##gff-version 3
#!gff-spec-version 1.21
#!processor NCBI annotwriter
#!genome-build ASM9144v1
#!genome-build-accession NCBI_Assembly:GCA_000091445.1
##sequence-region CP002027.1 1 1078809
##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=766747
CP002027.1	Genbank	region	1	1078809	.	+	.	ID=id0;Dbxref=taxon:766747;Is_circular=true;Name=ANONYMOUS;clone=sMmYCp235-1;gbkey=Src;genome=chromosome;mol_type=other DNA
CP002027.1	Genbank	gene	1	1353	.	+	.	ID=gene0;Name=dnaA_1;gbkey=Gene;gene=dnaA_1;locus_tag=MMSYN1_0001
CP002027.1	Genbank	CDS	1	1353	.	+	0	ID=cds0;Parent=gene0;Dbxref=NCBI_GP:ADH22081.1;Name=ADH22081.1;Note=identified by match to protein family HMM PF00308%3B match to protein family HMM PF08299%3B match to protein family HMM TIGR00362;gbkey=CDS;gene=dnaA_1;product=chromosomal replication initiator protein DnaA;protein_id=ADH22081.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1	1074	.	+	.	ID=id1;Note=mmyc811a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=dnaA_1
CP002027.1	Genbank	sequence_feature	995	2074	.	+	.	ID=id2;Note=mmyc812a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1511	2638	.	+	.	ID=gene1;Name=dnaN;gbkey=Gene;gene=dnaN;locus_tag=MMSYN1_0002
CP002027.1	Genbank	CDS	1511	2638	.	+	0	ID=cds1;Parent=gene1;Dbxref=NCBI_GP:ADH22028.1;Name=ADH22028.1;Note=identified by match to protein family HMM PF00712%3B match to protein family HMM PF02767%3B match to protein family HMM PF02768%3B match to protein family HMM TIGR00663;gbkey=CDS;gene=dnaN;product=DNA polymerase III%2C beta subunit;protein_id=ADH22028.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1995	3074	.	+	.	ID=id3;Note=mmyc813%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	2675	3217	.	+	.	ID=gene2;Name=rnmV;gbkey=Gene;gene=rnmV;locus_tag=MMSYN1_0003
CP002027.1	Genbank	CDS	2675	3217	.	+	0	ID=cds2;Parent=gene2;Dbxref=NCBI_GP:ADH21921.1;Name=ADH21921.1;Note=identified by match to protein family HMM PF01751%3B match to protein family HMM TIGR00334;gbkey=CDS;gene=rnmV;product=ribonuclease M5;protein_id=ADH21921.1;transl_table=4
CP002027.1	Genbank	sequence_feature	2995	4074	.	+	.	ID=id4;Note=mmyc814%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	3207	4007	.	+	.	ID=gene3;Name=ksgA;gbkey=Gene;gene=ksgA;locus_tag=MMSYN1_0004
CP002027.1	Genbank	CDS	3207	4007	.	+	0	ID=cds3;Parent=gene3;Dbxref=NCBI_GP:ADH21493.1;Name=ADH21493.1;Note=identified by match to protein family HMM PF00398%3B match to protein family HMM TIGR00755;gbkey=CDS;gene=ksgA;product=dimethyladenosine transferase;protein_id=ADH21493.1;transl_table=4
CP002027.1	Genbank	sequence_feature	3995	5074	.	+	.	ID=id5;Note=mmyc815%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	4064	5155	.	+	.	ID=gene4;Name=MMSYN1_0005;gbkey=Gene;locus_tag=MMSYN1_0005
CP002027.1	Genbank	CDS	4064	5155	.	+	0	ID=cds4;Parent=gene4;Dbxref=NCBI_GP:ADH21820.1;Name=ADH21820.1;gbkey=CDS;product=hypothetical purine NTPase;protein_id=ADH21820.1;transl_table=4
CP002027.1	Genbank	sequence_feature	4995	6074	.	+	.	ID=id6;Note=mmyc816%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	5515	7419	.	+	.	ID=gene5;Name=gyrB;gbkey=Gene;gene=gyrB;locus_tag=MMSYN1_0006
CP002027.1	Genbank	CDS	5515	7419	.	+	0	ID=cds5;Parent=gene5;Dbxref=NCBI_GP:ADH22170.1;Name=ADH22170.1;Note=identified by match to protein family HMM PF00204%3B match to protein family HMM PF00986%3B match to protein family HMM PF01751%3B match to protein family HMM PF02518%3B match to protein family HMM TIGR01059;gbkey=CDS;gene=gyrB;product=DNA gyrase%2C B subunit;protein_id=ADH22170.1;transl_table=4
CP002027.1	Genbank	sequence_feature	5995	7074	.	+	.	ID=id7;Note=mmyc817%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=gyrB
CP002027.1	Genbank	sequence_feature	6995	8074	.	+	.	ID=id8;Note=mmyc818%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	7435	9939	.	+	.	ID=gene6;Name=gyrA;gbkey=Gene;gene=gyrA;locus_tag=MMSYN1_0007
CP002027.1	Genbank	CDS	7435	9939	.	+	0	ID=cds6;Parent=gene6;Dbxref=NCBI_GP:ADH21637.1;Name=ADH21637.1;Note=identified by match to protein family HMM PF00521%3B match to protein family HMM PF03989%3B match to protein family HMM TIGR01063;gbkey=CDS;gene=gyrA;product=DNA gyrase%2C A subunit;protein_id=ADH21637.1;transl_table=4
CP002027.1	Genbank	sequence_feature	7995	9074	.	+	.	ID=id9;Note=mmyc819%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=gyrA
CP002027.1	Genbank	sequence_feature	8995	10074	.	+	.	ID=id10;Note=mmyc820%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	9991	10968	.	-	.	ID=gene7;Name=MMSYN1_0008;gbkey=Gene;locus_tag=MMSYN1_0008
CP002027.1	Genbank	CDS	9991	10968	.	-	0	ID=cds7;Parent=gene7;Dbxref=NCBI_GP:ADH22026.1;Name=ADH22026.1;Note=identified by match to protein family HMM PF02653;gbkey=CDS;product=ribose/Galactose ABC transporter%2C permease component II;protein_id=ADH22026.1;transl_table=4
CP002027.1	Genbank	sequence_feature	9995	11074	.	+	.	ID=id11;Note=mmyc821%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	10968	13535	.	-	.	ID=gene8;Name=MMSYN1_0009;gbkey=Gene;locus_tag=MMSYN1_0009
CP002027.1	Genbank	CDS	10968	13535	.	-	0	ID=cds8;Parent=gene8;Dbxref=NCBI_GP:ADH21938.1;Name=ADH21938.1;Note=identified by match to protein family HMM PF02653;gbkey=CDS;product=ABC transporter%2C permease protein;protein_id=ADH21938.1;transl_table=4
CP002027.1	Genbank	sequence_feature	10995	12074	.	+	.	ID=id12;Note=mmyc822%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	11995	13074	.	+	.	ID=id13;Note=mmyc823%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	12995	14074	.	+	.	ID=id14;Note=mmyc824%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	13525	15141	.	-	.	ID=gene9;Name=MMSYN1_0010;gbkey=Gene;locus_tag=MMSYN1_0010
CP002027.1	Genbank	CDS	13525	15141	.	-	0	ID=cds9;Parent=gene9;Dbxref=NCBI_GP:ADH22009.1;Name=ADH22009.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=ribose/Galactose ABC transporter%2C ATP-binding component;protein_id=ADH22009.1;transl_table=4
CP002027.1	Genbank	sequence_feature	13995	15074	.	+	.	ID=id15;Note=mmyc825%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	14995	16074	.	+	.	ID=id16;Note=mmyc826%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	15153	16799	.	-	.	ID=gene10;Name=MMSYN1_0011;gbkey=Gene;locus_tag=MMSYN1_0011
CP002027.1	Genbank	CDS	15153	16799	.	-	0	ID=cds10;Parent=gene10;Dbxref=NCBI_GP:ADH21892.1;Name=ADH21892.1;gbkey=CDS;product=ribose/galactose ABC transporter%2C substrate-binding component;protein_id=ADH21892.1;transl_table=4
CP002027.1	Genbank	sequence_feature	15995	17074	.	+	.	ID=id17;Note=mmyc827%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	16986	18515	.	-	.	ID=gene11;Name=metG;gbkey=Gene;gene=metG;locus_tag=MMSYN1_0012
CP002027.1	Genbank	CDS	16986	18515	.	-	0	ID=cds11;Parent=gene11;Dbxref=NCBI_GP:ADH21797.1;Name=ADH21797.1;Note=identified by match to protein family HMM PF09334%3B match to protein family HMM TIGR00398;gbkey=CDS;gene=metG;product=methionine--tRNA ligase;protein_id=ADH21797.1;transl_table=4
CP002027.1	Genbank	sequence_feature	16995	18074	.	+	.	ID=id18;Note=mmyc828%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	17995	19074	.	+	.	ID=id19;Note=mmyc829%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	18716	20302	.	+	.	ID=gene12;Name=MMSYN1_0013;gbkey=Gene;locus_tag=MMSYN1_0013
CP002027.1	Genbank	CDS	18716	20302	.	+	0	ID=cds12;Parent=gene12;Dbxref=NCBI_GP:ADH21685.1;Name=ADH21685.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH21685.1;transl_table=4
CP002027.1	Genbank	sequence_feature	18995	20074	.	+	.	ID=id20;Note=mmyc830%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	19995	21074	.	+	.	ID=id21;Note=mmyc831%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	20317	21831	.	+	.	ID=gene13;Name=MMSYN1_0014;gbkey=Gene;locus_tag=MMSYN1_0014
CP002027.1	Genbank	CDS	20317	21831	.	+	0	ID=cds13;Parent=gene13;Dbxref=NCBI_GP:ADH21481.1;Name=ADH21481.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH21481.1;transl_table=4
CP002027.1	Genbank	sequence_feature	20995	22074	.	+	.	ID=id22;Note=mmyc832%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	21864	23393	.	+	.	ID=gene14;Name=MMSYN1_0015;gbkey=Gene;locus_tag=MMSYN1_0015
CP002027.1	Genbank	CDS	21864	23393	.	+	0	ID=cds14;Parent=gene14;Dbxref=NCBI_GP:ADH21762.1;Name=ADH21762.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH21762.1;transl_table=4
CP002027.1	Genbank	sequence_feature	21995	23074	.	+	.	ID=id23;Note=mmyc833%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	22995	24074	.	+	.	ID=id24;Note=mmyc834%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	23411	25009	.	+	.	ID=gene15;Name=MMSYN1_0016;gbkey=Gene;locus_tag=MMSYN1_0016
CP002027.1	Genbank	CDS	23411	25009	.	+	0	ID=cds15;Parent=gene15;Dbxref=NCBI_GP:ADH22147.1;Name=ADH22147.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH22147.1;transl_table=4
CP002027.1	Genbank	sequence_feature	23996	25075	.	+	.	ID=id25;Note=mmyc835a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	24996	26075	.	+	.	ID=id26;Note=mmyc836a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	25111	25215	.	+	.	ID=gene16;Name=MMSYN1_0916;gbkey=Gene;locus_tag=MMSYN1_0916
CP002027.1	Genbank	ncRNA	25111	25215	.	+	.	ID=rna0;Parent=gene16;Note=RNAI%3B Rfam score 64.68;gbkey=ncRNA;inference=nucleotide motif:RFAM:RF00106;product=RNAI
CP002027.1	Genbank	exon	25111	25215	.	+	.	ID=id27;Parent=rna0;Note=RNAI%3B Rfam score 64.68;gbkey=ncRNA;inference=nucleotide motif:RFAM:RF00106;product=RNAI
CP002027.1	Genbank	gene	25426	26286	.	-	.	ID=gene17;Name=bla;gbkey=Gene;gene=bla;locus_tag=MMSYN1_0914
CP002027.1	Genbank	CDS	25426	26286	.	-	0	ID=cds16;Parent=gene17;Dbxref=NCBI_GP:ADH21581.1;Name=ADH21581.1;Note=identified by match to protein family HMM PF00144;gbkey=CDS;gene=bla;product=beta-lactamase TEM (precursor);protein_id=ADH21581.1;transl_table=4
CP002027.1	Genbank	sequence_feature	25996	27075	.	+	.	ID=id28;Note=mmyc837a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	26357	27529	.	-	.	ID=gene18;Name=MMSYN1_0917;gbkey=Gene;locus_tag=MMSYN1_0917
CP002027.1	Genbank	CDS	26357	27529	.	-	0	ID=cds17;Parent=gene18;Dbxref=NCBI_GP:ADH21904.1;Name=ADH21904.1;Note=identified by match to protein family HMM PF00872;gbkey=CDS;product=transposase%2C Mutator family;protein_id=ADH21904.1;transl_table=4
CP002027.1	Genbank	sequence_feature	26996	28075	.	+	.	ID=id29;Note=mmyc838a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	27639	28301	.	-	.	ID=gene19;Name=his3;gbkey=Gene;gene=his3;locus_tag=MMSYN1_0918
CP002027.1	Genbank	CDS	27639	28301	.	-	0	ID=cds18;Parent=gene19;Dbxref=NCBI_GP:ADH22012.1;Name=ADH22012.1;Note=identified by match to protein family HMM PF00475;gbkey=CDS;gene=his3;product=imidazoleglycerol-phosphate dehydratase;protein_id=ADH22012.1;transl_table=4
CP002027.1	Genbank	sequence_feature	27996	29075	.	+	.	ID=id30;Note=mmyc839a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	28996	30075	.	+	.	ID=id31;Note=mmyc840a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	29270	31258	.	+	.	ID=gene20;Name=tetM;gbkey=Gene;gene=tetM;locus_tag=MMSYN1_0913
CP002027.1	Genbank	CDS	29270	31258	.	+	0	ID=cds19;Parent=gene20;Dbxref=NCBI_GP:ADH21996.1;Name=ADH21996.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF00679%3B match to protein family HMM PF03144%3B match to protein family HMM PF03764;gbkey=CDS;gene=tetM;product=Tn916%2C tetracycline resistance protein;protein_id=ADH21996.1;transl_table=4
CP002027.1	Genbank	sequence_feature	29996	31075	.	+	.	ID=id32;Note=mmyc841a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=tetM
CP002027.1	Genbank	sequence_feature	30996	32075	.	+	.	ID=id33;Note=mmyc842a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	31535	34618	.	+	.	ID=gene21;Name=lacZ;gbkey=Gene;gene=lacZ;locus_tag=MMSYN1_0915
CP002027.1	Genbank	CDS	31535	34618	.	+	0	ID=cds20;Parent=gene21;Dbxref=NCBI_GP:ADH22253.1;Name=ADH22253.1;Note=identified by match to protein family HMM PF00703%3B match to protein family HMM PF02836%3B match to protein family HMM PF02929;gbkey=CDS;gene=lacZ;product=beta-galactosidase%2C chain D;protein_id=ADH22253.1;transl_table=4
CP002027.1	Genbank	sequence_feature	31996	33075	.	+	.	ID=id34;Note=mmyc843a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lacZ
CP002027.1	Genbank	sequence_feature	32996	34075	.	+	.	ID=id35;Note=mmyc844a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lacZ
CP002027.1	Genbank	sequence_feature	33996	35075	.	+	.	ID=id36;Note=mmyc845a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	34996	36075	.	+	.	ID=id37;Note=mmyc846a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	35234	35776	.	+	.	ID=gene22;Name=tnpA_1;gbkey=Gene;gene=tnpA_1;locus_tag=MMSYN1_0921
CP002027.1	Genbank	CDS	35234	35776	.	+	0	ID=cds21;Parent=gene22;Dbxref=NCBI_GP:ADH21458.1;Name=ADH21458.1;gbkey=CDS;gene=tnpA_1;product=IS1296 transposase protein A;protein_id=ADH21458.1;transl_table=4
CP002027.1	Genbank	gene	35914	36645	.	+	.	ID=gene23;Name=tnpB_1;gbkey=Gene;gene=tnpB_1;locus_tag=MMSYN1_0922
CP002027.1	Genbank	CDS	35914	36645	.	+	0	ID=cds22;Parent=gene23;Dbxref=NCBI_GP:ADH21864.1;Name=ADH21864.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_1;product=IS1296 transposase protein B;protein_id=ADH21864.1;transl_table=4
CP002027.1	Genbank	sequence_feature	35996	37075	.	+	.	ID=id38;Note=mmyc847a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	36687	37673	.	-	.	ID=gene24;Name=MMSYN1_0019;gbkey=Gene;locus_tag=MMSYN1_0019
CP002027.1	Genbank	CDS	36687	37673	.	-	0	ID=cds23;Parent=gene24;Dbxref=NCBI_GP:ADH21739.1;Name=ADH21739.1;Note=identified by match to protein family HMM PF01232%3B match to protein family HMM PF08125;gbkey=CDS;product=mannitol-1-phosphate 5-dehydrogenase;protein_id=ADH21739.1;transl_table=4
CP002027.1	Genbank	sequence_feature	36996	38075	.	+	.	ID=id39;Note=mmyc848a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	37674	38471	.	-	.	ID=gene25;Name=MMSYN1_0020;gbkey=Gene;locus_tag=MMSYN1_0020
CP002027.1	Genbank	CDS	37674	38471	.	-	0	ID=cds24;Parent=gene25;Dbxref=NCBI_GP:ADH22032.1;Name=ADH22032.1;Note=identified by match to protein family HMM PF01380%3B match to protein family HMM PF01418;gbkey=CDS;product=transcriptional regulator%2C RpiR family;protein_id=ADH22032.1;transl_table=4
CP002027.1	Genbank	sequence_feature	37996	39075	.	+	.	ID=id40;Note=mmyc849a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	38505	38921	.	-	.	ID=gene26;Name=MMSYN1_0021;gbkey=Gene;locus_tag=MMSYN1_0021
CP002027.1	Genbank	CDS	38505	38921	.	-	0	ID=cds25;Parent=gene26;Dbxref=NCBI_GP:ADH21913.1;Name=ADH21913.1;Note=identified by match to protein family HMM PF00359;gbkey=CDS;product=PTS system%2C mannitol-permease iia component;protein_id=ADH21913.1;transl_table=4
CP002027.1	Genbank	gene	38921	39679	.	-	.	ID=gene27;Name=MMSYN1_0022;gbkey=Gene;locus_tag=MMSYN1_0022
CP002027.1	Genbank	CDS	38921	39679	.	-	0	ID=cds26;Parent=gene27;Dbxref=NCBI_GP:ADH22201.1;Name=ADH22201.1;Note=identified by match to protein family HMM PF00106;gbkey=CDS;product=sorbitol-6-phosphate 2-dehydrogenase (Glucitol-6-phosphate dehydrogenase) (Ketosephosphate reductase);protein_id=ADH22201.1;transl_table=4
CP002027.1	Genbank	sequence_feature	38996	40075	.	+	.	ID=id41;Note=mmyc850a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	39679	41238	.	-	.	ID=gene28;Name=MMSYN1_0023;gbkey=Gene;locus_tag=MMSYN1_0023
CP002027.1	Genbank	CDS	39679	41238	.	-	0	ID=cds27;Parent=gene28;Dbxref=NCBI_GP:ADH22073.1;Name=ADH22073.1;Note=identified by match to protein family HMM PF02302%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system%2C mannitol-permease iibc component;protein_id=ADH22073.1;transl_table=4
CP002027.1	Genbank	sequence_feature	39940	41019	.	+	.	ID=id42;Note=mmyc853%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	40940	42019	.	+	.	ID=id43;Note=mmyc854%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	41509	42891	.	-	.	ID=gene29;Name=MMSYN1_0024;Note=divergent AAA domain family%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF04326;gbkey=Gene;locus_tag=MMSYN1_0024;pseudo=true
CP002027.1	Genbank	sequence_feature	41940	43019	.	+	.	ID=id44;Note=mmyc855%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	42940	44019	.	+	.	ID=id45;Note=mmyc856%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	43284	43511	.	-	.	ID=gene30;Name=rpsR;gbkey=Gene;gene=rpsR;locus_tag=MMSYN1_0025
CP002027.1	Genbank	CDS	43284	43511	.	-	0	ID=cds28;Parent=gene30;Dbxref=NCBI_GP:ADH21461.1;Name=ADH21461.1;Note=identified by match to protein family HMM PF01084%3B match to protein family HMM TIGR00165;gbkey=CDS;gene=rpsR;product=ribosomal protein S18;protein_id=ADH21461.1;transl_table=4
CP002027.1	Genbank	gene	43531	43971	.	-	.	ID=gene31;Name=MMSYN1_0026;gbkey=Gene;locus_tag=MMSYN1_0026
CP002027.1	Genbank	CDS	43531	43971	.	-	0	ID=cds29;Parent=gene31;Dbxref=NCBI_GP:ADH21632.1;Name=ADH21632.1;Note=identified by match to protein family HMM PF00436%3B match to protein family HMM PF01336%3B match to protein family HMM TIGR00621;gbkey=CDS;product=single-strand binding protein;protein_id=ADH21632.1;transl_table=4
CP002027.1	Genbank	sequence_feature	43940	45019	.	+	.	ID=id46;Note=mmyc857%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	43983	44396	.	-	.	ID=gene32;Name=MMSYN1_0027;gbkey=Gene;locus_tag=MMSYN1_0027
CP002027.1	Genbank	CDS	43983	44396	.	-	0	ID=cds30;Parent=gene32;Dbxref=NCBI_GP:ADH22160.1;Name=ADH22160.1;Note=identified by match to protein family HMM PF01250%3B match to protein family HMM TIGR00166;gbkey=CDS;product=30S ribosomal protein S6;protein_id=ADH22160.1;transl_table=4
CP002027.1	Genbank	gene	44601	44810	.	-	.	ID=gene33;Name=MMSYN1_0028;gbkey=Gene;locus_tag=MMSYN1_0028
CP002027.1	Genbank	CDS	44601	44810	.	-	0	ID=cds31;Parent=gene33;Dbxref=NCBI_GP:ADH22246.1;Name=ADH22246.1;Note=identified by match to protein family HMM PF00313;gbkey=CDS;product=cold-shock DNA-binding domain%2C putative;protein_id=ADH22246.1;transl_table=4
CP002027.1	Genbank	sequence_feature	44940	46019	.	+	.	ID=id47;Note=mmyc858%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	44998	45597	.	+	.	ID=gene34;Name=MMSYN1_0029;gbkey=Gene;locus_tag=MMSYN1_0029
CP002027.1	Genbank	CDS	44998	45597	.	+	0	ID=cds32;Parent=gene34;Dbxref=NCBI_GP:ADH21978.1;Name=ADH21978.1;Note=identified by match to protein family HMM PF02525;gbkey=CDS;product=fmn-dependent NADH-azoreductase (fmn-dependent nadh-azocompound oxidoreductase) (azo-dye reductase);protein_id=ADH21978.1;transl_table=4
CP002027.1	Genbank	gene	45634	46668	.	-	.	ID=gene35;Name=MMSYN1_0030;gbkey=Gene;locus_tag=MMSYN1_0030
CP002027.1	Genbank	CDS	45634	46668	.	-	0	ID=cds33;Parent=gene35;Dbxref=NCBI_GP:ADH21702.1;Name=ADH21702.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=abc transporter%2C ATP-binding protein;protein_id=ADH21702.1;transl_table=4
CP002027.1	Genbank	sequence_feature	45940	47019	.	+	.	ID=id48;Note=mmyc859%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	46716	47582	.	-	.	ID=gene36;Name=hslO;gbkey=Gene;gene=hslO;locus_tag=MMSYN1_0031
CP002027.1	Genbank	CDS	46716	47582	.	-	0	ID=cds34;Parent=gene36;Dbxref=NCBI_GP:ADH22090.1;Name=ADH22090.1;Note=identified by match to protein family HMM PF01430;gbkey=CDS;gene=hslO;product=chaperonin HslO;protein_id=ADH22090.1;transl_table=4
CP002027.1	Genbank	sequence_feature	46940	48019	.	+	.	ID=id49;Note=mmyc860%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	47674	50835	.	-	.	ID=gene37;Name=MMSYN1_0032;gbkey=Gene;locus_tag=MMSYN1_0032
CP002027.1	Genbank	CDS	47674	50835	.	-	0	ID=cds35;Parent=gene37;Dbxref=NCBI_GP:ADH21983.1;Name=ADH21983.1;Note=identified by match to protein family HMM PF08178;gbkey=CDS;product=GnsA/GnsB family;protein_id=ADH21983.1;transl_table=4
CP002027.1	Genbank	sequence_feature	47940	49019	.	+	.	ID=id50;Note=mmyc861%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_difference	48020	48020	.	+	.	ID=id51;Note=SNP%3B compared to JCVI-syn1%3B Gly (JCVI-syn1) -> Ala (sMmYCp235-1)%2C CDS: GnsA/GnsB family;gbkey=misc_difference;replace=c
CP002027.1	Genbank	sequence_feature	48940	50019	.	+	.	ID=id52;Note=mmyc862%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	49940	51019	.	+	.	ID=id53;Note=mmyc863%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	50940	52019	.	+	.	ID=id54;Note=mmyc864%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	50958	54116	.	-	.	ID=gene38;Name=MMSYN1_0033;gbkey=Gene;locus_tag=MMSYN1_0033
CP002027.1	Genbank	CDS	50958	54116	.	-	0	ID=cds36;Parent=gene38;Dbxref=NCBI_GP:ADH21876.1;Name=ADH21876.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21876.1;transl_table=4
CP002027.1	Genbank	sequence_feature	51940	53019	.	+	.	ID=id55;Note=mmyc865%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	52940	54019	.	+	.	ID=id56;Note=mmyc866%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	53940	55019	.	+	.	ID=id57;Note=mmyc867%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	54281	59650	.	+	.	ID=gene39;Name=MMSYN1_0034;gbkey=Gene;locus_tag=MMSYN1_0034
CP002027.1	Genbank	CDS	54281	59650	.	+	0	ID=cds37;Parent=gene39;Dbxref=NCBI_GP:ADH21656.1;Name=ADH21656.1;Note=identified by match to protein family HMM PF02687;gbkey=CDS;product=efflux ABC transporter%2C permease protein;protein_id=ADH21656.1;transl_table=4
CP002027.1	Genbank	sequence_feature	54940	56019	.	+	.	ID=id58;Note=mmyc868%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	55940	57019	.	+	.	ID=id59;Note=mmyc869%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	56940	58019	.	+	.	ID=id60;Note=mmyc870%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	57940	59019	.	+	.	ID=id61;Note=mmyc871%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	58940	60019	.	+	.	ID=id62;Note=mmyc872%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	59775	60968	.	+	.	ID=gene40;Name=MMSYN1_0035;gbkey=Gene;locus_tag=MMSYN1_0035
