Y16311) (431 aa) fasta scores: E(): 1.2e-33%2C 42.25%25 id in 284 aa;gbkey=CDS;product=conserved integral membrane protein;protein_id=CAD67474.1;transl_table=11
BX072543.1	EMBL	sequence_feature	924317	925007	.	-	.	ID=id1632;Note=60Kd inner membrane protein Score %3D 175.0 E-value %3D 8.9e-50;gbkey=misc_feature
BX072543.1	EMBL	sequence_feature	924942	925010	.	-	.	ID=id1633;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 42-64%2C 183-205 and 232-254;gbkey=misc_feature;is_ordered=true;part=1/3;partial=true
BX072543.1	EMBL	sequence_feature	924519	924587	.	-	.	ID=id1633;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 42-64%2C 183-205 and 232-254;gbkey=misc_feature;is_ordered=true;part=2/3;partial=true
BX072543.1	EMBL	sequence_feature	924372	924440	.	-	.	ID=id1633;Note=3 probable transmembrane helices predicted for Unknown_CDS by TMHMM2.0 at aa 42-64%2C 183-205 and 232-254;gbkey=misc_feature;is_ordered=true;part=3/3;partial=true
BX072543.1	EMBL	gene	925126	925404	.	-	.	ID=gene786;Name=TW816;gbkey=Gene;gene_biotype=protein_coding;locus_tag=TW816
BX072543.1	EMBL	CDS	925126	925404	.	-	0	ID=cds782;Parent=gene786;Dbxref=GOA:Q83H58,InterPro:IPR002696,NCBI_GP:CAD67475.1;Name=CAD67475.1;Note=Similar to Streptomyces coelicolor hypothetical protein SCO3882 or SCH24.04 SWALL:Y2I2_STRCO (SWALL:O54625) (124 aa) fasta scores: E(): 1.8e-10%2C 52.23%25 id in 67 aa%2C and to Chlamydia pneumoniae hypothetical protein Cpn0592/Cp0156/Cpj0592 SWALL:Y592_CHLPN (SWALL:Q9Z7W2) (103 aa) fasta scores: E(): 1.3e-09%2C 34.61%25 id in 78 aa;gbkey=CDS;product=conserved hypothetical protein;protein_id=CAD67475.1;transl_table=11
BX072543.1	EMBL	sequence_feature	925188	925389	.	-	.	ID=id1634;Note=Domain of unknown function DUF37 Score %3D 77.8 E-value %3D 1.6e-20;gbkey=misc_feature
BX072543.1	EMBL	gene	925397	925735	.	-	.	ID=gene787;Name=rnpA;gbkey=Gene;gene=rnpA;gene_biotype=protein_coding;locus_tag=TW817
BX072543.1	EMBL	CDS	925397	925735	.	-	0	ID=cds783;Parent=gene787;Dbxref=GOA:Q83H57,InterPro:IPR000100,InterPro:IPR014721,InterPro:IPR020539,InterPro:IPR020568,UniProtKB/TrEMBL:Q83H57,NCBI_GP:CAD67476.1;Name=CAD67476.1;Note=Similar to Bacillus subtilis ribonuclease P protein component RnpA SWALL:RNPA_BACSU (SWALL:P25814) (116 aa) fasta scores: E(): 0.00084%2C 29.8%25 id in 104 aa;gbkey=CDS;gene=rnpA;product=ribonuclease P protein component;protein_id=CAD67476.1;transl_table=11
BX072543.1	EMBL	sequence_feature	925411	925723	.	-	.	ID=id1635;Note=Ribonuclease P Score %3D 41.2 E-value %3D 1.7e-09;gbkey=misc_feature;gene=rnpA
BX072543.1	EMBL	sequence_feature	925550	925594	.	-	.	ID=id1636;Note=PS00648 Bacterial ribonuclease P protein component signature.;gbkey=misc_feature;gene=rnpA
###