CP002027.1	Genbank	CDS	59775	60968	.	+	0	ID=cds38;Parent=gene40;Dbxref=NCBI_GP:ADH21989.1;Name=ADH21989.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21989.1;transl_table=4
CP002027.1	Genbank	sequence_feature	59940	61019	.	+	.	ID=id63;Note=mmyc873%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	60940	62019	.	+	.	ID=id64;Note=mmyc874f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	61277	62263	.	+	.	ID=gene41;Name=MMSYN1_0036;gbkey=Gene;locus_tag=MMSYN1_0036
CP002027.1	Genbank	CDS	61277	62263	.	+	0	ID=cds39;Parent=gene41;Dbxref=NCBI_GP:ADH21649.1;Name=ADH21649.1;Note=identified by match to protein family HMM PF00389%3B match to protein family HMM PF02826;gbkey=CDS;product=D-lactate dehydrogenase;protein_id=ADH21649.1;transl_table=4
CP002027.1	Genbank	sequence_feature	61940	63019	.	+	.	ID=id65;Note=mmyc875%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	62282	63406	.	+	.	ID=gene42;Name=MMSYN1_0037;gbkey=Gene;locus_tag=MMSYN1_0037
CP002027.1	Genbank	CDS	62282	63406	.	+	0	ID=cds40;Parent=gene42;Dbxref=NCBI_GP:ADH21787.1;Name=ADH21787.1;Note=identified by match to protein family HMM PF03547;gbkey=CDS;product=malate permease;protein_id=ADH21787.1;transl_table=4
CP002027.1	Genbank	sequence_feature	62940	64019	.	+	.	ID=id66;Note=mmyc876%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	63762	65045	.	+	.	ID=gene43;Name=MMSYN1_0038;gbkey=Gene;locus_tag=MMSYN1_0038
CP002027.1	Genbank	CDS	63762	65045	.	+	0	ID=cds41;Parent=gene43;Dbxref=NCBI_GP:ADH22203.1;Name=ADH22203.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22203.1;transl_table=4
CP002027.1	Genbank	sequence_feature	63940	65019	.	+	.	ID=id67;Note=mmyc877%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	64940	66019	.	+	.	ID=id68;Note=mmyc878%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	65087	67033	.	-	.	ID=gene44;Name=MMSYN1_0039;gbkey=Gene;locus_tag=MMSYN1_0039
CP002027.1	Genbank	CDS	65087	67033	.	-	0	ID=cds42;Parent=gene44;Dbxref=NCBI_GP:ADH21643.1;Name=ADH21643.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM PF01434%3B match to protein family HMM PF06480%3B match to protein family HMM PF07728%3B match to protein family HMM TIGR01241;gbkey=CDS;product=peptidase%2C M41 family;protein_id=ADH21643.1;transl_table=4
CP002027.1	Genbank	sequence_feature	65940	67019	.	+	.	ID=id69;Note=mmyc879%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	66940	68019	.	+	.	ID=id70;Note=mmyc880%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	67265	68110	.	+	.	ID=gene45;Name=MMSYN1_0041;gbkey=Gene;locus_tag=MMSYN1_0041
CP002027.1	Genbank	CDS	67265	68110	.	+	0	ID=cds43;Parent=gene45;Dbxref=NCBI_GP:ADH21823.1;Name=ADH21823.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21823.1;transl_table=4
CP002027.1	Genbank	sequence_feature	67940	69019	.	+	.	ID=id71;Note=mmyc881%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	68094	69299	.	-	.	ID=gene46;Name=MMSYN1_0040;gbkey=Gene;locus_tag=MMSYN1_0040
CP002027.1	Genbank	CDS	68094	69299	.	-	0	ID=cds44;Parent=gene46;Dbxref=NCBI_GP:ADH21999.1;Name=ADH21999.1;Note=identified by match to protein family HMM PF01171%3B match to protein family HMM TIGR02432;gbkey=CDS;product=tRNA(Ile)-lysidine synthase (tRNA(Ile)-lysidinesynthetase) (tRNA(Ile)-2-lysyl-cytidine synthase);protein_id=ADH21999.1;transl_table=4
CP002027.1	Genbank	sequence_feature	68940	70019	.	+	.	ID=id72;Note=mmyc882%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	69302	70129	.	-	.	ID=gene47;Name=MMSYN1_0042;gbkey=Gene;locus_tag=MMSYN1_0042
CP002027.1	Genbank	CDS	69302	70129	.	-	0	ID=cds45;Parent=gene47;Dbxref=NCBI_GP:ADH21875.1;Name=ADH21875.1;Note=identified by match to protein family HMM PF01418;gbkey=CDS;product=transcriptional regulator%2C RpiR family protein;protein_id=ADH21875.1;transl_table=4
CP002027.1	Genbank	sequence_feature	69940	71019	.	+	.	ID=id73;Note=mmyc883%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	70181	70903	.	-	.	ID=gene48;Name=MMSYN1_0043;gbkey=Gene;locus_tag=MMSYN1_0043
CP002027.1	Genbank	CDS	70181	70903	.	-	0	ID=cds46;Parent=gene48;Dbxref=NCBI_GP:ADH21976.1;Name=ADH21976.1;Note=identified by match to protein family HMM PF01170%3B match to protein family HMM PF05175;gbkey=CDS;product=methyltransferase;protein_id=ADH21976.1;transl_table=4
CP002027.1	Genbank	gene	70903	71643	.	-	.	ID=gene49;Name=MMSYN1_0044;gbkey=Gene;locus_tag=MMSYN1_0044
CP002027.1	Genbank	CDS	70903	71643	.	-	0	ID=cds47;Parent=gene49;Dbxref=NCBI_GP:ADH22087.1;Name=ADH22087.1;gbkey=CDS;product=DNA polymerase III delta subunit;protein_id=ADH22087.1;transl_table=4
CP002027.1	Genbank	sequence_feature	70940	72019	.	+	.	ID=id74;Note=mmyc884%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	71621	72262	.	-	.	ID=gene50;Name=tmk;gbkey=Gene;gene=tmk;locus_tag=MMSYN1_0045
CP002027.1	Genbank	CDS	71621	72262	.	-	0	ID=cds48;Parent=gene50;Dbxref=NCBI_GP:ADH22196.1;Name=ADH22196.1;Note=identified by match to protein family HMM PF02223%3B match to protein family HMM TIGR00041;gbkey=CDS;gene=tmk;product=dTMP kinase;protein_id=ADH22196.1;transl_table=4
CP002027.1	Genbank	sequence_feature	71940	73019	.	+	.	ID=id75;Note=mmyc885%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	72265	72855	.	-	.	ID=gene51;Name=MMSYN1_0046;gbkey=Gene;locus_tag=MMSYN1_0046
CP002027.1	Genbank	CDS	72265	72855	.	-	0	ID=cds49;Parent=gene51;Dbxref=NCBI_GP:ADH21855.1;Name=ADH21855.1;Note=identified by match to protein family HMM PF01751%3B match to protein family HMM PF02132;gbkey=CDS;product=DNA repair protein RecM;protein_id=ADH21855.1;transl_table=4
CP002027.1	Genbank	gene	72857	74863	.	-	.	ID=gene52;Name=dnaX;gbkey=Gene;gene=dnaX;locus_tag=MMSYN1_0047
CP002027.1	Genbank	CDS	72857	74863	.	-	0	ID=cds50;Parent=gene52;Dbxref=NCBI_GP:ADH21544.1;Name=ADH21544.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM TIGR02397;gbkey=CDS;gene=dnaX;product=DNA polymerase III%2C gamma/tau subunit;protein_id=ADH21544.1;transl_table=4
CP002027.1	Genbank	sequence_feature	72940	74019	.	+	.	ID=id76;Note=mmyc886%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	73940	75019	.	+	.	ID=id77;Note=mmyc887%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	74940	76019	.	+	.	ID=id78;Note=mmyc888%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	74945	75412	.	-	.	ID=gene53;Name=MMSYN1_0048;gbkey=Gene;locus_tag=MMSYN1_0048
CP002027.1	Genbank	CDS	74945	75412	.	-	0	ID=cds51;Parent=gene53;Dbxref=NCBI_GP:ADH22036.1;Name=ADH22036.1;Note=identified by match to protein family HMM PF00383;gbkey=CDS;product=cytosine deaminase;protein_id=ADH22036.1;transl_table=4
CP002027.1	Genbank	gene	75393	75491	.	-	.	ID=gene54;Name=srpB;gbkey=Gene;gene=srpB;locus_tag=MMSYN1_0049
CP002027.1	Genbank	SRP_RNA	75393	75491	.	-	.	ID=rna1;Parent=gene54;gbkey=ncRNA;gene=srpB;product=Bacterial signal recognition particle RNA
CP002027.1	Genbank	exon	75393	75491	.	-	.	ID=id79;Parent=rna1;gbkey=ncRNA;gene=srpB;product=Bacterial signal recognition particle RNA
CP002027.1	Genbank	gene	75529	76491	.	-	.	ID=gene55;Name=guaC;gbkey=Gene;gene=guaC;locus_tag=MMSYN1_0050
CP002027.1	Genbank	CDS	75529	76491	.	-	0	ID=cds52;Parent=gene55;Dbxref=NCBI_GP:ADH21750.1;Name=ADH21750.1;Note=identified by match to protein family HMM PF00478%3B match to protein family HMM TIGR01306;gbkey=CDS;gene=guaC;product=GMP reductase;protein_id=ADH21750.1;transl_table=4
CP002027.1	Genbank	sequence_feature	75940	77019	.	+	.	ID=id80;Note=mmyc889%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	76906	77202	.	-	.	ID=gene56;Name=MMSYN1_0051;gbkey=Gene;locus_tag=MMSYN1_0051
CP002027.1	Genbank	CDS	76906	77202	.	-	0	ID=cds53;Parent=gene56;Dbxref=NCBI_GP:ADH22115.1;Name=ADH22115.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22115.1;transl_table=4
CP002027.1	Genbank	sequence_feature	76940	78019	.	+	.	ID=id81;Note=mmyc890%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	77327	77647	.	-	.	ID=gene57;Name=MMSYN1_0052;gbkey=Gene;locus_tag=MMSYN1_0052
CP002027.1	Genbank	CDS	77327	77647	.	-	0	ID=cds54;Parent=gene57;Dbxref=NCBI_GP:ADH22006.1;Name=ADH22006.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22006.1;transl_table=4
CP002027.1	Genbank	pseudogene	77755	79851	.	-	.	ID=gene58;Name=MMSYN1_0053;Note=putative liporotein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0053;pseudo=true
CP002027.1	Genbank	sequence_feature	77940	79019	.	+	.	ID=id82;Note=mmyc891%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	78940	80019	.	+	.	ID=id83;Note=mmyc892%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	79940	81019	.	+	.	ID=id84;Note=mmyc893%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	80000	80449	.	-	.	ID=gene59;Name=MMSYN1_0054;gbkey=Gene;locus_tag=MMSYN1_0054
CP002027.1	Genbank	CDS	80000	80449	.	-	0	ID=cds55;Parent=gene59;Dbxref=NCBI_GP:ADH22168.1;Name=ADH22168.1;Note=identified by match to protein family HMM PF00578%3B match to protein family HMM PF08534;gbkey=CDS;product=AhpC/TSA family protein;protein_id=ADH22168.1;transl_table=4
CP002027.1	Genbank	gene	80688	81977	.	-	.	ID=gene60;Name=mmyCVR;gbkey=Gene;gene=mmyCVR;locus_tag=MMSYN1_0055
CP002027.1	Genbank	CDS	80688	81977	.	-	0	ID=cds56;Parent=gene60;Dbxref=NCBI_GP:ADH21703.1;Name=ADH21703.1;gbkey=CDS;gene=mmyCVR;product=GATC--recognizing Type II restriction modification system (MmyCV) endonuclease subunit;protein_id=ADH21703.1;transl_table=4
CP002027.1	Genbank	sequence_feature	80940	82019	.	+	.	ID=id85;Note=mmyc894%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	81940	83019	.	+	.	ID=id86;Note=mmyc895%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	81979	82818	.	-	.	ID=gene61;Name=mmyC5VM;gbkey=Gene;gene=mmyC5VM;locus_tag=MMSYN1_0056
CP002027.1	Genbank	CDS	81979	82818	.	-	0	ID=cds57;Parent=gene61;Dbxref=NCBI_GP:ADH21471.1;Name=ADH21471.1;Note=identified by match to protein family HMM PF02086%3B match to protein family HMM TIGR00571;gbkey=CDS;gene=mmyC5VM;product=GATC--recognizing Type II restriction modification system (MmyCV) adenine DNA methyltransferase subunit;protein_id=ADH21471.1;transl_table=4
CP002027.1	Genbank	sequence_feature	82940	84019	.	+	.	ID=id87;Note=mmyc896%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	83287	83577	.	+	.	ID=gene62;Name=MMSYN1_0057;gbkey=Gene;locus_tag=MMSYN1_0057
CP002027.1	Genbank	CDS	83287	83577	.	+	0	ID=cds58;Parent=gene62;Dbxref=NCBI_GP:ADH21547.1;Name=ADH21547.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21547.1;transl_table=4
CP002027.1	Genbank	gene	83596	84177	.	+	.	ID=gene63;Name=MMSYN1_0058;gbkey=Gene;locus_tag=MMSYN1_0058
CP002027.1	Genbank	CDS	83596	84177	.	+	0	ID=cds59;Parent=gene63;Dbxref=NCBI_GP:ADH21617.1;Name=ADH21617.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21617.1;transl_table=4
CP002027.1	Genbank	sequence_feature	83940	85019	.	+	.	ID=id88;Note=mmyc897%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	84292	85410	.	+	.	ID=gene64;Name=ald;gbkey=Gene;gene=ald;locus_tag=MMSYN1_0059
CP002027.1	Genbank	CDS	84292	85410	.	+	0	ID=cds60;Parent=gene64;Dbxref=NCBI_GP:ADH22225.1;Name=ADH22225.1;Note=identified by match to protein family HMM PF01262%3B match to protein family HMM PF05222%3B match to protein family HMM TIGR00518;gbkey=CDS;gene=ald;product=alanine dehydrogenase;protein_id=ADH22225.1;transl_table=4
CP002027.1	Genbank	sequence_feature	84940	86019	.	+	.	ID=id89;Note=mmyc898%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	85704	86528	.	+	.	ID=gene65;Name=MMSYN1_0060;gbkey=Gene;locus_tag=MMSYN1_0060
CP002027.1	Genbank	CDS	85704	86528	.	+	0	ID=cds61;Parent=gene65;Dbxref=NCBI_GP:ADH22178.1;Name=ADH22178.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22178.1;transl_table=4
CP002027.1	Genbank	sequence_feature	85940	87019	.	+	.	ID=id90;Note=mmyc899%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	86611	87879	.	+	.	ID=gene66;Name=serS;gbkey=Gene;gene=serS;locus_tag=MMSYN1_0061
CP002027.1	Genbank	CDS	86611	87879	.	+	0	ID=cds62;Parent=gene66;Dbxref=NCBI_GP:ADH21898.1;Name=ADH21898.1;Note=identified by match to protein family HMM PF00587%3B match to protein family HMM PF02403%3B match to protein family HMM TIGR00414;gbkey=CDS;gene=serS;product=serine--tRNA ligase;protein_id=ADH21898.1;transl_table=4
CP002027.1	Genbank	sequence_feature	86940	88019	.	+	.	ID=id91;Note=mmyc900%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	87940	89019	.	+	.	ID=id92;Note=mmyc901%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	87981	88295	.	+	.	ID=gene67;Name=MMSYN1_0062;gbkey=Gene;locus_tag=MMSYN1_0062
CP002027.1	Genbank	CDS	87981	88295	.	+	0	ID=cds63;Parent=gene67;Dbxref=NCBI_GP:ADH21986.1;Name=ADH21986.1;Note=identified by match to protein family HMM PF08921;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21986.1;transl_table=4
CP002027.1	Genbank	gene	88297	89271	.	+	.	ID=gene68;Name=MMSYN1_0063;gbkey=Gene;locus_tag=MMSYN1_0063
CP002027.1	Genbank	CDS	88297	89271	.	+	0	ID=cds64;Parent=gene68;Dbxref=NCBI_GP:ADH21700.1;Name=ADH21700.1;Note=identified by match to protein family HMM PF01207%3B match to protein family HMM TIGR00737;gbkey=CDS;product=tRNA-dihydrouridine synthase B;protein_id=ADH21700.1;transl_table=4
CP002027.1	Genbank	sequence_feature	88940	90019	.	+	.	ID=id93;Note=mmyc902%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	89274	90776	.	+	.	ID=gene69;Name=lysS;gbkey=Gene;gene=lysS;locus_tag=MMSYN1_0064
CP002027.1	Genbank	CDS	89274	90776	.	+	0	ID=cds65;Parent=gene69;Dbxref=NCBI_GP:ADH22258.1;Name=ADH22258.1;Note=identified by match to protein family HMM PF00152%3B match to protein family HMM PF01336%3B match to protein family HMM TIGR00499;gbkey=CDS;gene=lysS;product=lysine--tRNA ligase;protein_id=ADH22258.1;transl_table=4
CP002027.1	Genbank	sequence_feature	89940	91019	.	+	.	ID=id94;Note=mmyc903%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	90866	91174	.	-	.	ID=gene70;Name=trxA;gbkey=Gene;gene=trxA;locus_tag=MMSYN1_0065
CP002027.1	Genbank	CDS	90866	91174	.	-	0	ID=cds66;Parent=gene70;Dbxref=NCBI_GP:ADH21901.1;Name=ADH21901.1;Note=identified by match to protein family HMM PF00085%3B match to protein family HMM TIGR01068;gbkey=CDS;gene=trxA;product=thioredoxin;protein_id=ADH21901.1;transl_table=4
CP002027.1	Genbank	sequence_feature	90940	92019	.	+	.	ID=id95;Note=mmyc904%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	91185	92027	.	-	.	ID=gene71;Name=MMSYN1_0066;gbkey=Gene;locus_tag=MMSYN1_0066
CP002027.1	Genbank	CDS	91185	92027	.	-	0	ID=cds67;Parent=gene71;Dbxref=NCBI_GP:ADH21916.1;Name=ADH21916.1;Note=identified by match to protein family HMM PF08282%3B match to protein family HMM TIGR01484;gbkey=CDS;product=putative hydrolase of the HAD family;protein_id=ADH21916.1;transl_table=4
CP002027.1	Genbank	sequence_feature	91940	93019	.	+	.	ID=id96;Note=mmyc905%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	92148	92256	.	-	.	ID=gene72;Name=rrf;gbkey=Gene;gene=rrf;locus_tag=MMSYN1_0067
CP002027.1	Genbank	rRNA	92148	92256	.	-	.	ID=rna2;Parent=gene72;gbkey=rRNA;gene=rrf;product=5S ribosomal RNA
CP002027.1	Genbank	exon	92148	92256	.	-	.	ID=id97;Parent=rna2;gbkey=rRNA;gene=rrf;product=5S ribosomal RNA
CP002027.1	Genbank	gene	92331	95225	.	-	.	ID=gene73;Name=rrl;gbkey=Gene;gene=rrl;locus_tag=MMSYN1_0068
CP002027.1	Genbank	rRNA	92331	95225	.	-	.	ID=rna3;Parent=gene73;gbkey=rRNA;gene=rrl;product=23S ribosomal RNA
CP002027.1	Genbank	exon	92331	95225	.	-	.	ID=id98;Parent=rna3;gbkey=rRNA;gene=rrl;product=23S ribosomal RNA
CP002027.1	Genbank	sequence_feature	92940	94019	.	+	.	ID=id99;Note=mmyc906%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	94940	96019	.	+	.	ID=id100;Note=mmyc908%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	95457	96980	.	-	.	ID=gene74;Name=rrs;gbkey=Gene;gene=rrs;locus_tag=MMSYN1_0069
CP002027.1	Genbank	rRNA	95457	96980	.	-	.	ID=rna4;Parent=gene74;gbkey=rRNA;gene=rrs;product=16S ribosomal RNA
CP002027.1	Genbank	exon	95457	96980	.	-	.	ID=id101;Parent=rna4;gbkey=rRNA;gene=rrs;product=16S ribosomal RNA
CP002027.1	Genbank	sequence_feature	95940	97019	.	+	.	ID=id102;Note=mmyc909%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	96940	98019	.	+	.	ID=id103;Note=mmyc910%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	97263	97346	.	-	.	ID=gene75;Name=MMSYN1_0070;gbkey=Gene;locus_tag=MMSYN1_0070
CP002027.1	Genbank	tRNA	97263	97346	.	-	.	ID=rna5;Parent=gene75;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	exon	97263	97346	.	-	.	ID=id104;Parent=rna5;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	gene	97349	97424	.	-	.	ID=gene76;Name=MMSYN1_0071;gbkey=Gene;locus_tag=MMSYN1_0071
CP002027.1	Genbank	tRNA	97349	97424	.	-	.	ID=rna6;Parent=gene76;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	exon	97349	97424	.	-	.	ID=id105;Parent=rna6;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	gene	97603	99669	.	+	.	ID=gene77;Name=MMSYN1_0072;gbkey=Gene;locus_tag=MMSYN1_0072
CP002027.1	Genbank	CDS	97603	99669	.	+	0	ID=cds68;Parent=gene77;Dbxref=NCBI_GP:ADH22207.1;Name=ADH22207.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22207.1;transl_table=4
CP002027.1	Genbank	sequence_feature	97940	99019	.	+	.	ID=id106;Note=mmyc911%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	98940	100019	.	+	.	ID=id107;Note=mmyc912%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	99702	102434	.	-	.	ID=gene78;Name=MMSYN1_0073;gbkey=Gene;locus_tag=MMSYN1_0073
CP002027.1	Genbank	CDS	99702	102434	.	-	0	ID=cds69;Parent=gene78;Dbxref=NCBI_GP:ADH22118.1;Name=ADH22118.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=phosphonate ABC transporter%2C permease protein PhnE%2C putative;protein_id=ADH22118.1;transl_table=4
CP002027.1	Genbank	sequence_feature	99940	101019	.	+	.	ID=id108;Note=mmyc913%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	100940	102019	.	+	.	ID=id109;Note=mmyc914%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	101940	103019	.	+	.	ID=id110;Note=mmyc915%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	102438	103190	.	-	.	ID=gene79;Name=phnC;gbkey=Gene;gene=phnC;locus_tag=MMSYN1_0074
CP002027.1	Genbank	CDS	102438	103190	.	-	0	ID=cds70;Parent=gene79;Dbxref=NCBI_GP:ADH21561.1;Name=ADH21561.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM TIGR02315;gbkey=CDS;gene=phnC;product=phosphonate ABC transporter%2C ATP-binding protein;protein_id=ADH21561.1;transl_table=4
CP002027.1	Genbank	sequence_feature	102940	104019	.	+	.	ID=id111;Note=mmyc916%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	103204	104574	.	-	.	ID=gene80;Name=MMSYN1_0075;gbkey=Gene;locus_tag=MMSYN1_0075
CP002027.1	Genbank	CDS	103204	104574	.	-	0	ID=cds71;Parent=gene80;Dbxref=NCBI_GP:ADH21836.1;Name=ADH21836.1;gbkey=CDS;product=phosphonate ABC transporter%2C phosphonate-binding protein%2C putative;protein_id=ADH21836.1;transl_table=4
CP002027.1	Genbank	sequence_feature	103940	105019	.	+	.	ID=id112;Note=mmyc917%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	104866	106230	.	-	.	ID=gene81;Name=asnS;gbkey=Gene;gene=asnS;locus_tag=MMSYN1_0076
CP002027.1	Genbank	CDS	104866	106230	.	-	0	ID=cds72;Parent=gene81;Dbxref=NCBI_GP:ADH21550.1;Name=ADH21550.1;Note=identified by match to protein family HMM PF00152%3B match to protein family HMM PF01336%3B match to protein family HMM TIGR00457;gbkey=CDS;gene=asnS;product=asparagine--tRNA ligase;protein_id=ADH21550.1;transl_table=4
CP002027.1	Genbank	sequence_feature	104940	106019	.	+	.	ID=id113;Note=mmyc918%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	105940	107019	.	+	.	ID=id114;Note=mmyc919%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	106239	107078	.	-	.	ID=gene82;Name=MMSYN1_0077;gbkey=Gene;locus_tag=MMSYN1_0077
CP002027.1	Genbank	CDS	106239	107078	.	-	0	ID=cds73;Parent=gene82;Dbxref=NCBI_GP:ADH21720.1;Name=ADH21720.1;Note=identified by match to protein family HMM PF08282;gbkey=CDS;product=putative hydrolase of the HAD family;protein_id=ADH21720.1;transl_table=4
CP002027.1	Genbank	sequence_feature	106940	108019	.	+	.	ID=id115;Note=mmyc920%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	107089	108219	.	-	.	ID=gene83;Name=MMSYN1_0078;gbkey=Gene;locus_tag=MMSYN1_0078
CP002027.1	Genbank	CDS	107089	108219	.	-	0	ID=cds74;Parent=gene83;Dbxref=NCBI_GP:ADH21831.1;Name=ADH21831.1;gbkey=CDS;product=putative hydrolase from alpha/beta family;protein_id=ADH21831.1;transl_table=4
CP002027.1	Genbank	sequence_feature	107940	109019	.	+	.	ID=id116;Note=mmyc921%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	108243	109199	.	-	.	ID=gene84;Name=MMSYN1_0079;gbkey=Gene;locus_tag=MMSYN1_0079
CP002027.1	Genbank	CDS	108243	109199	.	-	0	ID=cds75;Parent=gene84;Dbxref=NCBI_GP:ADH21516.1;Name=ADH21516.1;Note=identified by match to protein family HMM PF00814%3B match to protein family HMM TIGR00329%3B match to protein family HMM TIGR03723;gbkey=CDS;product=probable O-sialoglycoprotein endopeptidase (Glycoprotease);protein_id=ADH21516.1;transl_table=4
CP002027.1	Genbank	sequence_feature	108940	110019	.	+	.	ID=id117;Note=mmyc922%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	109294	109515	.	-	.	ID=gene85;Name=MMSYN1_0080;gbkey=Gene;locus_tag=MMSYN1_0080
CP002027.1	Genbank	CDS	109294	109515	.	-	0	ID=cds76;Parent=gene85;Dbxref=NCBI_GP:ADH21629.1;Name=ADH21629.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21629.1;transl_table=4
CP002027.1	Genbank	gene	109715	111073	.	+	.	ID=gene86;Name=trmE;gbkey=Gene;gene=trmE;locus_tag=MMSYN1_0081
CP002027.1	Genbank	CDS	109715	111073	.	+	0	ID=cds77;Parent=gene86;Dbxref=NCBI_GP:ADH21608.1;Name=ADH21608.1;Note=identified by match to protein family HMM PF01926%3B match to protein family HMM PF08477%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR00450;gbkey=CDS;gene=trmE;product=tRNA modification GTPase TrmE;protein_id=ADH21608.1;transl_table=4
CP002027.1	Genbank	sequence_feature	109940	111019	.	+	.	ID=id118;Note=mmyc923%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=trmE
CP002027.1	Genbank	sequence_feature	110940	112019	.	+	.	ID=id119;Note=mmyc924%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	111124	111369	.	-	.	ID=gene87;Name=rpsT;gbkey=Gene;gene=rpsT;locus_tag=MMSYN1_0082
CP002027.1	Genbank	CDS	111124	111369	.	-	0	ID=cds78;Parent=gene87;Dbxref=NCBI_GP:ADH21548.1;Name=ADH21548.1;Note=identified by match to protein family HMM PF01649%3B match to protein family HMM TIGR00029;gbkey=CDS;gene=rpsT;product=ribosomal protein S20;protein_id=ADH21548.1;transl_table=4
CP002027.1	Genbank	gene	111503	112138	.	-	.	ID=gene88;Name=MMSYN1_0083;gbkey=Gene;locus_tag=MMSYN1_0083
CP002027.1	Genbank	CDS	111503	112138	.	-	0	ID=cds79;Parent=gene88;Dbxref=NCBI_GP:ADH21854.1;Name=ADH21854.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21854.1;transl_table=4
CP002027.1	Genbank	sequence_feature	111940	113019	.	+	.	ID=id120;Note=mmyc925%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	112555	113967	.	-	.	ID=gene89;Name=MMSYN1_0084;gbkey=Gene;locus_tag=MMSYN1_0084
CP002027.1	Genbank	CDS	112555	113967	.	-	0	ID=cds80;Parent=gene89;Dbxref=NCBI_GP:ADH22013.1;Name=ADH22013.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22013.1;transl_table=4
CP002027.1	Genbank	sequence_feature	112940	114019	.	+	.	ID=id121;Note=mmyc926%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	113940	115019	.	+	.	ID=id122;Note=mmyc927%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	114118	116367	.	-	.	ID=gene90;Name=MMSYN1_0085;gbkey=Gene;locus_tag=MMSYN1_0085
CP002027.1	Genbank	CDS	114118	116367	.	-	0	ID=cds81;Parent=gene90;Dbxref=NCBI_GP:ADH22197.1;Name=ADH22197.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22197.1;transl_table=4
CP002027.1	Genbank	sequence_feature	114940	116019	.	+	.	ID=id123;Note=mmyc928%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	115940	117019	.	+	.	ID=id124;Note=mmyc929%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	116412	117539	.	-	.	ID=gene91;Name=MMSYN1_0086;gbkey=Gene;locus_tag=MMSYN1_0086
CP002027.1	Genbank	CDS	116412	117539	.	-	0	ID=cds82;Parent=gene91;Dbxref=NCBI_GP:ADH22159.1;Name=ADH22159.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22159.1;transl_table=4
CP002027.1	Genbank	sequence_feature	116940	118019	.	+	.	ID=id125;Note=mmyc930%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	117940	119019	.	+	.	ID=id126;Note=mmyc931%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	118095	118508	.	-	.	ID=gene92;Name=MMSYN1_0087;gbkey=Gene;locus_tag=MMSYN1_0087
CP002027.1	Genbank	CDS	118095	118508	.	-	0	ID=cds83;Parent=gene92;Dbxref=NCBI_GP:ADH21966.1;Name=ADH21966.1;gbkey=CDS;product=cell wall anchoring protein;protein_id=ADH21966.1;transl_table=4
CP002027.1	Genbank	gene	118767	120617	.	-	.	ID=gene93;Name=MMSYN1_0088;gbkey=Gene;locus_tag=MMSYN1_0088
CP002027.1	Genbank	CDS	118767	120617	.	-	0	ID=cds84;Parent=gene93;Dbxref=NCBI_GP:ADH21668.1;Name=ADH21668.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21668.1;transl_table=4
CP002027.1	Genbank	sequence_feature	118940	120019	.	+	.	ID=id127;Note=mmyc932%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	119940	121019	.	+	.	ID=id128;Note=mmyc933%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	120876	122567	.	-	.	ID=gene94;Name=MMSYN1_0089;gbkey=Gene;locus_tag=MMSYN1_0089
CP002027.1	Genbank	CDS	120876	122567	.	-	0	ID=cds85;Parent=gene94;Dbxref=NCBI_GP:ADH21515.1;Name=ADH21515.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21515.1;transl_table=4
CP002027.1	Genbank	sequence_feature	120940	122019	.	+	.	ID=id129;Note=mmyc934%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	121940	123019	.	+	.	ID=id130;Note=mmyc935%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	122730	123332	.	-	.	ID=gene95;Name=MMSYN1_0923;gbkey=Gene;locus_tag=MMSYN1_0923
CP002027.1	Genbank	CDS	122730	123332	.	-	0	ID=cds86;Parent=gene95;Dbxref=NCBI_GP:ADH21816.1;Name=ADH21816.1;gbkey=CDS;product=lipofamily protein;protein_id=ADH21816.1;transl_table=4
CP002027.1	Genbank	sequence_feature	122940	124019	.	+	.	ID=id131;Note=mmyc940f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	123560	126049	.	-	.	ID=gene96;Name=MMSYN1_0092;gbkey=Gene;locus_tag=MMSYN1_0092
CP002027.1	Genbank	CDS	123560	126049	.	-	0	ID=cds87;Parent=gene96;Dbxref=NCBI_GP:ADH21657.1;Name=ADH21657.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21657.1;transl_table=4
CP002027.1	Genbank	sequence_feature	123940	125019	.	+	.	ID=id132;Note=mmyc941%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	124940	126019	.	+	.	ID=id133;Note=mmyc942%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	125940	127019	.	+	.	ID=id134;Note=mmyc943%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	126220	126990	.	-	.	ID=gene97;Name=MMSYN1_0093;gbkey=Gene;locus_tag=MMSYN1_0093
CP002027.1	Genbank	CDS	126220	126990	.	-	0	ID=cds88;Parent=gene97;Dbxref=NCBI_GP:ADH21803.1;Name=ADH21803.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21803.1;transl_table=4
CP002027.1	Genbank	sequence_feature	126940	128019	.	+	.	ID=id135;Note=mmyc944%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	126974	127690	.	-	.	ID=gene98;Name=MMSYN1_0094;gbkey=Gene;locus_tag=MMSYN1_0094
CP002027.1	Genbank	CDS	126974	127690	.	-	0	ID=cds89;Parent=gene98;Dbxref=NCBI_GP:ADH22256.1;Name=ADH22256.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22256.1;transl_table=4
CP002027.1	Genbank	gene	127805	130639	.	-	.	ID=gene99;Name=secA;gbkey=Gene;gene=secA;locus_tag=MMSYN1_0095
CP002027.1	Genbank	CDS	127805	130639	.	-	0	ID=cds90;Parent=gene99;Dbxref=NCBI_GP:ADH22190.1;Name=ADH22190.1;Note=identified by match to protein family HMM PF00271%3B match to protein family HMM PF01043%3B match to protein family HMM PF07516%3B match to protein family HMM PF07517%3B match to protein family HMM TIGR00963;gbkey=CDS;gene=secA;product=preprotein translocase%2C SecA subunit;protein_id=ADH22190.1;transl_table=4
CP002027.1	Genbank	sequence_feature	127940	129019	.	+	.	ID=id136;Note=mmyc945%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	128940	130019	.	+	.	ID=id137;Note=mmyc946%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	129940	131019	.	+	.	ID=id138;Note=mmyc947%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	130730	131305	.	+	.	ID=gene100;Name=MMSYN1_0096;gbkey=Gene;locus_tag=MMSYN1_0096
CP002027.1	Genbank	CDS	130730	131305	.	+	0	ID=cds91;Parent=gene100;Dbxref=NCBI_GP:ADH21866.1;Name=ADH21866.1;Note=identified by match to protein family HMM PF01205;gbkey=CDS;product=Xaa-Pro dipeptidase;protein_id=ADH21866.1;transl_table=4
CP002027.1	Genbank	sequence_feature	130940	132019	.	+	.	ID=id139;Note=mmyc948%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	131380	132291	.	+	.	ID=gene101;Name=MMSYN1_0097;gbkey=Gene;locus_tag=MMSYN1_0097
CP002027.1	Genbank	CDS	131380	132291	.	+	0	ID=cds92;Parent=gene101;Dbxref=NCBI_GP:ADH21672.1;Name=ADH21672.1;Note=identified by match to protein family HMM PF01367%3B match to protein family HMM PF02739;gbkey=CDS;product=dna polymerase I%2C 5'-3' exonuclease;protein_id=ADH21672.1;transl_table=4
CP002027.1	Genbank	sequence_feature	131940	133019	.	+	.	ID=id140;Note=mmyc949%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	132495	133511	.	+	.	ID=gene102;Name=mmyCVIM1;gbkey=Gene;gene=mmyCVIM1;locus_tag=MMSYN1_0098
CP002027.1	Genbank	CDS	132495	133511	.	+	0	ID=cds93;Parent=gene102;Dbxref=NCBI_GP:ADH22150.1;Name=ADH22150.1;Note=identified by match to protein family HMM PF02086;gbkey=CDS;gene=mmyCVIM1;product=CCATC--recognizing Type II restriction modification system (MmyCVI) adenine DNA methyltransferase subunit 1;protein_id=ADH22150.1;transl_table=4
CP002027.1	Genbank	sequence_feature	132940	134019	.	+	.	ID=id141;Note=mmyc950%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	133501	134418	.	+	.	ID=gene103;Name=mmyCVIM2;gbkey=Gene;gene=mmyCVIM2;locus_tag=MMSYN1_0099
CP002027.1	Genbank	CDS	133501	134418	.	+	0	ID=cds94;Parent=gene103;Dbxref=NCBI_GP:ADH21846.1;Name=ADH21846.1;Note=identified by match to protein family HMM PF02086;gbkey=CDS;gene=mmyCVIM2;product=CCATC--recognizing Type II restriction modification system (MmyCVI) adenine DNA methyltransferase subunit 2;protein_id=ADH21846.1;transl_table=4
CP002027.1	Genbank	sequence_feature	133940	135019	.	+	.	ID=id142;Note=mmyc951%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	134396	135979	.	+	.	ID=gene104;Name=mmyCVIR;gbkey=Gene;gene=mmyCVIR;locus_tag=MMSYN1_0100
CP002027.1	Genbank	CDS	134396	135979	.	+	0	ID=cds95;Parent=gene104;Dbxref=NCBI_GP:ADH21918.1;Name=ADH21918.1;Note=identified by match to protein family HMM PF09491;gbkey=CDS;gene=mmyCVIR;product=CCATC--recognizing Type II restriction modification system (MmyCVI) endonuclease subunit;protein_id=ADH21918.1;transl_table=4
CP002027.1	Genbank	sequence_feature	134940	136019	.	+	.	ID=id143;Note=mmyc952%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	135940	137019	.	+	.	ID=id144;Note=mmyc953%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	136419	137714	.	+	.	ID=gene105;Name=MMSYN1_0101;gbkey=Gene;locus_tag=MMSYN1_0101
CP002027.1	Genbank	CDS	136419	137714	.	+	0	ID=cds96;Parent=gene105;Dbxref=NCBI_GP:ADH22230.1;Name=ADH22230.1;gbkey=CDS;product=ATPase;protein_id=ADH22230.1;transl_table=4
CP002027.1	Genbank	sequence_feature	136940	138019	.	+	.	ID=id145;Note=mmyc954%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	137940	139019	.	+	.	ID=id146;Note=mmyc955%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	138374	138649	.	+	.	ID=gene106;Name=MMSYN1_0102;gbkey=Gene;locus_tag=MMSYN1_0102
CP002027.1	Genbank	CDS	138374	138649	.	+	0	ID=cds97;Parent=gene106;Dbxref=NCBI_GP:ADH21525.1;Name=ADH21525.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21525.1;transl_table=4
CP002027.1	Genbank	gene	138651	139208	.	+	.	ID=gene107;Name=coaE;gbkey=Gene;gene=coaE;locus_tag=MMSYN1_0103
CP002027.1	Genbank	CDS	138651	139208	.	+	0	ID=cds98;Parent=gene107;Dbxref=NCBI_GP:ADH22063.1;Name=ADH22063.1;Note=identified by match to protein family HMM PF01121%3B match to protein family HMM TIGR00152;gbkey=CDS;gene=coaE;product=dephospho-CoA kinase;protein_id=ADH22063.1;transl_table=4
CP002027.1	Genbank	sequence_feature	138940	140019	.	+	.	ID=id147;Note=mmyc956%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	139210	140016	.	-	.	ID=gene108;Name=rrmJ;gbkey=Gene;gene=rrmJ;locus_tag=MMSYN1_0104
CP002027.1	Genbank	CDS	139210	140016	.	-	0	ID=cds99;Parent=gene108;Dbxref=NCBI_GP:ADH22193.1;Name=ADH22193.1;Note=identified by match to protein family HMM PF01479%3B match to protein family HMM PF01728;gbkey=CDS;gene=rrmJ;product=ribosomal RNA large subunit methyltransferase J;protein_id=ADH22193.1;transl_table=4
CP002027.1	Genbank	sequence_feature	139940	141019	.	+	.	ID=id148;Note=mmyc957%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	140016	140231	.	-	.	ID=gene109;Name=MMSYN1_0105;gbkey=Gene;locus_tag=MMSYN1_0105
CP002027.1	Genbank	CDS	140016	140231	.	-	0	ID=cds100;Parent=gene109;Dbxref=NCBI_GP:ADH21755.1;Name=ADH21755.1;gbkey=CDS;product=conserved domain protein;protein_id=ADH21755.1;transl_table=4
CP002027.1	Genbank	gene	140221	141630	.	-	.	ID=gene110;Name=xseA;gbkey=Gene;gene=xseA;locus_tag=MMSYN1_0106
CP002027.1	Genbank	CDS	140221	141630	.	-	0	ID=cds101;Parent=gene110;Dbxref=NCBI_GP:ADH22035.1;Name=ADH22035.1;Note=identified by match to protein family HMM PF01336%3B match to protein family HMM PF02601%3B match to protein family HMM TIGR00237;gbkey=CDS;gene=xseA;product=exodeoxyribonuclease VII%2C large subunit;protein_id=ADH22035.1;transl_table=4
CP002027.1	Genbank	sequence_feature	140940	142019	.	+	.	ID=id149;Note=mmyc958%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	141632	142030	.	-	.	ID=gene111;Name=nusB;gbkey=Gene;gene=nusB;locus_tag=MMSYN1_0107
CP002027.1	Genbank	CDS	141632	142030	.	-	0	ID=cds102;Parent=gene111;Dbxref=NCBI_GP:ADH21460.1;Name=ADH21460.1;Note=identified by match to protein family HMM PF01029%3B match to protein family HMM TIGR01951;gbkey=CDS;gene=nusB;product=transcription antitermination factor NusB;protein_id=ADH21460.1;transl_table=4
CP002027.1	Genbank	sequence_feature	141940	143019	.	+	.	ID=id150;Note=mmyc959%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	142042	143154	.	-	.	ID=gene112;Name=MMSYN1_0108;gbkey=Gene;locus_tag=MMSYN1_0108
CP002027.1	Genbank	CDS	142042	143154	.	-	0	ID=cds103;Parent=gene112;Dbxref=NCBI_GP:ADH22062.1;Name=ADH22062.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22062.1;transl_table=4
CP002027.1	Genbank	sequence_feature	142940	144019	.	+	.	ID=id151;Note=mmyc960%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	143180	144049	.	-	.	ID=gene113;Name=MMSYN1_0109;gbkey=Gene;locus_tag=MMSYN1_0109
CP002027.1	Genbank	CDS	143180	144049	.	-	0	ID=cds104;Parent=gene113;Dbxref=NCBI_GP:ADH21596.1;Name=ADH21596.1;Note=identified by match to protein family HMM PF01261%3B match to protein family HMM TIGR00587;gbkey=CDS;product=apurinic endonuclease Apn1;protein_id=ADH21596.1;transl_table=4
CP002027.1	Genbank	sequence_feature	143940	145019	.	+	.	ID=id152;Note=mmyc961%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	144042	144794	.	-	.	ID=gene114;Name=MMSYN1_0110;gbkey=Gene;locus_tag=MMSYN1_0110
CP002027.1	Genbank	CDS	144042	144794	.	-	0	ID=cds105;Parent=gene114;Dbxref=NCBI_GP:ADH21492.1;Name=ADH21492.1;Note=identified by match to protein family HMM PF01687;gbkey=CDS;product=riboflavin kinase;protein_id=ADH21492.1;transl_table=4
CP002027.1	Genbank	gene	144869	144944	.	-	.	ID=gene115;Name=MMSYN1_0111;gbkey=Gene;locus_tag=MMSYN1_0111
CP002027.1	Genbank	tRNA	144869	144944	.	-	.	ID=rna7;Parent=gene115;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	exon	144869	144944	.	-	.	ID=id153;Parent=rna7;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	sequence_feature	144940	146019	.	+	.	ID=id154;Note=mmyc962%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	145008	147287	.	-	.	ID=gene116;Name=MMSYN1_0112;gbkey=Gene;locus_tag=MMSYN1_0112
CP002027.1	Genbank	CDS	145008	147287	.	-	0	ID=cds106;Parent=gene116;Dbxref=NCBI_GP:ADH21665.1;Name=ADH21665.1;Note=identified by match to protein family HMM PF03572;gbkey=CDS;product=peptidase%2C S41 family;protein_id=ADH21665.1;transl_table=4
CP002027.1	Genbank	sequence_feature	145940	147019	.	+	.	ID=id155;Note=mmyc963%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	146940	148019	.	+	.	ID=id156;Note=mmyc964%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	147625	148869	.	+	.	ID=gene117;Name=MMSYN1_0113;gbkey=Gene;locus_tag=MMSYN1_0113
CP002027.1	Genbank	CDS	147625	148869	.	+	0	ID=cds107;Parent=gene117;Dbxref=NCBI_GP:ADH21956.1;Name=ADH21956.1;Note=identified by match to protein family HMM PF00535;gbkey=CDS;product=glycosyltransferase;protein_id=ADH21956.1;transl_table=4
CP002027.1	Genbank	sequence_feature	147940	149019	.	+	.	ID=id157;Note=mmyc965%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	148940	150019	.	+	.	ID=id158;Note=mmyc966%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	148943	149863	.	-	.	ID=gene118;Name=MMSYN1_0114;gbkey=Gene;locus_tag=MMSYN1_0114
CP002027.1	Genbank	CDS	148943	149863	.	-	0	ID=cds108;Parent=gene118;Dbxref=NCBI_GP:ADH21478.1;Name=ADH21478.1;gbkey=CDS;product=glycosyltransferase;protein_id=ADH21478.1;transl_table=4
CP002027.1	Genbank	sequence_feature	149940	151019	.	+	.	ID=id159;Note=mmyc967%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	150311	151183	.	-	.	ID=gene119;Name=MMSYN1_0115;gbkey=Gene;locus_tag=MMSYN1_0115
CP002027.1	Genbank	CDS	150311	151183	.	-	0	ID=cds109;Parent=gene119;Dbxref=NCBI_GP:ADH21811.1;Name=ADH21811.1;Note=identified by match to protein family HMM PF00483;gbkey=CDS;product=utp--glucose-1-phosphate uridylyltransferase (udp-glucosepyrophosphorylase) (udpgp) (alpha-d-glucosyl-1-phosphateuridylyltransferase) (uridine diphosphoglucose pyrophosphorylase)(general stress protein 33) (Gsp33);protein_id=ADH21811.1;transl_table=4
CP002027.1	Genbank	sequence_feature	150940	152019	.	+	.	ID=id160;Note=mmyc968%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	151368	151808	.	-	.	ID=gene120;Name=MMSYN1_0116;gbkey=Gene;locus_tag=MMSYN1_0116
CP002027.1	Genbank	CDS	151368	151808	.	-	0	ID=cds110;Parent=gene120;Dbxref=NCBI_GP:ADH22117.1;Name=ADH22117.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22117.1;transl_table=4
CP002027.1	Genbank	gene	151878	152639	.	+	.	ID=gene121;Name=plsY;gbkey=Gene;gene=plsY;locus_tag=MMSYN1_0117
CP002027.1	Genbank	CDS	151878	152639	.	+	0	ID=cds111;Parent=gene121;Dbxref=NCBI_GP:ADH21597.1;Name=ADH21597.1;Note=identified by match to protein family HMM PF02660%3B match to protein family HMM TIGR00023;gbkey=CDS;gene=plsY;product=acyl-phosphate glycerol 3-phosphate acyltransferase;protein_id=ADH21597.1;transl_table=4
CP002027.1	Genbank	sequence_feature	151940	153019	.	+	.	ID=id161;Note=mmyc969%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	152703	154241	.	+	.	ID=gene122;Name=MMSYN1_0118;gbkey=Gene;locus_tag=MMSYN1_0118
CP002027.1	Genbank	CDS	152703	154241	.	+	0	ID=cds112;Parent=gene122;Dbxref=NCBI_GP:ADH21967.1;Name=ADH21967.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=ABC transporter%2C ATP-binding protein;protein_id=ADH21967.1;transl_table=4
CP002027.1	Genbank	sequence_feature	152940	154019	.	+	.	ID=id162;Note=mmyc970%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	153940	155019	.	+	.	ID=id163;Note=mmyc971%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	154271	155068	.	-	.	ID=gene123;Name=MMSYN1_0119;gbkey=Gene;locus_tag=MMSYN1_0119
CP002027.1	Genbank	CDS	154271	155068	.	-	0	ID=cds113;Parent=gene123;Dbxref=NCBI_GP:ADH21694.1;Name=ADH21694.1;Note=identified by match to protein family HMM PF01026;gbkey=CDS;product=hydrolase%2C TatD family;protein_id=ADH21694.1;transl_table=4
CP002027.1	Genbank	sequence_feature	154940	156019	.	+	.	ID=id164;Note=mmyc972%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	155264	156490	.	+	.	ID=gene124;Name=ilvA;gbkey=Gene;gene=ilvA;locus_tag=MMSYN1_0120
CP002027.1	Genbank	CDS	155264	156490	.	+	0	ID=cds114;Parent=gene124;Dbxref=NCBI_GP:ADH21568.1;Name=ADH21568.1;Note=identified by match to protein family HMM PF00291%3B match to protein family HMM TIGR01127;gbkey=CDS;gene=ilvA;product=threonine ammonia-lyase;protein_id=ADH21568.1;transl_table=4
CP002027.1	Genbank	sequence_feature	155940	157019	.	+	.	ID=id165;Note=mmyc973%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	156705	158285	.	+	.	ID=gene125;Name=MMSYN1_0121;gbkey=Gene;locus_tag=MMSYN1_0121
CP002027.1	Genbank	CDS	156705	158285	.	+	0	ID=cds115;Parent=gene125;Dbxref=NCBI_GP:ADH22186.1;Name=ADH22186.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22186.1;transl_table=4
CP002027.1	Genbank	sequence_feature	156940	158019	.	+	.	ID=id166;Note=mmyc974%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	157940	159019	.	+	.	ID=id167;Note=mmyc975%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	158297	159157	.	+	.	ID=gene126;Name=MMSYN1_0122;gbkey=Gene;locus_tag=MMSYN1_0122
CP002027.1	Genbank	CDS	158297	159157	.	+	0	ID=cds116;Parent=gene126;Dbxref=NCBI_GP:ADH22181.1;Name=ADH22181.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22181.1;transl_table=4
CP002027.1	Genbank	sequence_feature	158940	160019	.	+	.	ID=id168;Note=mmyc976%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	159440	160150	.	+	.	ID=gene127;Name=vlcD;gbkey=Gene;gene=vlcD;locus_tag=MMSYN1_0123
CP002027.1	Genbank	CDS	159440	160150	.	+	0	ID=cds117;Parent=gene127;Dbxref=NCBI_GP:ADH22060.1;Name=ADH22060.1;gbkey=CDS;gene=vlcD;product=lipoprotein%2C putative (VlcD);protein_id=ADH22060.1;transl_table=4
CP002027.1	Genbank	sequence_feature	159940	161019	.	+	.	ID=id169;Note=mmyc977%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	160552	161883	.	+	.	ID=gene128;Name=MMSYN1_0124;gbkey=Gene;locus_tag=MMSYN1_0124
CP002027.1	Genbank	CDS	160552	161883	.	+	0	ID=cds118;Parent=gene128;Dbxref=NCBI_GP:ADH21948.1;Name=ADH21948.1;Note=identified by match to protein family HMM PF07672%3B match to protein family HMM PF07690;gbkey=CDS;product=hexosephosphate transport protein;protein_id=ADH21948.1;transl_table=4
CP002027.1	Genbank	sequence_feature	160940	162019	.	+	.	ID=id170;Note=mmyc978%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	161940	163019	.	+	.	ID=id171;Note=mmyc979%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	162231	163934	.	+	.	ID=gene129;Name=MMSYN1_0125;gbkey=Gene;locus_tag=MMSYN1_0125
CP002027.1	Genbank	CDS	162231	163934	.	+	0	ID=cds119;Parent=gene129;Dbxref=NCBI_GP:ADH21868.1;Name=ADH21868.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system%2C N-acetylglucosamine-specific iibc component;protein_id=ADH21868.1;transl_table=4
CP002027.1	Genbank	sequence_feature	162940	164019	.	+	.	ID=id172;Note=mmyc980%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	163940	165019	.	+	.	ID=id173;Note=mmyc981%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	164067	165518	.	+	.	ID=gene130;Name=gltX;gbkey=Gene;gene=gltX;locus_tag=MMSYN1_0126
CP002027.1	Genbank	CDS	164067	165518	.	+	0	ID=cds120;Parent=gene130;Dbxref=NCBI_GP:ADH21585.1;Name=ADH21585.1;Note=identified by match to protein family HMM PF00749%3B match to protein family HMM TIGR00464;gbkey=CDS;gene=gltX;product=glutamate--tRNA ligase;protein_id=ADH21585.1;transl_table=4
CP002027.1	Genbank	sequence_feature	164940	166019	.	+	.	ID=id174;Note=mmyc982%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	165521	166735	.	+	.	ID=gene131;Name=MMSYN1_0127;gbkey=Gene;locus_tag=MMSYN1_0127
CP002027.1	Genbank	CDS	165521	166735	.	+	0	ID=cds121;Parent=gene131;Dbxref=NCBI_GP:ADH21455.1;Name=ADH21455.1;Note=identified by match to protein family HMM PF01966;gbkey=CDS;product=HD domain protein;protein_id=ADH21455.1;transl_table=4
CP002027.1	Genbank	sequence_feature	165940	167019	.	+	.	ID=id175;Note=mmyc983%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	166761	167189	.	+	.	ID=gene132;Name=MMSYN1_0128;gbkey=Gene;locus_tag=MMSYN1_0128
CP002027.1	Genbank	CDS	166761	167189	.	+	0	ID=cds122;Parent=gene132;Dbxref=NCBI_GP:ADH22179.1;Name=ADH22179.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22179.1;transl_table=4
CP002027.1	Genbank	sequence_feature	166940	168019	.	+	.	ID=id176;Note=mmyc984%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	167281	168879	.	+	.	ID=gene133;Name=pyrG;gbkey=Gene;gene=pyrG;locus_tag=MMSYN1_0129
CP002027.1	Genbank	CDS	167281	168879	.	+	0	ID=cds123;Parent=gene133;Dbxref=NCBI_GP:ADH21669.1;Name=ADH21669.1;Note=identified by match to protein family HMM PF00117%3B match to protein family HMM PF06418%3B match to protein family HMM TIGR00337;gbkey=CDS;gene=pyrG;product=CTP synthase;protein_id=ADH21669.1;transl_table=4
CP002027.1	Genbank	sequence_feature	167940	169019	.	+	.	ID=id177;Note=mmyc985%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	168940	170019	.	+	.	ID=id178;Note=mmyc986%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	169010	169984	.	+	.	ID=gene134;Name=MMSYN1_0130;gbkey=Gene;locus_tag=MMSYN1_0130
CP002027.1	Genbank	CDS	169010	169984	.	+	0	ID=cds124;Parent=gene134;Dbxref=NCBI_GP:ADH21729.1;Name=ADH21729.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21729.1;transl_table=4
CP002027.1	Genbank	sequence_feature	169940	171019	.	+	.	ID=id179;Note=mmyc987%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	170143	171036	.	+	.	ID=gene135;Name=fba;gbkey=Gene;gene=fba;locus_tag=MMSYN1_0131
CP002027.1	Genbank	CDS	170143	171036	.	+	0	ID=cds125;Parent=gene135;Dbxref=NCBI_GP:ADH21897.1;Name=ADH21897.1;Note=identified by match to protein family HMM PF01116%3B match to protein family HMM TIGR00167%3B match to protein family HMM TIGR01859;gbkey=CDS;gene=fba;product=fructose-1%2C6-bisphosphate aldolase%2C class II;protein_id=ADH21897.1;transl_table=4
CP002027.1	Genbank	sequence_feature	170940	172019	.	+	.	ID=id180;Note=mmyc988%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	171185	172246	.	+	.	ID=gene136;Name=MMSYN1_0132;gbkey=Gene;locus_tag=MMSYN1_0132
CP002027.1	Genbank	CDS	171185	172246	.	+	0	ID=cds126;Parent=gene136;Dbxref=NCBI_GP:ADH21881.1;Name=ADH21881.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM PF07728;gbkey=CDS;product=AAA family ATPase;protein_id=ADH21881.1;transl_table=4
CP002027.1	Genbank	sequence_feature	171940	173019	.	+	.	ID=id181;Note=mmyc989%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	172239	174512	.	+	.	ID=gene137;Name=MMSYN1_0133;gbkey=Gene;locus_tag=MMSYN1_0133
CP002027.1	Genbank	CDS	172239	174512	.	+	0	ID=cds127;Parent=gene137;Dbxref=NCBI_GP:ADH22191.1;Name=ADH22191.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22191.1;transl_table=4
CP002027.1	Genbank	sequence_feature	172940	174019	.	+	.	ID=id182;Note=mmyc990%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	173940	175019	.	+	.	ID=id183;Note=mmyc991%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	174619	176106	.	-	.	ID=gene138;Name=MMSYN1_0134;gbkey=Gene;locus_tag=MMSYN1_0134
CP002027.1	Genbank	CDS	174619	176106	.	-	0	ID=cds128;Parent=gene138;Dbxref=NCBI_GP:ADH22137.1;Name=ADH22137.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22137.1;transl_table=4
CP002027.1	Genbank	sequence_feature	174940	176019	.	+	.	ID=id184;Note=mmyc992%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	175940	177019	.	+	.	ID=id185;Note=mmyc993%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	176449	176562	.	-	.	ID=gene139;Name=MMSYN1_0135;gbkey=Gene;locus_tag=MMSYN1_0135
CP002027.1	Genbank	CDS	176449	176562	.	-	0	ID=cds129;Parent=gene139;Dbxref=NCBI_GP:ADH21638.1;Name=ADH21638.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21638.1;transl_table=4
CP002027.1	Genbank	gene	176702	177406	.	+	.	ID=gene140;Name=MMSYN1_0136;gbkey=Gene;locus_tag=MMSYN1_0136
CP002027.1	Genbank	CDS	176702	177406	.	+	0	ID=cds130;Parent=gene140;Dbxref=NCBI_GP:ADH21576.1;Name=ADH21576.1;Note=identified by match to protein family HMM PF03009;gbkey=CDS;product=glycerophosphodiester phosphodiesterase;protein_id=ADH21576.1;transl_table=4
CP002027.1	Genbank	sequence_feature	176940	178019	.	+	.	ID=id186;Note=mmyc994%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	177566	177844	.	+	.	ID=gene141;Name=rpmE;gbkey=Gene;gene=rpmE;locus_tag=MMSYN1_0137
CP002027.1	Genbank	CDS	177566	177844	.	+	0	ID=cds131;Parent=gene141;Dbxref=NCBI_GP:ADH21485.1;Name=ADH21485.1;Note=identified by match to protein family HMM PF01197%3B match to protein family HMM TIGR00105;gbkey=CDS;gene=rpmE;product=ribosomal protein L31;protein_id=ADH21485.1;transl_table=4
CP002027.1	Genbank	gene	177917	179815	.	+	.	ID=gene142;Name=MMSYN1_0138;gbkey=Gene;locus_tag=MMSYN1_0138
CP002027.1	Genbank	CDS	177917	179815	.	+	0	ID=cds132;Parent=gene142;Dbxref=NCBI_GP:ADH21990.1;Name=ADH21990.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21990.1;transl_table=4
CP002027.1	Genbank	sequence_feature	177940	179019	.	+	.	ID=id187;Note=mmyc995%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	178940	180019	.	+	.	ID=id188;Note=mmyc996%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	179825	180775	.	+	.	ID=gene143;Name=MMSYN1_0139;gbkey=Gene;locus_tag=MMSYN1_0139
CP002027.1	Genbank	CDS	179825	180775	.	+	0	ID=cds133;Parent=gene143;Dbxref=NCBI_GP:ADH21817.1;Name=ADH21817.1;Note=identified by match to protein family HMM PF01368%3B match to protein family HMM PF02272;gbkey=CDS;product=DHH family protein;protein_id=ADH21817.1;transl_table=4
CP002027.1	Genbank	sequence_feature	179940	181019	.	+	.	ID=id189;Note=mmyc997%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	180777	181406	.	+	.	ID=gene144;Name=tdk;gbkey=Gene;gene=tdk;locus_tag=MMSYN1_0140
CP002027.1	Genbank	CDS	180777	181406	.	+	0	ID=cds134;Parent=gene144;Dbxref=NCBI_GP:ADH21549.1;Name=ADH21549.1;Note=identified by match to protein family HMM PF00265;gbkey=CDS;gene=tdk;product=thymidine kinase;protein_id=ADH21549.1;transl_table=4
CP002027.1	Genbank	sequence_feature	180940	182019	.	+	.	ID=id190;Note=mmyc998%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	181409	182503	.	+	.	ID=gene145;Name=prfA;gbkey=Gene;gene=prfA;locus_tag=MMSYN1_0141
CP002027.1	Genbank	CDS	181409	182503	.	+	0	ID=cds135;Parent=gene145;Dbxref=NCBI_GP:ADH21615.1;Name=ADH21615.1;Note=identified by match to protein family HMM PF00472%3B match to protein family HMM PF03462%3B match to protein family HMM TIGR00019;gbkey=CDS;gene=prfA;product=peptide chain release factor 1;protein_id=ADH21615.1;transl_table=4
CP002027.1	Genbank	sequence_feature	181940	183019	.	+	.	ID=id191;Note=mmyc999%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	182496	183344	.	+	.	ID=gene146;Name=prmC;gbkey=Gene;gene=prmC;locus_tag=MMSYN1_0142
CP002027.1	Genbank	CDS	182496	183344	.	+	0	ID=cds136;Parent=gene146;Dbxref=NCBI_GP:ADH21486.1;Name=ADH21486.1;Note=identified by match to protein family HMM PF05175%3B match to protein family HMM TIGR00536%3B match to protein family HMM TIGR03534;gbkey=CDS;gene=prmC;product=protein-(glutamine-N5) methyltransferase%2C release factor-specific;protein_id=ADH21486.1;transl_table=4
CP002027.1	Genbank	sequence_feature	182940	184019	.	+	.	ID=id192;Note=mmyc1000%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	183353	184825	.	+	.	ID=gene147;Name=MMSYN1_0143;gbkey=Gene;locus_tag=MMSYN1_0143
CP002027.1	Genbank	CDS	183353	184825	.	+	0	ID=cds137;Parent=gene147;Dbxref=NCBI_GP:ADH21748.1;Name=ADH21748.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21748.1;transl_table=4
CP002027.1	Genbank	sequence_feature	183940	185019	.	+	.	ID=id193;Note=mmyc1001%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	184834	185334	.	+	.	ID=gene148;Name=MMSYN1_0144;gbkey=Gene;locus_tag=MMSYN1_0144
CP002027.1	Genbank	CDS	184834	185334	.	+	0	ID=cds138;Parent=gene148;Dbxref=NCBI_GP:ADH22108.1;Name=ADH22108.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22108.1;transl_table=4
CP002027.1	Genbank	sequence_feature	184940	186019	.	+	.	ID=id194;Note=mmyc1002%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	185449	186363	.	+	.	ID=gene149;Name=MMSYN1_0145;gbkey=Gene;locus_tag=MMSYN1_0145
CP002027.1	Genbank	CDS	185449	186363	.	+	0	ID=cds139;Parent=gene149;Dbxref=NCBI_GP:ADH21511.1;Name=ADH21511.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21511.1;transl_table=4
CP002027.1	Genbank	sequence_feature	185940	187019	.	+	.	ID=id195;Note=mmyc1003%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	186592	187299	.	+	.	ID=gene150;Name=MMSYN1_0146;gbkey=Gene;locus_tag=MMSYN1_0146
CP002027.1	Genbank	CDS	186592	187299	.	+	0	ID=cds140;Parent=gene150;Dbxref=NCBI_GP:ADH21893.1;Name=ADH21893.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21893.1;transl_table=4
CP002027.1	Genbank	sequence_feature	186940	188019	.	+	.	ID=id196;Note=mmyc1004%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	187299	188828	.	+	.	ID=gene151;Name=MMSYN1_0147;gbkey=Gene;locus_tag=MMSYN1_0147
CP002027.1	Genbank	CDS	187299	188828	.	+	0	ID=cds141;Parent=gene151;Dbxref=NCBI_GP:ADH22135.1;Name=ADH22135.1;Note=identified by match to protein family HMM PF00614;gbkey=CDS;product=cardiolipin synthetase;protein_id=ADH22135.1;transl_table=4
CP002027.1	Genbank	sequence_feature	187940	189019	.	+	.	ID=id197;Note=mmyc1005%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	188940	190019	.	+	.	ID=id198;Note=mmyc1006%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	188952	189371	.	+	.	ID=gene152;Name=rpsL;gbkey=Gene;gene=rpsL;locus_tag=MMSYN1_0148
CP002027.1	Genbank	CDS	188952	189371	.	+	0	ID=cds142;Parent=gene152;Dbxref=NCBI_GP:ADH21704.1;Name=ADH21704.1;Note=identified by match to protein family HMM PF00164%3B match to protein family HMM TIGR00981;gbkey=CDS;gene=rpsL;product=ribosomal protein S12;protein_id=ADH21704.1;transl_table=4
CP002027.1	Genbank	gene	189458	189925	.	+	.	ID=gene153;Name=rpsG;gbkey=Gene;gene=rpsG;locus_tag=MMSYN1_0149
CP002027.1	Genbank	CDS	189458	189925	.	+	0	ID=cds143;Parent=gene153;Dbxref=NCBI_GP:ADH22165.1;Name=ADH22165.1;Note=identified by match to protein family HMM PF00177%3B match to protein family HMM TIGR01029;gbkey=CDS;gene=rpsG;product=ribosomal protein S7;protein_id=ADH22165.1;transl_table=4
CP002027.1	Genbank	sequence_difference	189893	189893	.	+	.	ID=id199;Note=SNP%3B G (JCVI-syn1) -> C (sMmYCp235-1)%2C Ala (JCVI-syn1) -> Pro (sMmYCp235-1)%2C CDS: rpsG;gbkey=misc_difference;gene=rpsG;replace=g
CP002027.1	Genbank	sequence_feature	189940	191019	.	+	.	ID=id200;Note=mmyc1007%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	189950	192019	.	+	.	ID=gene154;Name=fusA;gbkey=Gene;gene=fusA;locus_tag=MMSYN1_0150
CP002027.1	Genbank	CDS	189950	192019	.	+	0	ID=cds144;Parent=gene154;Dbxref=NCBI_GP:ADH21589.1;Name=ADH21589.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF00679%3B match to protein family HMM PF03144%3B match to protein family HMM PF03764%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR00484;gbkey=CDS;gene=fusA;product=translation elongation factor G;protein_id=ADH21589.1;transl_table=4
CP002027.1	Genbank	sequence_feature	190940	192019	.	+	.	ID=id201;Note=mmyc1008%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=fusA
CP002027.1	Genbank	sequence_feature	191940	193019	.	+	.	ID=id202;Note=mmyc1009%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	192151	193338	.	+	.	ID=gene155;Name=tuf;gbkey=Gene;gene=tuf;locus_tag=MMSYN1_0151
CP002027.1	Genbank	CDS	192151	193338	.	+	0	ID=cds145;Parent=gene155;Dbxref=NCBI_GP:ADH21526.1;Name=ADH21526.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF03143%3B match to protein family HMM PF03144%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR00485;gbkey=CDS;gene=tuf;product=translation elongation factor Tu;protein_id=ADH21526.1;transl_table=4
CP002027.1	Genbank	sequence_feature	192940	194019	.	+	.	ID=id203;Note=mmyc1010%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	193471	195336	.	+	.	ID=gene156;Name=MMSYN1_0152;gbkey=Gene;locus_tag=MMSYN1_0152
CP002027.1	Genbank	CDS	193471	195336	.	+	0	ID=cds146;Parent=gene156;Dbxref=NCBI_GP:ADH21894.1;Name=ADH21894.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system glucose-specific eiic ba component;protein_id=ADH21894.1;transl_table=4
CP002027.1	Genbank	sequence_feature	193940	195019	.	+	.	ID=id204;Note=mmyc1011f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	194940	196019	.	+	.	ID=id205;Note=mmyc1012%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	195320	197590	.	+	.	ID=gene157;Name=MMSYN1_0153;gbkey=Gene;locus_tag=MMSYN1_0153
CP002027.1	Genbank	CDS	195320	197590	.	+	0	ID=cds147;Parent=gene157;Dbxref=NCBI_GP:ADH22171.1;Name=ADH22171.1;Note=identified by match to protein family HMM PF01055;gbkey=CDS;product=glycosyl hydrolase%2C family 31;protein_id=ADH22171.1;transl_table=4
CP002027.1	Genbank	sequence_feature	195940	197019	.	+	.	ID=id206;Note=mmyc1013%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	196940	198019	.	+	.	ID=id207;Note=mmyc1014%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	197743	199098	.	+	.	ID=gene158;Name=lap;gbkey=Gene;gene=lap;locus_tag=MMSYN1_0154
CP002027.1	Genbank	CDS	197743	199098	.	+	0	ID=cds148;Parent=gene158;Dbxref=NCBI_GP:ADH21839.1;Name=ADH21839.1;Note=identified by match to protein family HMM PF00883;gbkey=CDS;gene=lap;product=leucyl aminopeptidase;protein_id=ADH21839.1;transl_table=4
CP002027.1	Genbank	sequence_feature	197940	199019	.	+	.	ID=id208;Note=mmyc1015%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lap
CP002027.1	Genbank	sequence_feature	198940	200019	.	+	.	ID=id209;Note=mmyc1016%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	199940	201019	.	+	.	ID=id210;Note=mmyc1017%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	200904	201506	.	+	.	ID=gene159;Name=MMSYN1_0155;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0155;pseudo=true
CP002027.1	Genbank	sequence_feature	200940	202019	.	+	.	ID=id211;Note=mmyc1018%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	201664	202329	.	-	.	ID=gene160;Name=trmB;gbkey=Gene;gene=trmB;locus_tag=MMSYN1_0156
CP002027.1	Genbank	CDS	201664	202329	.	-	0	ID=cds149;Parent=gene160;Dbxref=NCBI_GP:ADH21463.1;Name=ADH21463.1;Note=identified by match to protein family HMM PF02390%3B match to protein family HMM TIGR00091;gbkey=CDS;gene=trmB;product=tRNA (guanine-N(7)-)-methyltransferase;protein_id=ADH21463.1;transl_table=4
CP002027.1	Genbank	sequence_feature	201940	203019	.	+	.	ID=id212;Note=mmyc1019%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	202331	203734	.	-	.	ID=gene161;Name=mgtE;gbkey=Gene;gene=mgtE;locus_tag=MMSYN1_0157
CP002027.1	Genbank	CDS	202331	203734	.	-	0	ID=cds150;Parent=gene161;Dbxref=NCBI_GP:ADH21779.1;Name=ADH21779.1;Note=identified by match to protein family HMM PF00571%3B match to protein family HMM PF03448%3B match to protein family HMM TIGR00400;gbkey=CDS;gene=mgtE;product=magnesium transporter;protein_id=ADH21779.1;transl_table=4
CP002027.1	Genbank	sequence_feature	202940	204019	.	+	.	ID=id213;Note=mmyc1020%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	203879	204289	.	+	.	ID=gene162;Name=ssrA;gbkey=Gene;gene=ssrA;locus_tag=MMSYN1_0158
CP002027.1	Genbank	tmRNA	203879	204289	.	+	.	ID=rna8;Parent=gene162;gbkey=tmRNA;gene=ssrA
CP002027.1	Genbank	exon	203879	204289	.	+	.	ID=id214;Parent=rna8;gbkey=tmRNA;gene=ssrA
CP002027.1	Genbank	sequence_feature	203940	205019	.	+	.	ID=id215;Note=mmyc1021%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	204414	206543	.	+	.	ID=gene163;Name=MMSYN1_0159;gbkey=Gene;locus_tag=MMSYN1_0159
CP002027.1	Genbank	CDS	204414	206543	.	+	0	ID=cds151;Parent=gene163;Dbxref=NCBI_GP:ADH22262.1;Name=ADH22262.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22262.1;transl_table=4
CP002027.1	Genbank	sequence_feature	204940	206019	.	+	.	ID=id216;Note=mmyc1022%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	205940	207019	.	+	.	ID=id217;Note=mmyc1023%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	206563	207315	.	-	.	ID=gene164;Name=abiGIA;gbkey=Gene;gene=abiGIA;locus_tag=MMSYN1_0160
CP002027.1	Genbank	CDS	206563	207315	.	-	0	ID=cds152;Parent=gene164;Dbxref=NCBI_GP:ADH22098.1;Name=ADH22098.1;Note=identified by match to protein family HMM PF08843;gbkey=CDS;gene=abiGIA;product=abortive infection protein AbiGII;protein_id=ADH22098.1;transl_table=4
CP002027.1	Genbank	sequence_feature	206940	208019	.	+	.	ID=id218;Note=mmyc1024%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	207402	207998	.	-	.	ID=gene165;Name=abiGIB;gbkey=Gene;gene=abiGIB;locus_tag=MMSYN1_0161
CP002027.1	Genbank	CDS	207402	207998	.	-	0	ID=cds153;Parent=gene165;Dbxref=NCBI_GP:ADH21975.1;Name=ADH21975.1;gbkey=CDS;gene=abiGIB;product=abortive infection protein AbiGI;protein_id=ADH21975.1;transl_table=4
CP002027.1	Genbank	sequence_feature	207940	209019	.	+	.	ID=id219;Note=mmyc1025%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	208209	209415	.	-	.	ID=gene166;Name=MMSYN1_0162;Note=putative lipoprotein%2C authentic frameshift%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=Gene;locus_tag=MMSYN1_0162;pseudo=true
CP002027.1	Genbank	sequence_feature	208940	210019	.	+	.	ID=id220;Note=mmyc1026%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	209529	212219	.	-	.	ID=gene167;Name=alaS;gbkey=Gene;gene=alaS;locus_tag=MMSYN1_0163
CP002027.1	Genbank	CDS	209529	212219	.	-	0	ID=cds154;Parent=gene167;Dbxref=NCBI_GP:ADH21678.1;Name=ADH21678.1;Note=identified by match to protein family HMM PF01411%3B match to protein family HMM PF07973%3B match to protein family HMM TIGR00344;gbkey=CDS;gene=alaS;product=alanine--tRNA ligase;protein_id=ADH21678.1;transl_table=4
CP002027.1	Genbank	sequence_feature	209940	211019	.	+	.	ID=id221;Note=mmyc1027%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	210940	212019	.	+	.	ID=id222;Note=mmyc1028f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	211940	213019	.	+	.	ID=id223;Note=mmyc1029%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	212293	212787	.	-	.	ID=gene168;Name=MMSYN1_0164;gbkey=Gene;locus_tag=MMSYN1_0164
CP002027.1	Genbank	CDS	212293	212787	.	-	0	ID=cds155;Parent=gene168;Dbxref=NCBI_GP:ADH21546.1;Name=ADH21546.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21546.1;transl_table=4
CP002027.1	Genbank	sequence_feature	212940	214019	.	+	.	ID=id224;Note=mmyc1030%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	213005	214249	.	+	.	ID=gene169;Name=MMSYN1_0165;gbkey=Gene;locus_tag=MMSYN1_0165
CP002027.1	Genbank	CDS	213005	214249	.	+	0	ID=cds156;Parent=gene169;Dbxref=NCBI_GP:ADH22200.1;Name=ADH22200.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=oligopeptide ABC transporter%2C permease component;protein_id=ADH22200.1;transl_table=4
CP002027.1	Genbank	sequence_feature	213940	215019	.	+	.	ID=id225;Note=mmyc1031%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	214265	215275	.	+	.	ID=gene170;Name=MMSYN1_0166;gbkey=Gene;locus_tag=MMSYN1_0166
CP002027.1	Genbank	CDS	214265	215275	.	+	0	ID=cds157;Parent=gene170;Dbxref=NCBI_GP:ADH22127.1;Name=ADH22127.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=oligopeptide ABC transporter%2C permease component I;protein_id=ADH22127.1;transl_table=4
CP002027.1	Genbank	sequence_feature	214940	216019	.	+	.	ID=id226;Note=mmyc1032%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	215289	216989	.	+	.	ID=gene171;Name=MMSYN1_0167;gbkey=Gene;locus_tag=MMSYN1_0167
CP002027.1	Genbank	CDS	215289	216989	.	+	0	ID=cds158;Parent=gene171;Dbxref=NCBI_GP:ADH21900.1;Name=ADH21900.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF08352%3B match to protein family HMM TIGR01727;gbkey=CDS;product=oligopeptide ABC transporter%2C ATP-binding component;protein_id=ADH21900.1;transl_table=4
CP002027.1	Genbank	sequence_feature	215940	217019	.	+	.	ID=id227;Note=mmyc1033%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	216940	218019	.	+	.	ID=id228;Note=mmyc1034%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	216991	218859	.	+	.	ID=gene172;Name=MMSYN1_0168;gbkey=Gene;locus_tag=MMSYN1_0168
CP002027.1	Genbank	CDS	216991	218859	.	+	0	ID=cds159;Parent=gene172;Dbxref=NCBI_GP:ADH21850.1;Name=ADH21850.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF08352;gbkey=CDS;product=ABC transporter%2C ATP-binding protein%2C putative;protein_id=ADH21850.1;transl_table=4
CP002027.1	Genbank	sequence_feature	217940	219019	.	+	.	ID=id229;Note=mmyc1035%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	218876	221977	.	+	.	ID=gene173;Name=MMSYN1_0169;gbkey=Gene;locus_tag=MMSYN1_0169
CP002027.1	Genbank	CDS	218876	221977	.	+	0	ID=cds160;Parent=gene173;Dbxref=NCBI_GP:ADH21599.1;Name=ADH21599.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21599.1;transl_table=4
CP002027.1	Genbank	sequence_feature	218940	220019	.	+	.	ID=id230;Note=mmyc1036%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	219940	221019	.	+	.	ID=id231;Note=mmyc1037%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	220940	222019	.	+	.	ID=id232;Note=mmyc1038%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	221940	223019	.	+	.	ID=id233;Note=mmyc1039%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	222395	223690	.	-	.	ID=gene174;Name=MMSYN1_0170;gbkey=Gene;locus_tag=MMSYN1_0170
CP002027.1	Genbank	CDS	222395	223690	.	-	0	ID=cds161;Parent=gene174;Dbxref=NCBI_GP:ADH21614.1;Name=ADH21614.1;Note=identified by match to protein family HMM PF01637;gbkey=CDS;product=ATPase;protein_id=ADH21614.1;transl_table=4
CP002027.1	Genbank	sequence_feature	222940	224019	.	+	.	ID=id234;Note=mmyc1040%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	223785	225089	.	-	.	ID=gene175;Name=MMSYN1_0171;gbkey=Gene;locus_tag=MMSYN1_0171
CP002027.1	Genbank	CDS	223785	225089	.	-	0	ID=cds162;Parent=gene175;Dbxref=NCBI_GP:ADH21792.1;Name=ADH21792.1;gbkey=CDS;product=ATPase;protein_id=ADH21792.1;transl_table=4
CP002027.1	Genbank	sequence_feature	223940	225019	.	+	.	ID=id235;Note=mmyc1041%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	224940	226019	.	+	.	ID=id236;Note=mmyc1042%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	225321	226202	.	+	.	ID=gene176;Name=MMSYN1_0172;gbkey=Gene;locus_tag=MMSYN1_0172
CP002027.1	Genbank	CDS	225321	226202	.	+	0	ID=cds163;Parent=gene176;Dbxref=NCBI_GP:ADH21659.1;Name=ADH21659.1;Note=identified by match to protein family HMM PF00702%3B match to protein family HMM PF08282%3B match to protein family HMM TIGR00099%3B match to protein family HMM TIGR01484;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21659.1;transl_table=4
CP002027.1	Genbank	sequence_feature	225940	227019	.	+	.	ID=id237;Note=mmyc1043%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	226236	227933	.	-	.	ID=gene177;Name=MMSYN1_0173;gbkey=Gene;locus_tag=MMSYN1_0173
CP002027.1	Genbank	CDS	226236	227933	.	-	0	ID=cds164;Parent=gene177;Dbxref=NCBI_GP:ADH22007.1;Name=ADH22007.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH22007.1;transl_table=4
CP002027.1	Genbank	sequence_feature	226940	228019	.	+	.	ID=id238;Note=mmyc1044%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	227940	229019	.	+	.	ID=id239;Note=mmyc1045%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	228150	228296	.	+	.	ID=gene178;Name=MMSYN1_0174;gbkey=Gene;locus_tag=MMSYN1_0174
CP002027.1	Genbank	CDS	228150	228296	.	+	0	ID=cds165;Parent=gene178;Dbxref=NCBI_GP:ADH21882.1;Name=ADH21882.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21882.1;transl_table=4
CP002027.1	Genbank	gene	228333	230015	.	-	.	ID=gene179;Name=MMSYN1_0175;gbkey=Gene;locus_tag=MMSYN1_0175
CP002027.1	Genbank	CDS	228333	230015	.	-	0	ID=cds166;Parent=gene179;Dbxref=NCBI_GP:ADH22188.1;Name=ADH22188.1;Note=identified by match to protein family HMM TIGR03490;gbkey=CDS;product=mycoides cluster lipoprotein%2C LppA/P72 family;protein_id=ADH22188.1;transl_table=4
CP002027.1	Genbank	sequence_feature	228940	230019	.	+	.	ID=id240;Note=mmyc1046%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	229940	231019	.	+	.	ID=id241;Note=mmyc1047%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	230125	230754	.	-	.	ID=gene180;Name=pgmB;gbkey=Gene;gene=pgmB;locus_tag=MMSYN1_0176
CP002027.1	Genbank	CDS	230125	230754	.	-	0	ID=cds167;Parent=gene180;Dbxref=NCBI_GP:ADH22155.1;Name=ADH22155.1;Note=identified by match to protein family HMM PF00702%3B match to protein family HMM TIGR01509%3B match to protein family HMM TIGR01990%3B match to protein family HMM TIGR02009;gbkey=CDS;gene=pgmB;product=beta-phosphoglucomutase;protein_id=ADH22155.1;transl_table=4
CP002027.1	Genbank	gene	230754	232553	.	-	.	ID=gene181;Name=MMSYN1_0177;gbkey=Gene;locus_tag=MMSYN1_0177
CP002027.1	Genbank	CDS	230754	232553	.	-	0	ID=cds168;Parent=gene181;Dbxref=NCBI_GP:ADH21572.1;Name=ADH21572.1;Note=identified by match to protein family HMM PF00128%3B match to protein family HMM PF02903;gbkey=CDS;product=neopullulanase;protein_id=ADH21572.1;transl_table=4
CP002027.1	Genbank	sequence_feature	230940	232019	.	+	.	ID=id242;Note=mmyc1048%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	231940	233019	.	+	.	ID=id243;Note=mmyc1049%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	232672	234468	.	-	.	ID=gene182;Name=MMSYN1_0178;gbkey=Gene;locus_tag=MMSYN1_0178
CP002027.1	Genbank	CDS	232672	234468	.	-	0	ID=cds169;Parent=gene182;Dbxref=NCBI_GP:ADH21538.1;Name=ADH21538.1;Note=identified by match to protein family HMM PF00128%3B match to protein family HMM PF02903;gbkey=CDS;product=neopullulanase;protein_id=ADH21538.1;transl_table=4
CP002027.1	Genbank	sequence_feature	232940	234019	.	+	.	ID=id244;Note=mmyc1050%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	233940	235019	.	+	.	ID=id245;Note=mmyc1051%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	234726	236525	.	+	.	ID=gene183;Name=MMSYN1_0179;gbkey=Gene;locus_tag=MMSYN1_0179
CP002027.1	Genbank	CDS	234726	236525	.	+	0	ID=cds170;Parent=gene183;Dbxref=NCBI_GP:ADH21514.1;Name=ADH21514.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21514.1;transl_table=4
CP002027.1	Genbank	sequence_feature	234940	236019	.	+	.	ID=id246;Note=mmyc1052%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	235940	237019	.	+	.	ID=id247;Note=mmyc1053%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	236820	238610	.	+	.	ID=gene184;Name=MMSYN1_0180;gbkey=Gene;locus_tag=MMSYN1_0180
CP002027.1	Genbank	CDS	236820	238610	.	+	0	ID=cds171;Parent=gene184;Dbxref=NCBI_GP:ADH21887.1;Name=ADH21887.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21887.1;transl_table=4
CP002027.1	Genbank	sequence_feature	236940	238019	.	+	.	ID=id248;Note=mmyc1054%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	237940	239019	.	+	.	ID=id249;Note=mmyc1055%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	238692	239183	.	+	.	ID=gene185;Name=MMSYN1_0181;gbkey=Gene;locus_tag=MMSYN1_0181
CP002027.1	Genbank	CDS	238692	239183	.	+	0	ID=cds172;Parent=gene185;Dbxref=NCBI_GP:ADH21798.1;Name=ADH21798.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21798.1;transl_table=4
CP002027.1	Genbank	sequence_feature	238940	240019	.	+	.	ID=id250;Note=mmyc1056%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	239198	241615	.	+	.	ID=gene186;Name=MMSYN1_0182;Note=maltosaccharide ABC transporter%2C permease%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF00528;gbkey=Gene;locus_tag=MMSYN1_0182;pseudo=true
CP002027.1	Genbank	sequence_feature	239940	241019	.	+	.	ID=id251;Note=mmyc1057%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	240940	242019	.	+	.	ID=id252;Note=mmyc1058%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	241630	244170	.	+	.	ID=gene187;Name=MMSYN1_0183;gbkey=Gene;locus_tag=MMSYN1_0183
CP002027.1	Genbank	CDS	241630	244170	.	+	0	ID=cds173;Parent=gene187;Dbxref=NCBI_GP:ADH21624.1;Name=ADH21624.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=maltose ABC transporter permease protein;protein_id=ADH21624.1;transl_table=4
CP002027.1	Genbank	sequence_feature	241940	243019	.	+	.	ID=id253;Note=mmyc1059%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	242940	244019	.	+	.	ID=id254;Note=mmyc1060%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	243940	245019	.	+	.	ID=id255;Note=mmyc1061%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	244172	245257	.	+	.	ID=gene188;Name=MMSYN1_0184;gbkey=Gene;locus_tag=MMSYN1_0184
CP002027.1	Genbank	CDS	244172	245257	.	+	0	ID=cds174;Parent=gene188;Dbxref=NCBI_GP:ADH21796.1;Name=ADH21796.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=multiple sugar-binding transport ATP-binding protein MsmK;protein_id=ADH21796.1;transl_table=4
CP002027.1	Genbank	sequence_feature	244940	246019	.	+	.	ID=id256;Note=mmyc1062%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	245365	247662	.	+	.	ID=gene189;Name=MMSYN1_0185;gbkey=Gene;locus_tag=MMSYN1_0185
CP002027.1	Genbank	CDS	245365	247662	.	+	0	ID=cds175;Parent=gene189;Dbxref=NCBI_GP:ADH21687.1;Name=ADH21687.1;Note=identified by match to protein family HMM PF03632%3B match to protein family HMM PF03633%3B match to protein family HMM PF03636;gbkey=CDS;product=glycosyl hydrolase%2C family 65;protein_id=ADH21687.1;transl_table=4
CP002027.1	Genbank	sequence_feature	245940	247019	.	+	.	ID=id257;Note=mmyc1063%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	246940	248019	.	+	.	ID=id258;Note=mmyc1064%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	247664	249268	.	+	.	ID=gene190;Name=MMSYN1_0186;gbkey=Gene;locus_tag=MMSYN1_0186
CP002027.1	Genbank	CDS	247664	249268	.	+	0	ID=cds176;Parent=gene190;Dbxref=NCBI_GP:ADH21972.1;Name=ADH21972.1;Note=identified by match to protein family HMM PF00128;gbkey=CDS;product=trehalose-6-phosphate hydrolase (Alpha%2Calpha-phosphotrehalase);protein_id=ADH21972.1;transl_table=4
CP002027.1	Genbank	sequence_feature	247940	249019	.	+	.	ID=id259;Note=mmyc1065%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	248940	250019	.	+	.	ID=id260;Note=mmyc1066%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	249291	250010	.	+	.	ID=gene191;Name=MMSYN1_0187;gbkey=Gene;locus_tag=MMSYN1_0187
CP002027.1	Genbank	CDS	249291	250010	.	+	0	ID=cds177;Parent=gene191;Dbxref=NCBI_GP:ADH21925.1;Name=ADH21925.1;Note=identified by match to protein family HMM PF00392;gbkey=CDS;product=transcriptional regulator%2C GntR family;protein_id=ADH21925.1;transl_table=4
CP002027.1	Genbank	sequence_feature	249940	251019	.	+	.	ID=id261;Note=mmyc1067%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	250039	251832	.	-	.	ID=gene192;Name=pepF;gbkey=Gene;gene=pepF;locus_tag=MMSYN1_0188
CP002027.1	Genbank	CDS	250039	251832	.	-	0	ID=cds178;Parent=gene192;Dbxref=NCBI_GP:ADH22280.1;Name=ADH22280.1;Note=identified by match to protein family HMM PF01432%3B match to protein family HMM PF08439%3B match to protein family HMM TIGR00181;gbkey=CDS;gene=pepF;product=oligoendopeptidase F;protein_id=ADH22280.1;transl_table=4
CP002027.1	Genbank	sequence_feature	250940	252019	.	+	.	ID=id262;Note=mmyc1068%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	251832	252515	.	-	.	ID=gene193;Name=MMSYN1_0189;gbkey=Gene;locus_tag=MMSYN1_0189
CP002027.1	Genbank	CDS	251832	252515	.	-	0	ID=cds179;Parent=gene193;Dbxref=NCBI_GP:ADH21584.1;Name=ADH21584.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21584.1;transl_table=4
CP002027.1	Genbank	sequence_feature	251940	253019	.	+	.	ID=id263;Note=mmyc1069%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	252531	253886	.	-	.	ID=gene194;Name=MMSYN1_0190;gbkey=Gene;locus_tag=MMSYN1_0190
CP002027.1	Genbank	CDS	252531	253886	.	-	0	ID=cds180;Parent=gene194;Dbxref=NCBI_GP:ADH22065.1;Name=ADH22065.1;Note=identified by match to protein family HMM PF00883;gbkey=CDS;product=leucyl aminopeptidase;protein_id=ADH22065.1;transl_table=4
CP002027.1	Genbank	sequence_feature	252940	254019	.	+	.	ID=id264;Note=mmyc1070%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	253940	255019	.	+	.	ID=id265;Note=mmyc1071%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	253998	254180	.	-	.	ID=gene195;Name=MMSYN1_0191;gbkey=Gene;locus_tag=MMSYN1_0191
CP002027.1	Genbank	CDS	253998	254180	.	-	0	ID=cds181;Parent=gene195;Dbxref=NCBI_GP:ADH21781.1;Name=ADH21781.1;gbkey=CDS;product=ATPase;protein_id=ADH21781.1;transl_table=4
CP002027.1	Genbank	gene	254459	255079	.	+	.	ID=gene196;Name=MMSYN1_0192;gbkey=Gene;locus_tag=MMSYN1_0192
CP002027.1	Genbank	CDS	254459	255079	.	+	0	ID=cds182;Parent=gene196;Dbxref=NCBI_GP:ADH21841.1;Name=ADH21841.1;Note=identified by match to protein family HMM PF02417%3B overlaps another CDS with the same product name;gbkey=CDS;product=chromate ion transporter;protein_id=ADH21841.1;transl_table=4
CP002027.1	Genbank	sequence_feature	254940	256019	.	+	.	ID=id266;Note=mmyc1072%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	255079	255756	.	+	.	ID=gene197;Name=MMSYN1_0193;gbkey=Gene;locus_tag=MMSYN1_0193
CP002027.1	Genbank	CDS	255079	255756	.	+	0	ID=cds183;Parent=gene197;Dbxref=NCBI_GP:ADH21510.1;Name=ADH21510.1;Note=overlaps another CDS with the same product name;gbkey=CDS;product=chromate ion transporter;protein_id=ADH21510.1;transl_table=4
CP002027.1	Genbank	pseudogene	255890	256849	.	+	.	ID=gene198;Name=MMSYN1_0194;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF07751;gbkey=Gene;locus_tag=MMSYN1_0194;pseudo=true
CP002027.1	Genbank	sequence_feature	255940	257019	.	+	.	ID=id267;Note=mmyc1073%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	256940	258019	.	+	.	ID=id268;Note=mmyc1074%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	257213	260323	.	-	.	ID=gene199;Name=MMSYN1_0195;gbkey=Gene;locus_tag=MMSYN1_0195
CP002027.1	Genbank	CDS	257213	260323	.	-	0	ID=cds184;Parent=gene199;Dbxref=NCBI_GP:ADH21732.1;Name=ADH21732.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=ABC transporter%2C permease protein;protein_id=ADH21732.1;transl_table=4
CP002027.1	Genbank	sequence_feature	257940	259019	.	+	.	ID=id269;Note=mmyc1075%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	258940	260019	.	+	.	ID=id270;Note=mmyc1076%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	259940	261019	.	+	.	ID=id271;Note=mmyc1077%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	260308	261300	.	-	.	ID=gene200;Name=MMSYN1_0196;gbkey=Gene;locus_tag=MMSYN1_0196
CP002027.1	Genbank	CDS	260308	261300	.	-	0	ID=cds185;Parent=gene200;Dbxref=NCBI_GP:ADH22136.1;Name=ADH22136.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=spermidine/putrescine ABC transporter%2C permease protein;protein_id=ADH22136.1;transl_table=4
CP002027.1	Genbank	sequence_feature	260940	262019	.	+	.	ID=id272;Note=mmyc1078%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	261300	262355	.	-	.	ID=gene201;Name=MMSYN1_0197;gbkey=Gene;locus_tag=MMSYN1_0197
CP002027.1	Genbank	CDS	261300	262355	.	-	0	ID=cds186;Parent=gene201;Dbxref=NCBI_GP:ADH22252.1;Name=ADH22252.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF08402;gbkey=CDS;product=spermidine/putrescine import ATP-binding protein PotA;protein_id=ADH22252.1;transl_table=4
CP002027.1	Genbank	sequence_feature	261940	263019	.	+	.	ID=id273;Note=mmyc1079%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	262729	263088	.	-	.	ID=gene202;Name=rplT;gbkey=Gene;gene=rplT;locus_tag=MMSYN1_0198
CP002027.1	Genbank	CDS	262729	263088	.	-	0	ID=cds187;Parent=gene202;Dbxref=NCBI_GP:ADH21537.1;Name=ADH21537.1;Note=identified by match to protein family HMM PF00453%3B match to protein family HMM TIGR01032;gbkey=CDS;gene=rplT;product=ribosomal protein L20;protein_id=ADH21537.1;transl_table=4
CP002027.1	Genbank	sequence_feature	262940	264019	.	+	.	ID=id274;Note=mmyc1080%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	263107	263298	.	-	.	ID=gene203;Name=rpmI;gbkey=Gene;gene=rpmI;locus_tag=MMSYN1_0199
CP002027.1	Genbank	CDS	263107	263298	.	-	0	ID=cds188;Parent=gene203;Dbxref=NCBI_GP:ADH21722.1;Name=ADH21722.1;Note=identified by match to protein family HMM PF01632%3B match to protein family HMM TIGR00001;gbkey=CDS;gene=rpmI;product=ribosomal protein L35;protein_id=ADH21722.1;transl_table=4
CP002027.1	Genbank	gene	263324	263869	.	-	.	ID=gene204;Name=infC;gbkey=Gene;gene=infC;locus_tag=MMSYN1_0200
CP002027.1	Genbank	CDS	263324	263869	.	-	0	ID=cds189;Parent=gene204;Dbxref=NCBI_GP:ADH22029.1;Name=ADH22029.1;Note=identified by match to protein family HMM PF00707%3B match to protein family HMM PF05198%3B match to protein family HMM TIGR00168;gbkey=CDS;gene=infC;product=translation initiation factor IF-3;protein_id=ADH22029.1;transl_table=4
CP002027.1	Genbank	sequence_feature	263940	265019	.	+	.	ID=id275;Note=mmyc1081%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	264058	264660	.	-	.	ID=gene205;Name=def;gbkey=Gene;gene=def;locus_tag=MMSYN1_0201
CP002027.1	Genbank	CDS	264058	264660	.	-	0	ID=cds190;Parent=gene205;Dbxref=NCBI_GP:ADH21924.1;Name=ADH21924.1;Note=identified by match to protein family HMM PF01327%3B match to protein family HMM TIGR00079;gbkey=CDS;gene=def;product=peptide deformylase;protein_id=ADH21924.1;transl_table=4
CP002027.1	Genbank	gene	264734	265291	.	+	.	ID=gene206;Name=MMSYN1_0202;gbkey=Gene;locus_tag=MMSYN1_0202
CP002027.1	Genbank	CDS	264734	265291	.	+	0	ID=cds191;Parent=gene206;Dbxref=NCBI_GP:ADH22095.1;Name=ADH22095.1;Note=identified by match to protein family HMM PF03602;gbkey=CDS;product=methyltransferase;protein_id=ADH22095.1;transl_table=4
CP002027.1	Genbank	sequence_feature	264940	266019	.	+	.	ID=id276;Note=mmyc1082%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	265294	266187	.	+	.	ID=gene207;Name=gmk;gbkey=Gene;gene=gmk;locus_tag=MMSYN1_0203
CP002027.1	Genbank	CDS	265294	266187	.	+	0	ID=cds192;Parent=gene207;Dbxref=NCBI_GP:ADH22078.1;Name=ADH22078.1;Note=identified by match to protein family HMM PF00625%3B match to protein family HMM TIGR03263;gbkey=CDS;gene=gmk;product=guanylate kinase (GMP kinase);protein_id=ADH22078.1;transl_table=4
CP002027.1	Genbank	sequence_feature	265940	267019	.	+	.	ID=id277;Note=mmyc1083%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	266177	267436	.	+	.	ID=gene208;Name=sun;gbkey=Gene;gene=sun;locus_tag=MMSYN1_0204
CP002027.1	Genbank	CDS	266177	267436	.	+	0	ID=cds193;Parent=gene208;Dbxref=NCBI_GP:ADH21560.1;Name=ADH21560.1;Note=identified by match to protein family HMM PF01029%3B match to protein family HMM PF01189%3B match to protein family HMM TIGR00563;gbkey=CDS;gene=sun;product=ribosomal RNA small subunit methyltransferase B;protein_id=ADH21560.1;transl_table=4
CP002027.1	Genbank	sequence_feature	266940	268019	.	+	.	ID=id278;Note=mmyc1084%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	267440	269269	.	-	.	ID=gene209;Name=typA;gbkey=Gene;gene=typA;locus_tag=MMSYN1_0205
CP002027.1	Genbank	CDS	267440	269269	.	-	0	ID=cds194;Parent=gene209;Dbxref=NCBI_GP:ADH21472.1;Name=ADH21472.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF00679%3B match to protein family HMM PF03144%3B match to protein family HMM PF08477%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR01394;gbkey=CDS;gene=typA;product=GTP-binding protein TypA/BipA;protein_id=ADH21472.1;transl_table=4
CP002027.1	Genbank	sequence_feature	267940	269019	.	+	.	ID=id279;Note=mmyc1085%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	268940	270019	.	+	.	ID=id280;Note=mmyc1086%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	269514	270271	.	+	.	ID=gene210;Name=MMSYN1_0206;Note=putative lipoprotein%2C authentic frameshift%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0206;pseudo=true
CP002027.1	Genbank	sequence_feature	269940	271019	.	+	.	ID=id281;Note=mmyc1087%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	270334	271125	.	+	.	ID=gene211;Name=MMSYN1_0207;gbkey=Gene;locus_tag=MMSYN1_0207
CP002027.1	Genbank	CDS	270334	271125	.	+	0	ID=cds195;Parent=gene211;Dbxref=NCBI_GP:ADH21942.1;Name=ADH21942.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=putative liporotein;protein_id=ADH21942.1;transl_table=4
CP002027.1	Genbank	sequence_feature	270940	272019	.	+	.	ID=id282;Note=mmyc1088%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	271254	272045	.	+	.	ID=gene212;Name=MMSYN1_0208;gbkey=Gene;locus_tag=MMSYN1_0208
CP002027.1	Genbank	CDS	271254	272045	.	+	0	ID=cds196;Parent=gene212;Dbxref=NCBI_GP:ADH21606.1;Name=ADH21606.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=putative liporotein;protein_id=ADH21606.1;transl_table=4
CP002027.1	Genbank	sequence_feature	271940	273019	.	+	.	ID=id283;Note=mmyc1089%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	272099	273016	.	-	.	ID=gene213;Name=murQ;gbkey=Gene;gene=murQ;locus_tag=MMSYN1_0209
CP002027.1	Genbank	CDS	272099	273016	.	-	0	ID=cds197;Parent=gene213;Dbxref=NCBI_GP:ADH21848.1;Name=ADH21848.1;Note=identified by match to protein family HMM TIGR00274;gbkey=CDS;gene=murQ;product=N-acetylmuramic acid 6-phosphate etherase;protein_id=ADH21848.1;transl_table=4
CP002027.1	Genbank	sequence_feature	272940	274019	.	+	.	ID=id284;Note=mmyc1090%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	273009	274706	.	-	.	ID=gene214;Name=MMSYN1_0210;gbkey=Gene;locus_tag=MMSYN1_0210
CP002027.1	Genbank	CDS	273009	274706	.	-	0	ID=cds198;Parent=gene214;Dbxref=NCBI_GP:ADH21523.1;Name=ADH21523.1;Note=identified by match to protein family HMM PF02378;gbkey=CDS;product=PTS system N-acetylmuramic acid-specific eiibc component (eiibc-murnac);protein_id=ADH21523.1;transl_table=4
CP002027.1	Genbank	sequence_feature	273940	275019	.	+	.	ID=id285;Note=mmyc1091%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	274828	275661	.	-	.	ID=gene215;Name=MMSYN1_0211;gbkey=Gene;locus_tag=MMSYN1_0211
CP002027.1	Genbank	CDS	274828	275661	.	-	0	ID=cds199;Parent=gene215;Dbxref=NCBI_GP:ADH22000.1;Name=ADH22000.1;Note=identified by match to protein family HMM PF01380%3B match to protein family HMM PF01418;gbkey=CDS;product=transcription regulator GntR;protein_id=ADH22000.1;transl_table=4
CP002027.1	Genbank	sequence_feature	274940	276019	.	+	.	ID=id286;Note=mmyc1092%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	275665	275868	.	-	.	ID=gene216;Name=MMSYN1_0212;gbkey=Gene;locus_tag=MMSYN1_0212
CP002027.1	Genbank	CDS	275665	275868	.	-	0	ID=cds200;Parent=gene216;Dbxref=NCBI_GP:ADH21949.1;Name=ADH21949.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21949.1;transl_table=4
CP002027.1	Genbank	sequence_feature	275940	277019	.	+	.	ID=id287;Note=mmyc1093%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	276076	277431	.	+	.	ID=gene217;Name=eno;gbkey=Gene;gene=eno;locus_tag=MMSYN1_0213
CP002027.1	Genbank	CDS	276076	277431	.	+	0	ID=cds201;Parent=gene217;Dbxref=NCBI_GP:ADH22182.1;Name=ADH22182.1;Note=identified by match to protein family HMM PF00113%3B match to protein family HMM PF03952%3B match to protein family HMM TIGR01060;gbkey=CDS;gene=eno;product=phosphopyruvate hydratase;protein_id=ADH22182.1;transl_table=4
CP002027.1	Genbank	sequence_feature	276940	278019	.	+	.	ID=id288;Note=mmyc1094%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	277498	278319	.	+	.	ID=gene218;Name=MMSYN1_0214;gbkey=Gene;locus_tag=MMSYN1_0214
CP002027.1	Genbank	CDS	277498	278319	.	+	0	ID=cds202;Parent=gene218;Dbxref=NCBI_GP:ADH22075.1;Name=ADH22075.1;Note=identified by match to protein family HMM PF01569;gbkey=CDS;product=PAP2 superfamily domain membrane protein;protein_id=ADH22075.1;transl_table=4
CP002027.1	Genbank	sequence_feature	277940	279019	.	+	.	ID=id289;Note=mmyc1095%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	278321	278752	.	+	.	ID=gene219;Name=MMSYN1_0215;gbkey=Gene;locus_tag=MMSYN1_0215
CP002027.1	Genbank	CDS	278321	278752	.	+	0	ID=cds203;Parent=gene219;Dbxref=NCBI_GP:ADH21564.1;Name=ADH21564.1;Note=identified by match to protein family HMM PF03652%3B match to protein family HMM TIGR00250;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21564.1;transl_table=4
CP002027.1	Genbank	gene	278758	279330	.	+	.	ID=gene220;Name=hpt_1;gbkey=Gene;gene=hpt_1;locus_tag=MMSYN1_0216
CP002027.1	Genbank	CDS	278758	279330	.	+	0	ID=cds204;Parent=gene220;Dbxref=NCBI_GP:ADH21456.1;Name=ADH21456.1;Note=identified by match to protein family HMM PF00156%3B match to protein family HMM TIGR01203;gbkey=CDS;gene=hpt_1;product=hypoxanthine phosphoribosyltransferase;protein_id=ADH21456.1;transl_table=4
CP002027.1	Genbank	sequence_feature	278940	280019	.	+	.	ID=id290;Note=mmyc1096%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	279390	280163	.	-	.	ID=gene221;Name=MMSYN1_0217;gbkey=Gene;locus_tag=MMSYN1_0217
CP002027.1	Genbank	CDS	279390	280163	.	-	0	ID=cds205;Parent=gene221;Dbxref=NCBI_GP:ADH21569.1;Name=ADH21569.1;Note=identified by match to protein family HMM PF00230;gbkey=CDS;product=glycerol uptake facilitator protein;protein_id=ADH21569.1;transl_table=4
CP002027.1	Genbank	sequence_feature	279940	281019	.	+	.	ID=id291;Note=mmyc1097%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	280204	281721	.	-	.	ID=gene222;Name=glpK;gbkey=Gene;gene=glpK;locus_tag=MMSYN1_0218
CP002027.1	Genbank	CDS	280204	281721	.	-	0	ID=cds206;Parent=gene222;Dbxref=NCBI_GP:ADH21770.1;Name=ADH21770.1;Note=identified by match to protein family HMM PF00370%3B match to protein family HMM PF02782%3B match to protein family HMM TIGR01311;gbkey=CDS;gene=glpK;product=glycerol kinase;protein_id=ADH21770.1;transl_table=4
CP002027.1	Genbank	sequence_feature	280940	282019	.	+	.	ID=id292;Note=mmyc1098%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	281738	282901	.	-	.	ID=gene223;Name=glpO;gbkey=Gene;gene=glpO;locus_tag=MMSYN1_0219
CP002027.1	Genbank	CDS	281738	282901	.	-	0	ID=cds207;Parent=gene223;Dbxref=NCBI_GP:ADH21679.1;Name=ADH21679.1;Note=identified by match to protein family HMM PF01266;gbkey=CDS;gene=glpO;product=glycerol oxydase;protein_id=ADH21679.1;transl_table=4
CP002027.1	Genbank	sequence_feature	281940	283019	.	+	.	ID=id293;Note=mmyc1099%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	282940	284019	.	+	.	ID=id294;Note=mmyc1100%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	283236	284216	.	+	.	ID=gene224;Name=pfkA;gbkey=Gene;gene=pfkA;locus_tag=MMSYN1_0220
CP002027.1	Genbank	CDS	283236	284216	.	+	0	ID=cds208;Parent=gene224;Dbxref=NCBI_GP:ADH21634.1;Name=ADH21634.1;Note=identified by match to protein family HMM PF00365%3B match to protein family HMM TIGR02482;gbkey=CDS;gene=pfkA;product=6-phosphofructokinase;protein_id=ADH21634.1;transl_table=4
CP002027.1	Genbank	sequence_feature	283940	285019	.	+	.	ID=id295;Note=mmyc1101%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	284287	285723	.	+	.	ID=gene225;Name=pyk;gbkey=Gene;gene=pyk;locus_tag=MMSYN1_0221
CP002027.1	Genbank	CDS	284287	285723	.	+	0	ID=cds209;Parent=gene225;Dbxref=NCBI_GP:ADH21630.1;Name=ADH21630.1;Note=identified by match to protein family HMM PF00224%3B match to protein family HMM TIGR01064;gbkey=CDS;gene=pyk;product=pyruvate kinase;protein_id=ADH21630.1;transl_table=4
CP002027.1	Genbank	sequence_feature	284940	286019	.	+	.	ID=id296;Note=mmyc1102%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	285940	287019	.	+	.	ID=id297;Note=mmyc1103%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	285988	287907	.	+	.	ID=gene226;Name=thrS;gbkey=Gene;gene=thrS;locus_tag=MMSYN1_0222
CP002027.1	Genbank	CDS	285988	287907	.	+	0	ID=cds210;Parent=gene226;Dbxref=NCBI_GP:ADH21723.1;Name=ADH21723.1;Note=identified by match to protein family HMM PF00587%3B match to protein family HMM PF02824%3B match to protein family HMM PF03129%3B match to protein family HMM TIGR00418;gbkey=CDS;gene=thrS;product=threonine--tRNA ligase;protein_id=ADH21723.1;transl_table=4
CP002027.1	Genbank	sequence_feature	286940	288019	.	+	.	ID=id298;Note=mmyc1104%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	287941	289020	.	+	.	ID=id299;Note=mmyc2a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	288390	289754	.	+	.	ID=gene227;Name=MMSYN1_0223;gbkey=Gene;locus_tag=MMSYN1_0223
CP002027.1	Genbank	CDS	288390	289754	.	+	0	ID=cds211;Parent=gene227;Dbxref=NCBI_GP:ADH21843.1;Name=ADH21843.1;Note=identified by match to protein family HMM PF00070%3B match to protein family HMM PF02852%3B match to protein family HMM PF07992;gbkey=CDS;product=NADH oxidase (noxase);protein_id=ADH21843.1;transl_table=4
CP002027.1	Genbank	sequence_feature	288941	290020	.	+	.	ID=id300;Note=mmyc3a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	289757	290761	.	+	.	ID=gene228;Name=MMSYN1_0224;gbkey=Gene;locus_tag=MMSYN1_0224
CP002027.1	Genbank	CDS	289757	290761	.	+	0	ID=cds212;Parent=gene228;Dbxref=NCBI_GP:ADH21911.1;Name=ADH21911.1;Note=identified by match to protein family HMM PF03099%3B match to protein family HMM TIGR00545;gbkey=CDS;product=probable lipoate-protein ligase A (Lipoate--proteinligase);protein_id=ADH21911.1;transl_table=4
CP002027.1	Genbank	sequence_feature	289941	291020	.	+	.	ID=id301;Note=mmyc4a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	290805	291917	.	+	.	ID=gene229;Name=pdhA;gbkey=Gene;gene=pdhA;locus_tag=MMSYN1_0225
CP002027.1	Genbank	CDS	290805	291917	.	+	0	ID=cds213;Parent=gene229;Dbxref=NCBI_GP:ADH21885.1;Name=ADH21885.1;Note=identified by match to protein family HMM PF00676%3B match to protein family HMM TIGR03181;gbkey=CDS;gene=pdhA;product=pyruvate dehydrogenase (acetyl-transferring) E1 component%2C alpha subunit;protein_id=ADH21885.1;transl_table=4
CP002027.1	Genbank	sequence_feature	290941	292020	.	+	.	ID=id302;Note=mmyc5a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	291917	292906	.	+	.	ID=gene230;Name=pdhB;gbkey=Gene;gene=pdhB;locus_tag=MMSYN1_0226
CP002027.1	Genbank	CDS	291917	292906	.	+	0	ID=cds214;Parent=gene230;Dbxref=NCBI_GP:ADH22057.1;Name=ADH22057.1;Note=identified by match to protein family HMM PF02779%3B match to protein family HMM PF02780;gbkey=CDS;gene=pdhB;product=pyruvate dehydrogenase E1 component subunit beta (Scomplex%2C 36 kDa subunit);protein_id=ADH22057.1;transl_table=4
CP002027.1	Genbank	sequence_feature	291941	293020	.	+	.	ID=id303;Note=mmyc6a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	292935	294260	.	+	.	ID=gene231;Name=pdhC;gbkey=Gene;gene=pdhC;locus_tag=MMSYN1_0227
CP002027.1	Genbank	CDS	292935	294260	.	+	0	ID=cds215;Parent=gene231;Dbxref=NCBI_GP:ADH22161.1;Name=ADH22161.1;Note=identified by match to protein family HMM PF00198%3B match to protein family HMM PF00364%3B match to protein family HMM PF02817;gbkey=CDS;gene=pdhC;product=dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex;protein_id=ADH22161.1;transl_table=4
CP002027.1	Genbank	sequence_feature	292941	294020	.	+	.	ID=id304;Note=mmyc7a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=pdhC
CP002027.1	Genbank	sequence_feature	293941	295020	.	+	.	ID=id305;Note=mmyc8a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	294279	296168	.	+	.	ID=gene232;Name=lpdA;gbkey=Gene;gene=lpdA;locus_tag=MMSYN1_0228
CP002027.1	Genbank	CDS	294279	296168	.	+	0	ID=cds216;Parent=gene232;Dbxref=NCBI_GP:ADH22239.1;Name=ADH22239.1;Note=identified by match to protein family HMM PF00070%3B match to protein family HMM PF00364%3B match to protein family HMM PF01134%3B match to protein family HMM PF02852%3B match to protein family HMM PF07992%3B match to protein family HMM TIGR01350;gbkey=CDS;gene=lpdA;product=dihydrolipoyl dehydrogenase;protein_id=ADH22239.1;transl_table=4
CP002027.1	Genbank	sequence_feature	294941	296020	.	+	.	ID=id306;Note=mmyc9a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lpdA
CP002027.1	Genbank	sequence_feature	295941	297020	.	+	.	ID=id307;Note=mmyc10a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	296190	297158	.	+	.	ID=gene233;Name=pta;gbkey=Gene;gene=pta;locus_tag=MMSYN1_0229
CP002027.1	Genbank	CDS	296190	297158	.	+	0	ID=cds217;Parent=gene233;Dbxref=NCBI_GP:ADH21454.1;Name=ADH21454.1;Note=identified by match to protein family HMM PF01515%3B match to protein family HMM TIGR00651;gbkey=CDS;gene=pta;product=phosphate acetyltransferase;protein_id=ADH21454.1;transl_table=4
CP002027.1	Genbank	sequence_feature	296941	298020	.	+	.	ID=id308;Note=mmyc11a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	297171	298352	.	+	.	ID=gene234;Name=ackA;gbkey=Gene;gene=ackA;locus_tag=MMSYN1_0230
CP002027.1	Genbank	CDS	297171	298352	.	+	0	ID=cds218;Parent=gene234;Dbxref=NCBI_GP:ADH22264.1;Name=ADH22264.1;Note=identified by match to protein family HMM PF00871%3B match to protein family HMM TIGR00016;gbkey=CDS;gene=ackA;product=acetate kinase;protein_id=ADH22264.1;transl_table=4
CP002027.1	Genbank	sequence_feature	297940	299119	.	+	.	ID=id309;Note=mmyc12ax%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	298421	300376	.	+	.	ID=gene235;Name=MMSYN1_0231;gbkey=Gene;locus_tag=MMSYN1_0231
CP002027.1	Genbank	CDS	298421	300376	.	+	0	ID=cds219;Parent=gene235;Dbxref=NCBI_GP:ADH21810.1;Name=ADH21810.1;Note=identified by match to protein family HMM PF01732;gbkey=CDS;product=putative liporotein;protein_id=ADH21810.1;transl_table=4
CP002027.1	Genbank	sequence_feature	299039	300118	.	+	.	ID=id310;Note=mmyc15%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	300039	301118	.	+	.	ID=id311;Note=mmyc16%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	300386	300808	.	+	.	ID=gene236;Name=coaD;gbkey=Gene;gene=coaD;locus_tag=MMSYN1_0232
CP002027.1	Genbank	CDS	300386	300808	.	+	0	ID=cds220;Parent=gene236;Dbxref=NCBI_GP:ADH21577.1;Name=ADH21577.1;Note=identified by match to protein family HMM PF01467%3B match to protein family HMM TIGR00125%3B match to protein family HMM TIGR01510;gbkey=CDS;gene=coaD;product=pantetheine-phosphate adenylyltransferase;protein_id=ADH21577.1;transl_table=4
CP002027.1	Genbank	gene	300902	302623	.	+	.	ID=gene237;Name=ptsP;gbkey=Gene;gene=ptsP;locus_tag=MMSYN1_0233
CP002027.1	Genbank	CDS	300902	302623	.	+	0	ID=cds221;Parent=gene237;Dbxref=NCBI_GP:ADH21815.1;Name=ADH21815.1;Note=identified by match to protein family HMM PF00391%3B match to protein family HMM PF02896%3B match to protein family HMM PF05524%3B match to protein family HMM TIGR01417;gbkey=CDS;gene=ptsP;product=phosphoenolpyruvate-protein phosphotransferase;protein_id=ADH21815.1;transl_table=4
CP002027.1	Genbank	sequence_feature	301039	302118	.	+	.	ID=id312;Note=mmyc17%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=ptsP
CP002027.1	Genbank	sequence_feature	302039	303118	.	+	.	ID=id313;Note=mmyc18%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	302705	303169	.	+	.	ID=gene238;Name=MMSYN1_0234;gbkey=Gene;locus_tag=MMSYN1_0234
CP002027.1	Genbank	CDS	302705	303169	.	+	0	ID=cds222;Parent=gene238;Dbxref=NCBI_GP:ADH21673.1;Name=ADH21673.1;Note=identified by match to protein family HMM PF00358%3B match to protein family HMM TIGR00830;gbkey=CDS;product=PTS system glucose-specific eiicba component (eiicba-glc) (eii-glc/eiii-glc);protein_id=ADH21673.1;transl_table=4
CP002027.1	Genbank	sequence_feature	303039	304118	.	+	.	ID=id314;Note=mmyc19%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	303170	303460	.	+	.	ID=gene239;Name=MMSYN1_0235;gbkey=Gene;locus_tag=MMSYN1_0235
CP002027.1	Genbank	CDS	303170	303460	.	+	0	ID=cds223;Parent=gene239;Dbxref=NCBI_GP:ADH22027.1;Name=ADH22027.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22027.1;transl_table=4
CP002027.1	Genbank	gene	303533	304159	.	+	.	ID=gene240;Name=dhaL;gbkey=Gene;gene=dhaL;locus_tag=MMSYN1_0236
CP002027.1	Genbank	CDS	303533	304159	.	+	0	ID=cds224;Parent=gene240;Dbxref=NCBI_GP:ADH21961.1;Name=ADH21961.1;Note=identified by match to protein family HMM PF02734%3B match to protein family HMM TIGR02365;gbkey=CDS;gene=dhaL;product=dihydroxyacetone kinase%2C L subunit;protein_id=ADH21961.1;transl_table=4
CP002027.1	Genbank	sequence_feature	304039	305118	.	+	.	ID=id315;Note=mmyc20%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	304167	304562	.	+	.	ID=gene241;Name=MMSYN1_0237;gbkey=Gene;locus_tag=MMSYN1_0237
CP002027.1	Genbank	CDS	304167	304562	.	+	0	ID=cds225;Parent=gene241;Dbxref=NCBI_GP:ADH22267.1;Name=ADH22267.1;Note=identified by match to protein family HMM PF03610%3B match to protein family HMM TIGR02364;gbkey=CDS;product=dihydroxyacetone kinase%2C phosphotransfer subunit;protein_id=ADH22267.1;transl_table=4
CP002027.1	Genbank	gene	304607	305233	.	-	.	ID=gene242;Name=rpsD;gbkey=Gene;gene=rpsD;locus_tag=MMSYN1_0238
CP002027.1	Genbank	CDS	304607	305233	.	-	0	ID=cds226;Parent=gene242;Dbxref=NCBI_GP:ADH21958.1;Name=ADH21958.1;Note=identified by match to protein family HMM PF00163%3B match to protein family HMM PF01479%3B match to protein family HMM TIGR01017;gbkey=CDS;gene=rpsD;product=ribosomal protein S4;protein_id=ADH21958.1;transl_table=4
CP002027.1	Genbank	sequence_feature	305039	306118	.	+	.	ID=id316;Note=mmyc21%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	305488	307275	.	+	.	ID=gene243;Name=MMSYN1_0239;gbkey=Gene;locus_tag=MMSYN1_0239
CP002027.1	Genbank	CDS	305488	307275	.	+	0	ID=cds227;Parent=gene243;Dbxref=NCBI_GP:ADH22220.1;Name=ADH22220.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22220.1;transl_table=4
CP002027.1	Genbank	sequence_feature	306039	307118	.	+	.	ID=id317;Note=mmyc22%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	307039	308118	.	+	.	ID=id318;Note=mmyc23%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	307283	308470	.	+	.	ID=gene244;Name=thiI;gbkey=Gene;gene=thiI;locus_tag=MMSYN1_0240
CP002027.1	Genbank	CDS	307283	308470	.	+	0	ID=cds228;Parent=gene244;Dbxref=NCBI_GP:ADH21880.1;Name=ADH21880.1;Note=identified by match to protein family HMM PF02568%3B match to protein family HMM PF02926%3B match to protein family HMM PF06508%3B match to protein family HMM TIGR00342;gbkey=CDS;gene=thiI;product=thiamine biosynthesis/tRNA modification protein ThiI;protein_id=ADH21880.1;transl_table=4
CP002027.1	Genbank	sequence_feature	308039	309895	.	+	.	ID=id319;Note=mmyc24%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	308601	311333	.	+	.	ID=gene245;Name=ctpA;Note=carboxyl terminal peptidase activity of this gene was confirmed by Mary Brown and Ayman Alam at the University of Florida%3B disrupted by insertion sequence acquired from Escherichia coli during a BAC cloning step in the genome synthesis process%3B carboxyl terminal peptidase A%3B this gene model represents a disrupted reading frame with multiple genetic anomalies%3B identified by match to protein family HMM PF03572;gbkey=Gene;gene=ctpA;locus_tag=MMSYN1_0241;pseudo=true
CP002027.1	Genbank	sequence_feature	309816	310895	.	+	.	ID=id320;Note=mmyc25%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=ctpA
CP002027.1	Genbank	mobile_genetic_element	308737	309513	.	+	.	ID=id321;Note=not in design of JCVI-syn1%3B disrupts ctpA%3B acquired from Eschericha coli during BAC cloning step;gbkey=mobile_element;mobile_element_type=insertion sequence
CP002027.1	Genbank	sequence_feature	310816	311895	.	+	.	ID=id322;Note=mmyc26%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	311451	313136	.	+	.	ID=gene246;Name=MMSYN1_0242;gbkey=Gene;locus_tag=MMSYN1_0242
CP002027.1	Genbank	CDS	311451	313136	.	+	0	ID=cds229;Parent=gene246;Dbxref=NCBI_GP:ADH21636.1;Name=ADH21636.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21636.1;transl_table=4
CP002027.1	Genbank	sequence_feature	311816	312895	.	+	.	ID=id323;Note=mmyc27%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	312816	313895	.	+	.	ID=id324;Note=mmyc28%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	313147	315438	.	+	.	ID=gene247;Name=MMSYN1_0243;gbkey=Gene;locus_tag=MMSYN1_0243
CP002027.1	Genbank	CDS	313147	315438	.	+	0	ID=cds230;Parent=gene247;Dbxref=NCBI_GP:ADH21757.1;Name=ADH21757.1;Note=identified by match to protein family HMM PF03382;gbkey=CDS;product=putative liporotein;protein_id=ADH21757.1;transl_table=4
CP002027.1	Genbank	sequence_feature	313816	314895	.	+	.	ID=id325;Note=mmyc29%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	314816	315895	.	+	.	ID=id326;Note=mmyc30%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	315501	317768	.	+	.	ID=gene248;Name=MMSYN1_0244;gbkey=Gene;locus_tag=MMSYN1_0244
CP002027.1	Genbank	CDS	315501	317768	.	+	0	ID=cds231;Parent=gene248;Dbxref=NCBI_GP:ADH21788.1;Name=ADH21788.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21788.1;transl_table=4
CP002027.1	Genbank	sequence_feature	315816	316895	.	+	.	ID=id327;Note=mmyc31%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	316816	317895	.	+	.	ID=id328;Note=mmyc32%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	317816	318895	.	+	.	ID=id329;Note=mmyc33%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	318242	320383	.	+	.	ID=gene249;Name=MMSYN1_0245;gbkey=Gene;locus_tag=MMSYN1_0245
CP002027.1	Genbank	CDS	318242	320383	.	+	0	ID=cds232;Parent=gene249;Dbxref=NCBI_GP:ADH22015.1;Name=ADH22015.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22015.1;transl_table=4
CP002027.1	Genbank	sequence_feature	318816	319895	.	+	.	ID=id330;Note=mmyc34%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	319816	320895	.	+	.	ID=id331;Note=mmyc35%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	320410	323316	.	-	.	ID=gene250;Name=MMSYN1_0246;gbkey=Gene;locus_tag=MMSYN1_0246
CP002027.1	Genbank	CDS	320410	323316	.	-	0	ID=cds233;Parent=gene250;Dbxref=NCBI_GP:ADH21691.1;Name=ADH21691.1;Note=identified by match to protein family HMM PF00122%3B match to protein family HMM PF00690%3B match to protein family HMM PF00702%3B match to protein family HMM TIGR01494;gbkey=CDS;product=E1-E2 ATPase subfamily%2C putative;protein_id=ADH21691.1;transl_table=4
CP002027.1	Genbank	sequence_feature	320816	321895	.	+	.	ID=id332;Note=mmyc36%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	321816	322895	.	+	.	ID=id333;Note=mmyc37%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	322816	323895	.	+	.	ID=id334;Note=mmyc38%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	323325	323915	.	-	.	ID=gene251;Name=ysxC;gbkey=Gene;gene=ysxC;locus_tag=MMSYN1_0247
CP002027.1	Genbank	CDS	323325	323915	.	-	0	ID=cds234;Parent=gene251;Dbxref=NCBI_GP:ADH22209.1;Name=ADH22209.1;Note=identified by match to protein family HMM PF01926%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR03598;gbkey=CDS;gene=ysxC;product=ribosome biogenesis GTP-binding protein YsxC;protein_id=ADH22209.1;transl_table=4
CP002027.1	Genbank	sequence_feature	323816	324895	.	+	.	ID=id335;Note=mmyc39%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	323909	324469	.	-	.	ID=gene252;Name=MMSYN1_0248;gbkey=Gene;locus_tag=MMSYN1_0248
CP002027.1	Genbank	CDS	323909	324469	.	-	0	ID=cds235;Parent=gene252;Dbxref=NCBI_GP:ADH21575.1;Name=ADH21575.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21575.1;transl_table=4
CP002027.1	Genbank	gene	324471	325049	.	-	.	ID=gene253;Name=MMSYN1_0249;gbkey=Gene;locus_tag=MMSYN1_0249
CP002027.1	Genbank	CDS	324471	325049	.	-	0	ID=cds236;Parent=gene253;Dbxref=NCBI_GP:ADH21536.1;Name=ADH21536.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21536.1;transl_table=4
CP002027.1	Genbank	sequence_feature	324816	325895	.	+	.	ID=id336;Note=mmyc40%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	325052	325741	.	-	.	ID=gene254;Name=MMSYN1_0250;gbkey=Gene;locus_tag=MMSYN1_0250
CP002027.1	Genbank	CDS	325052	325741	.	-	0	ID=cds237;Parent=gene254;Dbxref=NCBI_GP:ADH21469.1;Name=ADH21469.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21469.1;transl_table=4
CP002027.1	Genbank	sequence_feature	325816	326895	.	+	.	ID=id337;Note=mmyc41%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	325823	326515	.	+	.	ID=gene255;Name=MMSYN1_0251;gbkey=Gene;locus_tag=MMSYN1_0251
CP002027.1	Genbank	CDS	325823	326515	.	+	0	ID=cds238;Parent=gene255;Dbxref=NCBI_GP:ADH22003.1;Name=ADH22003.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22003.1;transl_table=4
CP002027.1	Genbank	gene	326516	327238	.	-	.	ID=gene256;Name=MMSYN1_0252;gbkey=Gene;locus_tag=MMSYN1_0252
CP002027.1	Genbank	CDS	326516	327238	.	-	0	ID=cds239;Parent=gene256;Dbxref=NCBI_GP:ADH21861.1;Name=ADH21861.1;Note=identified by match to protein family HMM PF00106%3B match to protein family HMM PF01370%3B match to protein family HMM PF08659;gbkey=CDS;product=oxidoreductase;protein_id=ADH21861.1;transl_table=4
CP002027.1	Genbank	sequence_feature	326816	327895	.	+	.	ID=id338;Note=mmyc42%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	327283	327756	.	-	.	ID=gene257;Name=MMSYN1_0253;gbkey=Gene;locus_tag=MMSYN1_0253
CP002027.1	Genbank	CDS	327283	327756	.	-	0	ID=cds240;Parent=gene257;Dbxref=NCBI_GP:ADH21914.1;Name=ADH21914.1;Note=identified by match to protein family HMM PF01272%3B match to protein family HMM PF03449%3B match to protein family HMM TIGR01462;gbkey=CDS;product=transcription elongation factor GreA;protein_id=ADH21914.1;transl_table=4
CP002027.1	Genbank	sequence_feature	327816	328895	.	+	.	ID=id339;Note=mmyc43%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	327879	329633	.	-	.	ID=gene258;Name=uvrC;gbkey=Gene;gene=uvrC;locus_tag=MMSYN1_0254
CP002027.1	Genbank	CDS	327879	329633	.	-	0	ID=cds241;Parent=gene258;Dbxref=NCBI_GP:ADH21973.1;Name=ADH21973.1;Note=identified by match to protein family HMM PF01541%3B match to protein family HMM PF02151%3B match to protein family HMM PF08459%3B match to protein family HMM TIGR00194;gbkey=CDS;gene=uvrC;product=excinuclease ABC subunit C;protein_id=ADH21973.1;transl_table=4
CP002027.1	Genbank	sequence_feature	328816	329895	.	+	.	ID=id340;Note=mmyc44%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	329643	330704	.	-	.	ID=gene259;Name=MMSYN1_0255;gbkey=Gene;locus_tag=MMSYN1_0255
CP002027.1	Genbank	CDS	329643	330704	.	-	0	ID=cds242;Parent=gene259;Dbxref=NCBI_GP:ADH22140.1;Name=ADH22140.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22140.1;transl_table=4
CP002027.1	Genbank	sequence_feature	329816	330895	.	+	.	ID=id341;Note=mmyc45%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	330770	332392	.	-	.	ID=gene260;Name=MMSYN1_0256;gbkey=Gene;locus_tag=MMSYN1_0256
CP002027.1	Genbank	CDS	330770	332392	.	-	0	ID=cds243;Parent=gene260;Dbxref=NCBI_GP:ADH21594.1;Name=ADH21594.1;Note=identified by match to protein family HMM PF00324;gbkey=CDS;product=Amino acid permease superfamily protein;protein_id=ADH21594.1;transl_table=4
CP002027.1	Genbank	sequence_feature	330816	331895	.	+	.	ID=id342;Note=mmyc46%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	331816	332895	.	+	.	ID=id343;Note=mmyc47%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	332498	334249	.	-	.	ID=gene261;Name=MMSYN1_0257;gbkey=Gene;locus_tag=MMSYN1_0257
CP002027.1	Genbank	CDS	332498	334249	.	-	0	ID=cds244;Parent=gene261;Dbxref=NCBI_GP:ADH21774.1;Name=ADH21774.1;Note=identified by match to protein family HMM PF00753;gbkey=CDS;product=hydrolase;protein_id=ADH21774.1;transl_table=4
CP002027.1	Genbank	sequence_feature	332816	333895	.	+	.	ID=id344;Note=mmyc48%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	333816	334895	.	+	.	ID=id345;Note=mmyc49%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	334375	335094	.	-	.	ID=gene262;Name=MMSYN1_0258;gbkey=Gene;locus_tag=MMSYN1_0258
CP002027.1	Genbank	CDS	334375	335094	.	-	0	ID=cds245;Parent=gene262;Dbxref=NCBI_GP:ADH21509.1;Name=ADH21509.1;Note=identified by match to protein family HMM PF00106%3B match to protein family HMM PF01370;gbkey=CDS;product=oxidoreductase;protein_id=ADH21509.1;transl_table=4
CP002027.1	Genbank	sequence_feature	334816	335895	.	+	.	ID=id346;Note=mmyc50%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	335106	335903	.	-	.	ID=gene263;Name=MMSYN1_0259;gbkey=Gene;locus_tag=MMSYN1_0259
CP002027.1	Genbank	CDS	335106	335903	.	-	0	ID=cds246;Parent=gene263;Dbxref=NCBI_GP:ADH22077.1;Name=ADH22077.1;Note=identified by match to protein family HMM PF01513;gbkey=CDS;product=NAD(+)/nadh kinase%2C putative;protein_id=ADH22077.1;transl_table=4
CP002027.1	Genbank	sequence_feature	335816	336895	.	+	.	ID=id347;Note=mmyc51%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	336014	338632	.	-	.	ID=gene264;Name=valS;gbkey=Gene;gene=valS;locus_tag=MMSYN1_0260
CP002027.1	Genbank	CDS	336014	338632	.	-	0	ID=cds247;Parent=gene264;Dbxref=NCBI_GP:ADH21998.1;Name=ADH21998.1;Note=identified by match to protein family HMM PF00133%3B match to protein family HMM PF08264%3B match to protein family HMM PF09334%3B match to protein family HMM TIGR00422;gbkey=CDS;gene=valS;product=valine--tRNA ligase;protein_id=ADH21998.1;transl_table=4
CP002027.1	Genbank	sequence_feature	336816	337895	.	+	.	ID=id348;Note=mmyc52%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	337816	338895	.	+	.	ID=id349;Note=mmyc53%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	338719	339345	.	-	.	ID=gene265;Name=thiN;Note=contains an 85 bp insertion that occured during the genome synthethis process%3B this gene model represents a disrupted reading frame with multiple genetic anomalies%3B identified by match to protein family HMM PF04263%3B match to protein family HMM TIGR01378;description=thiamine diphosphokinase;gbkey=Gene;gene=thiN;locus_tag=MMSYN1_0261;pseudo=true
CP002027.1	Genbank	sequence_feature	338816	339980	.	+	.	ID=id350;Note=mmyc54%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_difference	338895	338979	.	+	.	ID=id351;Note=insertion%3B 85 base insertion in sMmYCp235-1 not in design of JCVI-syn1%3B Disrupts CDS: thiamine pyrophosphokinase%3B Insertion appears to be duplication.;gbkey=misc_difference
CP002027.1	Genbank	gene	339335	340097	.	-	.	ID=gene266;Name=rpe;description=ribulose-phosphate 3-epimerase;gbkey=Gene;gene=rpe;locus_tag=MMSYN1_0262
CP002027.1	Genbank	sequence_feature	339901	340980	.	+	.	ID=id352;Note=mmyc55%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	340099	341001	.	-	.	ID=gene267;Name=rsgA;gbkey=Gene;gene=rsgA;locus_tag=MMSYN1_0263
CP002027.1	Genbank	CDS	340099	341001	.	-	0	ID=cds248;Parent=gene267;Dbxref=NCBI_GP:ADH21867.1;Name=ADH21867.1;Note=identified by match to protein family HMM PF03193%3B match to protein family HMM TIGR00157;gbkey=CDS;gene=rsgA;product=ribosome small subunit-dependent GTPase A;protein_id=ADH21867.1;transl_table=4
CP002027.1	Genbank	sequence_feature	340901	341899	.	+	.	ID=id353;Note=mmyc56a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	341011	342126	.	-	.	ID=gene268;Name=MMSYN1_0264;gbkey=Gene;locus_tag=MMSYN1_0264
CP002027.1	Genbank	CDS	341011	342126	.	-	0	ID=cds249;Parent=gene268;Dbxref=NCBI_GP:ADH21663.1;Name=ADH21663.1;Note=identified by match to protein family HMM PF00069;gbkey=CDS;product=serine/threonine protein kinase;protein_id=ADH21663.1;transl_table=4
CP002027.1	Genbank	sequence_feature	341818	342512	.	+	.	ID=id354;Note=mmyc58a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	342126	342883	.	-	.	ID=gene269;Name=MMSYN1_0268;Note=serine/threonine phosphatase%2C degenerate%3B this region contains one or more premature stops and/or frameshifts;gbkey=Gene;locus_tag=MMSYN1_0268;pseudo=true
CP002027.1	Genbank	sequence_feature	342413	343492	.	+	.	ID=id355;Note=mmyc59%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	342912	344321	.	-	.	ID=gene270;Name=MMSYN1_0269;gbkey=Gene;locus_tag=MMSYN1_0269
CP002027.1	Genbank	CDS	342912	344321	.	-	0	ID=cds250;Parent=gene270;Dbxref=NCBI_GP:ADH21714.1;Name=ADH21714.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21714.1;transl_table=4
CP002027.1	Genbank	sequence_feature	343413	344492	.	+	.	ID=id356;Note=mmyc60%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	344413	345492	.	+	.	ID=id357;Note=mmyc61%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	344441	344857	.	+	.	ID=gene271;Name=MMSYN1_0270;gbkey=Gene;locus_tag=MMSYN1_0270
CP002027.1	Genbank	CDS	344441	344857	.	+	0	ID=cds251;Parent=gene271;Dbxref=NCBI_GP:ADH21776.1;Name=ADH21776.1;Note=identified by match to protein family HMM PF02367%3B match to protein family HMM TIGR00150;gbkey=CDS;product=ATPase%2C YjeE family;protein_id=ADH21776.1;transl_table=4
CP002027.1	Genbank	gene	344859	345422	.	+	.	ID=gene272;Name=MMSYN1_0271;gbkey=Gene;locus_tag=MMSYN1_0271
CP002027.1	Genbank	CDS	344859	345422	.	+	0	ID=cds252;Parent=gene272;Dbxref=NCBI_GP:ADH21857.1;Name=ADH21857.1;Note=identified by match to protein family HMM PF00814%3B match to protein family HMM TIGR03725;gbkey=CDS;product=glycoprotease family protein;protein_id=ADH21857.1;transl_table=4
CP002027.1	Genbank	sequence_feature	345413	346492	.	+	.	ID=id358;Note=mmyc62%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	345458	350779	.	-	.	ID=gene273;Name=MMSYN1_0272;gbkey=Gene;locus_tag=MMSYN1_0272
CP002027.1	Genbank	CDS	345458	350779	.	-	0	ID=cds253;Parent=gene273;Dbxref=NCBI_GP:ADH22001.1;Name=ADH22001.1;Note=identified by match to protein family HMM PF02687;gbkey=CDS;product=efflux ABC transporter%2C permease protein;protein_id=ADH22001.1;transl_table=4
CP002027.1	Genbank	sequence_feature	346413	347492	.	+	.	ID=id359;Note=mmyc63%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	347413	348492	.	+	.	ID=id360;Note=mmyc64%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	348413	349492	.	+	.	ID=id361;Note=mmyc65%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_difference	348827	348827	.	+	.	ID=id362;Note=SNP%3B T (JCVI-syn1) -> A (sMmYCp235-1)%2C Leu (JCVI-syn1) -> Phe (sMmYCp235-1)%2C CDS: efflux ABC transporter%2C permease protein;gbkey=misc_difference;replace=t
CP002027.1	Genbank	sequence_feature	349413	350492	.	+	.	ID=id363;Note=mmyc66%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	350413	351492	.	+	.	ID=id364;Note=mmyc67%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	350992	354132	.	+	.	ID=gene274;Name=MMSYN1_0273;gbkey=Gene;locus_tag=MMSYN1_0273
CP002027.1	Genbank	CDS	350992	354132	.	+	0	ID=cds254;Parent=gene274;Dbxref=NCBI_GP:ADH22148.1;Name=ADH22148.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22148.1;transl_table=4
CP002027.1	Genbank	sequence_feature	351413	352492	.	+	.	ID=id365;Note=mmyc68%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	352413	353492	.	+	.	ID=id366;Note=mmyc69%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	353413	354492	.	+	.	ID=id367;Note=mmyc70%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	354147	354761	.	+	.	ID=gene275;Name=MMSYN1_0274;gbkey=Gene;locus_tag=MMSYN1_0274
CP002027.1	Genbank	CDS	354147	354761	.	+	0	ID=cds255;Parent=gene275;Dbxref=NCBI_GP:ADH22204.1;Name=ADH22204.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22204.1;transl_table=4
CP002027.1	Genbank	sequence_feature	354413	355492	.	+	.	ID=id368;Note=mmyc71%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	354901	355422	.	+	.	ID=gene276;Name=MMSYN1_0275;gbkey=Gene;locus_tag=MMSYN1_0275
CP002027.1	Genbank	CDS	354901	355422	.	+	0	ID=cds256;Parent=gene276;Dbxref=NCBI_GP:ADH22187.1;Name=ADH22187.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22187.1;transl_table=4
CP002027.1	Genbank	sequence_feature	355413	356492	.	+	.	ID=id369;Note=mmyc72%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	355682	356302	.	+	.	ID=gene277;Name=MMSYN1_0276;Note=putative liporotein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0276;pseudo=true
CP002027.1	Genbank	sequence_feature	356413	357492	.	+	.	ID=id370;Note=mmyc73%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	356463	356975	.	+	.	ID=gene278;Name=MMSYN1_0277;gbkey=Gene;locus_tag=MMSYN1_0277
CP002027.1	Genbank	CDS	356463	356975	.	+	0	ID=cds257;Parent=gene278;Dbxref=NCBI_GP:ADH21697.1;Name=ADH21697.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21697.1;transl_table=4
CP002027.1	Genbank	gene	357015	359429	.	-	.	ID=gene279;Name=MMSYN1_0278;gbkey=Gene;locus_tag=MMSYN1_0278
CP002027.1	Genbank	CDS	357015	359429	.	-	0	ID=cds258;Parent=gene279;Dbxref=NCBI_GP:ADH21508.1;Name=ADH21508.1;Note=identified by match to protein family HMM PF00359%3B match to protein family HMM PF02378%3B match to protein family HMM PF02379%3B match to protein family HMM TIGR00829%3B match to protein family HMM TIGR00848%3B match to protein family HMM TIGR01427;gbkey=CDS;product=PTS system fructose-specific enzyme iiabc component;protein_id=ADH21508.1;transl_table=4
CP002027.1	Genbank	sequence_feature	357413	358492	.	+	.	ID=id371;Note=mmyc74%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	358413	359492	.	+	.	ID=id372;Note=mmyc75%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	359413	360492	.	+	.	ID=id373;Note=mmyc76%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	359688	359975	.	+	.	ID=gene280;Name=MMSYN1_0279;gbkey=Gene;locus_tag=MMSYN1_0279
CP002027.1	Genbank	CDS	359688	359975	.	+	0	ID=cds259;Parent=gene280;Dbxref=NCBI_GP:ADH21767.1;Name=ADH21767.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21767.1;transl_table=4
CP002027.1	Genbank	gene	360219	360308	.	+	.	ID=gene281;Name=MMSYN1_0280;gbkey=Gene;locus_tag=MMSYN1_0280
CP002027.1	Genbank	tRNA	360219	360308	.	+	.	ID=rna9;Parent=gene281;gbkey=tRNA;product=tRNA-Ser
CP002027.1	Genbank	exon	360219	360308	.	+	.	ID=id374;Parent=rna9;gbkey=tRNA;product=tRNA-Ser
CP002027.1	Genbank	sequence_feature	360413	361492	.	+	.	ID=id375;Note=mmyc77%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	360428	361108	.	+	.	ID=gene282;Name=MMSYN1_0281;gbkey=Gene;locus_tag=MMSYN1_0281
CP002027.1	Genbank	CDS	360428	361108	.	+	0	ID=cds260;Parent=gene282;Dbxref=NCBI_GP:ADH22151.1;Name=ADH22151.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22151.1;transl_table=4
CP002027.1	Genbank	gene	361089	362513	.	+	.	ID=gene283;Name=proS;gbkey=Gene;gene=proS;locus_tag=MMSYN1_0282
CP002027.1	Genbank	CDS	361089	362513	.	+	0	ID=cds261;Parent=gene283;Dbxref=NCBI_GP:ADH21675.1;Name=ADH21675.1;Note=identified by match to protein family HMM PF00587%3B match to protein family HMM PF03129%3B match to protein family HMM PF09180%3B match to protein family HMM TIGR00408;gbkey=CDS;gene=proS;product=proline--tRNA ligase;protein_id=ADH21675.1;transl_table=4
CP002027.1	Genbank	sequence_feature	361413	362492	.	+	.	ID=id376;Note=mmyc78%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=proS
CP002027.1	Genbank	sequence_feature	362413	363492	.	+	.	ID=id377;Note=mmyc79%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	362526	363143	.	+	.	ID=gene284;Name=rnhA;gbkey=Gene;gene=rnhA;locus_tag=MMSYN1_0283
CP002027.1	Genbank	CDS	362526	363143	.	+	0	ID=cds262;Parent=gene284;Dbxref=NCBI_GP:ADH21819.1;Name=ADH21819.1;Note=identified by match to protein family HMM PF00075;gbkey=CDS;gene=rnhA;product=ribonuclease HI;protein_id=ADH21819.1;transl_table=4
CP002027.1	Genbank	gene	363145	364032	.	+	.	ID=gene285;Name=MMSYN1_0284;gbkey=Gene;locus_tag=MMSYN1_0284
CP002027.1	Genbank	CDS	363145	364032	.	+	0	ID=cds263;Parent=gene285;Dbxref=NCBI_GP:ADH21610.1;Name=ADH21610.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21610.1;transl_table=4
CP002027.1	Genbank	sequence_feature	363413	364492	.	+	.	ID=id378;Note=mmyc80%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	364056	365858	.	+	.	ID=gene286;Name=lepA;gbkey=Gene;gene=lepA;locus_tag=MMSYN1_0285
CP002027.1	Genbank	CDS	364056	365858	.	+	0	ID=cds264;Parent=gene286;Dbxref=NCBI_GP:ADH21689.1;Name=ADH21689.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF00679%3B match to protein family HMM PF03144%3B match to protein family HMM PF06421%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR01393;gbkey=CDS;gene=lepA;product=GTP-binding protein LepA;protein_id=ADH21689.1;transl_table=4
CP002027.1	Genbank	sequence_feature	364413	365492	.	+	.	ID=id379;Note=mmyc81%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lepA
CP002027.1	Genbank	sequence_feature	365413	366492	.	+	.	ID=id380;Note=mmyc82%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	365884	366690	.	+	.	ID=gene287;Name=MMSYN1_0286;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0286;pseudo=true
CP002027.1	Genbank	sequence_feature	366413	367492	.	+	.	ID=id381;Note=mmyc83%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	366707	368431	.	-	.	ID=gene288;Name=aspS;gbkey=Gene;gene=aspS;locus_tag=MMSYN1_0287
CP002027.1	Genbank	CDS	366707	368431	.	-	0	ID=cds265;Parent=gene288;Dbxref=NCBI_GP:ADH21744.1;Name=ADH21744.1;Note=identified by match to protein family HMM PF00152%3B match to protein family HMM PF00587%3B match to protein family HMM PF01336%3B match to protein family HMM PF02938%3B match to protein family HMM TIGR00459;gbkey=CDS;gene=aspS;product=aspartate--tRNA ligase;protein_id=ADH21744.1;transl_table=4
CP002027.1	Genbank	sequence_feature	367413	368492	.	+	.	ID=id382;Note=mmyc84%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	368413	369492	.	+	.	ID=id383;Note=mmyc85%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	368440	369684	.	-	.	ID=gene289;Name=hisS;gbkey=Gene;gene=hisS;locus_tag=MMSYN1_0288
CP002027.1	Genbank	CDS	368440	369684	.	-	0	ID=cds266;Parent=gene289;Dbxref=NCBI_GP:ADH21950.1;Name=ADH21950.1;Note=identified by match to protein family HMM PF00587%3B match to protein family HMM TIGR00442;gbkey=CDS;gene=hisS;product=histidine--tRNA ligase;protein_id=ADH21950.1;transl_table=4
CP002027.1	Genbank	sequence_feature	369413	370492	.	+	.	ID=id384;Note=mmyc86%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	369869	370222	.	+	.	ID=gene290;Name=rbfA;gbkey=Gene;gene=rbfA;locus_tag=MMSYN1_0289
CP002027.1	Genbank	CDS	369869	370222	.	+	0	ID=cds267;Parent=gene290;Dbxref=NCBI_GP:ADH22025.1;Name=ADH22025.1;Note=identified by match to protein family HMM PF02033%3B match to protein family HMM TIGR00082;gbkey=CDS;gene=rbfA;product=ribosome-binding factor A;protein_id=ADH22025.1;transl_table=4
CP002027.1	Genbank	gene	370272	371150	.	+	.	ID=gene291;Name=truB;gbkey=Gene;gene=truB;locus_tag=MMSYN1_0290
CP002027.1	Genbank	CDS	370272	371150	.	+	0	ID=cds268;Parent=gene291;Dbxref=NCBI_GP:ADH22120.1;Name=ADH22120.1;Note=identified by match to protein family HMM PF01509%3B match to protein family HMM TIGR00431;gbkey=CDS;gene=truB;product=tRNA pseudouridine synthase B;protein_id=ADH22120.1;transl_table=4
CP002027.1	Genbank	sequence_feature	370413	371492	.	+	.	ID=id385;Note=mmyc87%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	371137	371691	.	+	.	ID=gene292;Name=MMSYN1_0291;gbkey=Gene;locus_tag=MMSYN1_0291
CP002027.1	Genbank	CDS	371137	371691	.	+	0	ID=cds269;Parent=gene292;Dbxref=NCBI_GP:ADH21667.1;Name=ADH21667.1;Note=identified by match to protein family HMM PF01467%3B match to protein family HMM PF06574;gbkey=CDS;product=riboflavin kinase (Flavokinase);protein_id=ADH21667.1;transl_table=4
CP002027.1	Genbank	sequence_feature	371413	372492	.	+	.	ID=id386;Note=mmyc88%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	371714	373759	.	-	.	ID=gene293;Name=MMSYN1_0292;gbkey=Gene;locus_tag=MMSYN1_0292
CP002027.1	Genbank	CDS	371714	373759	.	-	0	ID=cds270;Parent=gene293;Dbxref=NCBI_GP:ADH21595.1;Name=ADH21595.1;Note=identified by match to protein family HMM PF03572;gbkey=CDS;product=peptidase%2C S41 family;protein_id=ADH21595.1;transl_table=4
CP002027.1	Genbank	sequence_feature	372413	373492	.	+	.	ID=id387;Note=mmyc89%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	373413	374492	.	+	.	ID=id388;Note=mmyc90%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	373784	375754	.	-	.	ID=gene294;Name=MMSYN1_0293;gbkey=Gene;locus_tag=MMSYN1_0293
CP002027.1	Genbank	CDS	373784	375754	.	-	0	ID=cds271;Parent=gene294;Dbxref=NCBI_GP:ADH21495.1;Name=ADH21495.1;Note=identified by match to protein family HMM PF03572;gbkey=CDS;product=putative liporotein;protein_id=ADH21495.1;transl_table=4
CP002027.1	Genbank	sequence_feature	374413	375492	.	+	.	ID=id389;Note=mmyc91%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	375413	376492	.	+	.	ID=id390;Note=mmyc92%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	375967	376233	.	+	.	ID=gene295;Name=rpsO;gbkey=Gene;gene=rpsO;locus_tag=MMSYN1_0294
CP002027.1	Genbank	CDS	375967	376233	.	+	0	ID=cds272;Parent=gene295;Dbxref=NCBI_GP:ADH21935.1;Name=ADH21935.1;Note=identified by match to protein family HMM PF00312%3B match to protein family HMM TIGR00952;gbkey=CDS;gene=rpsO;product=ribosomal protein S15;protein_id=ADH21935.1;transl_table=4
CP002027.1	Genbank	gene	376293	376366	.	+	.	ID=gene296;Name=MMSYN1_0295;gbkey=Gene;locus_tag=MMSYN1_0295
CP002027.1	Genbank	tRNA	376293	376366	.	+	.	ID=rna10;Parent=gene296;gbkey=tRNA;product=tRNA-Gly
CP002027.1	Genbank	exon	376293	376366	.	+	.	ID=id391;Parent=rna10;gbkey=tRNA;product=tRNA-Gly
CP002027.1	Genbank	sequence_feature	376413	377492	.	+	.	ID=id392;Note=mmyc93%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	376464	377108	.	+	.	ID=gene297;Name=MMSYN1_0296;gbkey=Gene;locus_tag=MMSYN1_0296
CP002027.1	Genbank	CDS	376464	377108	.	+	0	ID=cds273;Parent=gene297;Dbxref=NCBI_GP:ADH21655.1;Name=ADH21655.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21655.1;transl_table=4
CP002027.1	Genbank	gene	377127	378989	.	-	.	ID=gene298;Name=infB;gbkey=Gene;gene=infB;locus_tag=MMSYN1_0297
CP002027.1	Genbank	CDS	377127	378989	.	-	0	ID=cds274;Parent=gene298;Dbxref=NCBI_GP:ADH22157.1;Name=ADH22157.1;Note=identified by match to protein family HMM PF00009%3B match to protein family HMM PF01926%3B match to protein family HMM PF03144%3B match to protein family HMM PF04760%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR00487;gbkey=CDS;gene=infB;product=translation initiation factor IF-2;protein_id=ADH22157.1;transl_table=4
CP002027.1	Genbank	sequence_feature	377413	378492	.	+	.	ID=id393;Note=mmyc94%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	378413	379492	.	+	.	ID=id394;Note=mmyc95%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	379011	379310	.	-	.	ID=gene299;Name=MMSYN1_0298;gbkey=Gene;locus_tag=MMSYN1_0298
CP002027.1	Genbank	CDS	379011	379310	.	-	0	ID=cds275;Parent=gene299;Dbxref=NCBI_GP:ADH21891.1;Name=ADH21891.1;Note=identified by match to protein family HMM PF01248;gbkey=CDS;product=ribosomal protein L7A family;protein_id=ADH21891.1;transl_table=4
CP002027.1	Genbank	gene	379297	379578	.	-	.	ID=gene300;Name=MMSYN1_0299;gbkey=Gene;locus_tag=MMSYN1_0299
CP002027.1	Genbank	CDS	379297	379578	.	-	0	ID=cds276;Parent=gene300;Dbxref=NCBI_GP:ADH21539.1;Name=ADH21539.1;Note=identified by match to protein family HMM PF04296;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21539.1;transl_table=4
CP002027.1	Genbank	sequence_feature	379413	380492	.	+	.	ID=id395;Note=mmyc96%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	379559	381313	.	-	.	ID=gene301;Name=nusA;gbkey=Gene;gene=nusA;locus_tag=MMSYN1_0300
CP002027.1	Genbank	CDS	379559	381313	.	-	0	ID=cds277;Parent=gene301;Dbxref=NCBI_GP:ADH22106.1;Name=ADH22106.1;Note=identified by match to protein family HMM PF08529%3B match to protein family HMM TIGR01953;gbkey=CDS;gene=nusA;product=transcription elongation factor NusA;protein_id=ADH22106.1;transl_table=4
CP002027.1	Genbank	sequence_feature	380413	381492	.	+	.	ID=id396;Note=mmyc97%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	381322	381816	.	-	.	ID=gene302;Name=MMSYN1_0301;gbkey=Gene;locus_tag=MMSYN1_0301
CP002027.1	Genbank	CDS	381322	381816	.	-	0	ID=cds278;Parent=gene302;Dbxref=NCBI_GP:ADH21725.1;Name=ADH21725.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21725.1;transl_table=4
CP002027.1	Genbank	sequence_feature	381413	382492	.	+	.	ID=id397;Note=mmyc98%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	381929	382579	.	-	.	ID=gene303;Name=MMSYN1_0302;gbkey=Gene;locus_tag=MMSYN1_0302
CP002027.1	Genbank	CDS	381929	382579	.	-	0	ID=cds279;Parent=gene303;Dbxref=NCBI_GP:ADH21928.1;Name=ADH21928.1;Note=identified by match to protein family HMM PF00881;gbkey=CDS;product=nitroreductase family protein;protein_id=ADH21928.1;transl_table=4
CP002027.1	Genbank	sequence_feature	382413	383492	.	+	.	ID=id398;Note=mmyc99%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	382592	387040	.	-	.	ID=gene304;Name=polC;gbkey=Gene;gene=polC;locus_tag=MMSYN1_0303
CP002027.1	Genbank	CDS	382592	387040	.	-	0	ID=cds280;Parent=gene304;Dbxref=NCBI_GP:ADH21931.1;Name=ADH21931.1;Note=identified by match to protein family HMM PF00929%3B match to protein family HMM PF01336%3B match to protein family HMM PF02811%3B match to protein family HMM PF07733%3B match to protein family HMM TIGR00573%3B match to protein family HMM TIGR01405;gbkey=CDS;gene=polC;product=DNA polymerase III%2C alpha subunit%2C Gram-positive type;protein_id=ADH21931.1;transl_table=4
CP002027.1	Genbank	sequence_feature	383413	384492	.	+	.	ID=id399;Note=mmyc100%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	384413	385492	.	+	.	ID=id400;Note=mmyc101%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	385413	386492	.	+	.	ID=id401;Note=mmyc102%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	386413	387492	.	+	.	ID=id402;Note=mmyc103%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	387049	388077	.	-	.	ID=gene305;Name=cdsA;gbkey=Gene;gene=cdsA;locus_tag=MMSYN1_0304
CP002027.1	Genbank	CDS	387049	388077	.	-	0	ID=cds281;Parent=gene305;Dbxref=NCBI_GP:ADH21783.1;Name=ADH21783.1;Note=identified by match to protein family HMM PF01148;gbkey=CDS;gene=cdsA;product=phosphatidate cytidylyltransferase;protein_id=ADH21783.1;transl_table=4
CP002027.1	Genbank	sequence_feature	387413	388492	.	+	.	ID=id403;Note=mmyc104%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	388276	389352	.	-	.	ID=gene306;Name=MMSYN1_0305;gbkey=Gene;locus_tag=MMSYN1_0305
CP002027.1	Genbank	CDS	388276	389352	.	-	0	ID=cds282;Parent=gene306;Dbxref=NCBI_GP:ADH21734.1;Name=ADH21734.1;Note=identified by match to protein family HMM PF00557%3B match to protein family HMM PF01321;gbkey=CDS;product=peptidase%2C M24 family;protein_id=ADH21734.1;transl_table=4
CP002027.1	Genbank	sequence_feature	388413	389492	.	+	.	ID=id404;Note=mmyc105%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	389413	390505	.	+	.	ID=id405;Note=mmycWM3%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	389506	390282	.	-	.	ID=gene307;Name=MMSYN1_0306;gbkey=Gene;locus_tag=MMSYN1_0306
CP002027.1	Genbank	CDS	389506	390282	.	-	0	ID=cds283;Parent=gene307;Dbxref=NCBI_GP:ADH21621.1;Name=ADH21621.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21621.1;transl_table=4
CP002027.1	Genbank	sequence_feature	390426	391505	.	+	.	ID=id406;Note=mmyc107%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	390558	390911	.	+	.	ID=gene308;Name=MMSYN1_0307;gbkey=Gene;locus_tag=MMSYN1_0307
CP002027.1	Genbank	CDS	390558	390911	.	+	0	ID=cds284;Parent=gene308;Dbxref=NCBI_GP:ADH21565.1;Name=ADH21565.1;gbkey=CDS;product=integrase core domain protein;protein_id=ADH21565.1;transl_table=4
CP002027.1	Genbank	gene	391003	392013	.	+	.	ID=gene309;Name=trpS;gbkey=Gene;gene=trpS;locus_tag=MMSYN1_0308
CP002027.1	Genbank	CDS	391003	392013	.	+	0	ID=cds285;Parent=gene309;Dbxref=NCBI_GP:ADH22232.1;Name=ADH22232.1;Note=identified by match to protein family HMM PF00579%3B match to protein family HMM TIGR00233;gbkey=CDS;gene=trpS;product=tryptophan--tRNA ligase;protein_id=ADH22232.1;transl_table=4
CP002027.1	Genbank	sequence_feature	391426	392505	.	+	.	ID=id407;Note=mmyc108%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	392042	392911	.	-	.	ID=gene310;Name=MMSYN1_0309;gbkey=Gene;locus_tag=MMSYN1_0309
CP002027.1	Genbank	CDS	392042	392911	.	-	0	ID=cds286;Parent=gene310;Dbxref=NCBI_GP:ADH22107.1;Name=ADH22107.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22107.1;transl_table=4
CP002027.1	Genbank	sequence_feature	392426	393505	.	+	.	ID=id408;Note=mmyc109%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	393024	393824	.	+	.	ID=gene311;Name=MMSYN1_0310;gbkey=Gene;locus_tag=MMSYN1_0310
CP002027.1	Genbank	CDS	393024	393824	.	+	0	ID=cds287;Parent=gene311;Dbxref=NCBI_GP:ADH22004.1;Name=ADH22004.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22004.1;transl_table=4
CP002027.1	Genbank	sequence_feature	393426	394505	.	+	.	ID=id409;Note=mmyc110%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	393879	394955	.	-	.	ID=gene312;Name=MMSYN1_0311;gbkey=Gene;locus_tag=MMSYN1_0311
CP002027.1	Genbank	CDS	393879	394955	.	-	0	ID=cds288;Parent=gene312;Dbxref=NCBI_GP:ADH22019.1;Name=ADH22019.1;Note=identified by match to protein family HMM PF02646;gbkey=CDS;product=RmuC domain protein;protein_id=ADH22019.1;transl_table=4
CP002027.1	Genbank	sequence_feature	394426	395505	.	+	.	ID=id410;Note=mmyc111%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	395171	397891	.	+	.	ID=gene313;Name=MMSYN1_0312;gbkey=Gene;locus_tag=MMSYN1_0312
CP002027.1	Genbank	CDS	395171	397891	.	+	0	ID=cds289;Parent=gene313;Dbxref=NCBI_GP:ADH22215.1;Name=ADH22215.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22215.1;transl_table=4
CP002027.1	Genbank	sequence_feature	395426	396505	.	+	.	ID=id411;Note=mmyc112%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	396426	397505	.	+	.	ID=id412;Note=mmyc113%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	397426	398505	.	+	.	ID=id413;Note=mmyc114%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	398248	399522	.	+	.	ID=gene314;Name=trmFO2;gbkey=Gene;gene=trmFO2;locus_tag=MMSYN1_0313
CP002027.1	Genbank	CDS	398248	399522	.	+	0	ID=cds290;Parent=gene314;Dbxref=NCBI_GP:ADH22198.1;Name=ADH22198.1;Note=identified by match to protein family HMM PF01134;gbkey=CDS;gene=trmFO2;product=methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase trmFO 2;protein_id=ADH22198.1;transl_table=4
CP002027.1	Genbank	sequence_feature	398426	399505	.	+	.	ID=id414;Note=mmyc115%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=trmFO2
CP002027.1	Genbank	sequence_feature	399426	400505	.	+	.	ID=id415;Note=mmyc116%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	399627	400361	.	+	.	ID=gene315;Name=MMSYN1_0314;gbkey=Gene;locus_tag=MMSYN1_0314
CP002027.1	Genbank	CDS	399627	400361	.	+	0	ID=cds291;Parent=gene315;Dbxref=NCBI_GP:ADH22083.1;Name=ADH22083.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22083.1;transl_table=4
CP002027.1	Genbank	sequence_feature	400426	401505	.	+	.	ID=id416;Note=mmyc117%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	400483	400635	.	+	.	ID=gene316;Name=MMSYN1_0315;gbkey=Gene;locus_tag=MMSYN1_0315
CP002027.1	Genbank	CDS	400483	400635	.	+	0	ID=cds292;Parent=gene316;Dbxref=NCBI_GP:ADH21518.1;Name=ADH21518.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21518.1;transl_table=4
CP002027.1	Genbank	gene	400694	402664	.	+	.	ID=gene317;Name=tkt;gbkey=Gene;gene=tkt;locus_tag=MMSYN1_0316
CP002027.1	Genbank	CDS	400694	402664	.	+	0	ID=cds293;Parent=gene317;Dbxref=NCBI_GP:ADH21844.1;Name=ADH21844.1;Note=identified by match to protein family HMM PF00456%3B match to protein family HMM PF02779%3B match to protein family HMM PF02780%3B match to protein family HMM TIGR00232;gbkey=CDS;gene=tkt;product=transketolase;protein_id=ADH21844.1;transl_table=4
CP002027.1	Genbank	sequence_feature	401426	402505	.	+	.	ID=id417;Note=mmyc118%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=tkt
CP002027.1	Genbank	sequence_feature	402426	403505	.	+	.	ID=id418;Note=mmyc119%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	402680	402925	.	+	.	ID=gene318;Name=MMSYN1_0317;gbkey=Gene;locus_tag=MMSYN1_0317
CP002027.1	Genbank	CDS	402680	402925	.	+	0	ID=cds294;Parent=gene318;Dbxref=NCBI_GP:ADH21758.1;Name=ADH21758.1;Note=identified by match to protein family HMM PF03672;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21758.1;transl_table=4
CP002027.1	Genbank	gene	402993	404537	.	+	.	ID=gene319;Name=MMSYN1_0318;gbkey=Gene;locus_tag=MMSYN1_0318
CP002027.1	Genbank	CDS	402993	404537	.	+	0	ID=cds295;Parent=gene319;Dbxref=NCBI_GP:ADH22051.1;Name=ADH22051.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22051.1;transl_table=4
CP002027.1	Genbank	sequence_feature	403426	404505	.	+	.	ID=id419;Note=mmyc120%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	404426	405505	.	+	.	ID=id420;Note=mmyc121%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	404627	407524	.	+	.	ID=gene320;Name=MMSYN1_0319;gbkey=Gene;locus_tag=MMSYN1_0319
CP002027.1	Genbank	CDS	404627	407524	.	+	0	ID=cds296;Parent=gene320;Dbxref=NCBI_GP:ADH22180.1;Name=ADH22180.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22180.1;transl_table=4
CP002027.1	Genbank	sequence_feature	405426	406505	.	+	.	ID=id421;Note=mmyc122%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010) An A to G mutation was present in some molecules of the chemically synthesized cassette mmyc122. This mutation was incorporated into the assembled genome%2C resulting in a new HaeIII site. This mutation changed the original mmyc122 cassette sequence from AAATATGACTATAATTTAACAGATGGACC to AAATATGACTATAATTTAACAGATGGGCC in the final molecule. These substrings of the mmyc122 cassette sequence uniquely identify the HaeIII site within the final molecule. This silent mutation was accepted as a feature of the designed sequence of M. mycoides JCVI-syn1.;gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	406426	407505	.	+	.	ID=id422;Note=mmyc123%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	407426	408505	.	+	.	ID=id423;Note=mmyc124%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	407532	408329	.	+	.	ID=gene321;Name=MMSYN1_0320;gbkey=Gene;locus_tag=MMSYN1_0320
CP002027.1	Genbank	CDS	407532	408329	.	+	0	ID=cds297;Parent=gene321;Dbxref=NCBI_GP:ADH22111.1;Name=ADH22111.1;Note=identified by match to protein family HMM PF00561;gbkey=CDS;product=triacylglycerol lipase;protein_id=ADH22111.1;transl_table=4
CP002027.1	Genbank	sequence_feature	408426	409505	.	+	.	ID=id424;Note=mmyc125%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	408482	408910	.	+	.	ID=gene322;Name=MMSYN1_0321;Note=putative liporotein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0321;pseudo=true
CP002027.1	Genbank	gene	409235	410692	.	+	.	ID=gene323;Name=MMSYN1_0322;gbkey=Gene;locus_tag=MMSYN1_0322
CP002027.1	Genbank	CDS	409235	410692	.	+	0	ID=cds298;Parent=gene323;Dbxref=NCBI_GP:ADH21879.1;Name=ADH21879.1;Note=identified by match to protein family HMM PF04326;gbkey=CDS;product=divergent AAA domain family;protein_id=ADH21879.1;transl_table=4
CP002027.1	Genbank	sequence_feature	409426	410505	.	+	.	ID=id425;Note=mmyc126%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	410426	411505	.	+	.	ID=id426;Note=mmyc127%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	410710	412203	.	-	.	ID=gene324;Name=MMSYN1_0323;gbkey=Gene;locus_tag=MMSYN1_0323
CP002027.1	Genbank	CDS	410710	412203	.	-	0	ID=cds299;Parent=gene324;Dbxref=NCBI_GP:ADH21598.1;Name=ADH21598.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21598.1;transl_table=4
CP002027.1	Genbank	sequence_feature	411426	412505	.	+	.	ID=id427;Note=mmyc128%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	412372	412896	.	-	.	ID=gene325;Name=MMSYN1_0324;gbkey=Gene;locus_tag=MMSYN1_0324
CP002027.1	Genbank	CDS	412372	412896	.	-	0	ID=cds300;Parent=gene325;Dbxref=NCBI_GP:ADH22259.1;Name=ADH22259.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22259.1;transl_table=4
CP002027.1	Genbank	sequence_feature	412426	413505	.	+	.	ID=id428;Note=mmyc129%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	413426	414505	.	+	.	ID=id429;Note=mmyc130%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	414261	415751	.	+	.	ID=gene326;Name=MMSYN1_0325;gbkey=Gene;locus_tag=MMSYN1_0325
CP002027.1	Genbank	CDS	414261	415751	.	+	0	ID=cds301;Parent=gene326;Dbxref=NCBI_GP:ADH21812.1;Name=ADH21812.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21812.1;transl_table=4
CP002027.1	Genbank	sequence_feature	414426	415505	.	+	.	ID=id430;Note=mmyc131%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	415426	416505	.	+	.	ID=id431;Note=mmyc132%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	415769	416530	.	+	.	ID=gene327;Name=MMSYN1_0326;gbkey=Gene;locus_tag=MMSYN1_0326
CP002027.1	Genbank	CDS	415769	416530	.	+	0	ID=cds302;Parent=gene327;Dbxref=NCBI_GP:ADH21743.1;Name=ADH21743.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21743.1;transl_table=4
CP002027.1	Genbank	sequence_feature	416426	417505	.	+	.	ID=id432;Note=mmyc133%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	416540	417376	.	+	.	ID=gene328;Name=scpA;gbkey=Gene;gene=scpA;locus_tag=MMSYN1_0327
CP002027.1	Genbank	CDS	416540	417376	.	+	0	ID=cds303;Parent=gene328;Dbxref=NCBI_GP:ADH21853.1;Name=ADH21853.1;Note=identified by match to protein family HMM PF02616;gbkey=CDS;gene=scpA;product=ScpA protein;protein_id=ADH21853.1;transl_table=4
CP002027.1	Genbank	gene	417360	417989	.	+	.	ID=gene329;Name=scpB;gbkey=Gene;gene=scpB;locus_tag=MMSYN1_0328
CP002027.1	Genbank	CDS	417360	417989	.	+	0	ID=cds304;Parent=gene329;Dbxref=NCBI_GP:ADH21932.1;Name=ADH21932.1;Note=identified by match to protein family HMM PF04079%3B match to protein family HMM TIGR00281;gbkey=CDS;gene=scpB;product=segregation and condensation protein B;protein_id=ADH21932.1;transl_table=4
CP002027.1	Genbank	sequence_feature	417426	418505	.	+	.	ID=id433;Note=mmyc134%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	418057	418815	.	+	.	ID=gene330;Name=MMSYN1_0329;gbkey=Gene;locus_tag=MMSYN1_0329
CP002027.1	Genbank	CDS	418057	418815	.	+	0	ID=cds305;Parent=gene330;Dbxref=NCBI_GP:ADH22067.1;Name=ADH22067.1;Note=identified by match to protein family HMM PF00849%3B match to protein family HMM PF01479%3B match to protein family HMM TIGR00093;gbkey=CDS;product=ribosomal large subunit pseudouridine synthase B (rRNA-uridine isomerase B) (rRNA pseudouridylate synthase B);protein_id=ADH22067.1;transl_table=4
CP002027.1	Genbank	sequence_feature	418426	419505	.	+	.	ID=id434;Note=mmyc135%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	418825	419442	.	+	.	ID=gene331;Name=MMSYN1_0330;gbkey=Gene;locus_tag=MMSYN1_0330
CP002027.1	Genbank	CDS	418825	419442	.	+	0	ID=cds306;Parent=gene331;Dbxref=NCBI_GP:ADH22208.1;Name=ADH22208.1;Note=identified by match to protein family HMM PF01712;gbkey=CDS;product=deoxyguanosine kinase;protein_id=ADH22208.1;transl_table=4
CP002027.1	Genbank	sequence_feature	419426	420505	.	+	.	ID=id435;Note=mmyc136%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	419454	420167	.	+	.	ID=gene332;Name=MMSYN1_0331;gbkey=Gene;locus_tag=MMSYN1_0331
CP002027.1	Genbank	CDS	419454	420167	.	+	0	ID=cds307;Parent=gene332;Dbxref=NCBI_GP:ADH22079.1;Name=ADH22079.1;Note=identified by match to protein family HMM PF01709;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22079.1;transl_table=4
CP002027.1	Genbank	gene	420267	421094	.	+	.	ID=gene333;Name=MMSYN1_0332;gbkey=Gene;locus_tag=MMSYN1_0332
CP002027.1	Genbank	CDS	420267	421094	.	+	0	ID=cds308;Parent=gene333;Dbxref=NCBI_GP:ADH22235.1;Name=ADH22235.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22235.1;transl_table=4
CP002027.1	Genbank	sequence_feature	420426	421505	.	+	.	ID=id436;Note=mmyc137%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	421426	422505	.	+	.	ID=id437;Note=mmyc138%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	421586	422005	.	+	.	ID=gene334;Name=vlcA;gbkey=Gene;gene=vlcA;locus_tag=MMSYN1_0333
CP002027.1	Genbank	CDS	421586	422005	.	+	0	ID=cds309;Parent=gene334;Dbxref=NCBI_GP:ADH21910.1;Name=ADH21910.1;gbkey=CDS;gene=vlcA;product=lipoprotein%2C putative (VlcA);protein_id=ADH21910.1;transl_table=4
CP002027.1	Genbank	sequence_feature	422426	423505	.	+	.	ID=id438;Note=mmyc139%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	422445	422924	.	+	.	ID=gene335;Name=vlcB;gbkey=Gene;gene=vlcB;locus_tag=MMSYN1_0334
CP002027.1	Genbank	CDS	422445	422924	.	+	0	ID=cds310;Parent=gene335;Dbxref=NCBI_GP:ADH21977.1;Name=ADH21977.1;gbkey=CDS;gene=vlcB;product=lipoprotein%2C putative (VlcB);protein_id=ADH21977.1;transl_table=4
CP002027.1	Genbank	gene	423315	423773	.	+	.	ID=gene336;Name=vlcC;gbkey=Gene;gene=vlcC;locus_tag=MMSYN1_0335
CP002027.1	Genbank	CDS	423315	423773	.	+	0	ID=cds311;Parent=gene336;Dbxref=NCBI_GP:ADH21934.1;Name=ADH21934.1;gbkey=CDS;gene=vlcC;product=lipoprotein%2C putative (VlcC);protein_id=ADH21934.1;transl_table=4
CP002027.1	Genbank	sequence_feature	423426	424505	.	+	.	ID=id439;Note=mmyc140%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	423939	424388	.	+	.	ID=gene337;Name=MMSYN1_0336;gbkey=Gene;locus_tag=MMSYN1_0336
CP002027.1	Genbank	CDS	423939	424388	.	+	0	ID=cds312;Parent=gene337;Dbxref=NCBI_GP:ADH21842.1;Name=ADH21842.1;Note=identified by match to protein family HMM PF00359;gbkey=CDS;product=PTS system%2C IIA component;protein_id=ADH21842.1;transl_table=4
CP002027.1	Genbank	gene	424400	426208	.	+	.	ID=gene338;Name=MMSYN1_0337;gbkey=Gene;locus_tag=MMSYN1_0337
CP002027.1	Genbank	CDS	424400	426208	.	+	0	ID=cds313;Parent=gene338;Dbxref=NCBI_GP:ADH22130.1;Name=ADH22130.1;Note=identified by match to protein family HMM PF02302%3B match to protein family HMM PF04215;gbkey=CDS;product=PTS system ascorbate-specific enzyme IIC/IIB;protein_id=ADH22130.1;transl_table=4
CP002027.1	Genbank	sequence_feature	424426	425505	.	+	.	ID=id440;Note=mmyc141%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	425426	426505	.	+	.	ID=id441;Note=mmyc142%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	426379	427098	.	+	.	ID=gene339;Name=MMSYN1_0338;gbkey=Gene;locus_tag=MMSYN1_0338
CP002027.1	Genbank	CDS	426379	427098	.	+	0	ID=cds314;Parent=gene339;Dbxref=NCBI_GP:ADH22031.1;Name=ADH22031.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22031.1;transl_table=4
CP002027.1	Genbank	sequence_feature	426426	427505	.	+	.	ID=id442;Note=mmyc143%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	427426	428505	.	+	.	ID=id443;Note=mmyc144%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	427501	429321	.	+	.	ID=gene340;Name=MMSYN1_0339;gbkey=Gene;locus_tag=MMSYN1_0339
CP002027.1	Genbank	CDS	427501	429321	.	+	0	ID=cds315;Parent=gene340;Dbxref=NCBI_GP:ADH21580.1;Name=ADH21580.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=Na+ ABC transporter%2C ATP-binding component;protein_id=ADH21580.1;transl_table=4
CP002027.1	Genbank	sequence_feature	428426	429505	.	+	.	ID=id444;Note=mmyc145%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	429337	431127	.	+	.	ID=gene341;Name=MMSYN1_0340;gbkey=Gene;locus_tag=MMSYN1_0340
CP002027.1	Genbank	CDS	429337	431127	.	+	0	ID=cds316;Parent=gene341;Dbxref=NCBI_GP:ADH21488.1;Name=ADH21488.1;gbkey=CDS;product=ABC transporter%2C permease protein %2C putative;protein_id=ADH21488.1;transl_table=4
CP002027.1	Genbank	sequence_feature	429426	430505	.	+	.	ID=id445;Note=mmyc146%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	430426	431505	.	+	.	ID=id446;Note=mmyc147%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	431156	432556	.	+	.	ID=gene342;Name=MMSYN1_0341;gbkey=Gene;locus_tag=MMSYN1_0341
CP002027.1	Genbank	CDS	431156	432556	.	+	0	ID=cds317;Parent=gene342;Dbxref=NCBI_GP:ADH21648.1;Name=ADH21648.1;gbkey=CDS;product=viral A-type inclusion protein%2C putative;protein_id=ADH21648.1;transl_table=4
CP002027.1	Genbank	sequence_feature	431426	432505	.	+	.	ID=id447;Note=mmyc148%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	432426	433505	.	+	.	ID=id448;Note=mmyc149%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	432682	434868	.	+	.	ID=gene343;Name=MMSYN1_0342;Note=putative liporotein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0342;pseudo=true
CP002027.1	Genbank	sequence_feature	433426	434505	.	+	.	ID=id449;Note=mmyc150%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	434426	435505	.	+	.	ID=id450;Note=mmyc151%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	435005	435700	.	+	.	ID=gene344;Name=MMSYN1_0343;gbkey=Gene;locus_tag=MMSYN1_0343
CP002027.1	Genbank	CDS	435005	435700	.	+	0	ID=cds318;Parent=gene344;Dbxref=NCBI_GP:ADH21871.1;Name=ADH21871.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21871.1;transl_table=4
CP002027.1	Genbank	sequence_feature	435426	436505	.	+	.	ID=id451;Note=mmyc152%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	435756	436316	.	-	.	ID=gene345;Name=ppa;gbkey=Gene;gene=ppa;locus_tag=MMSYN1_0344
CP002027.1	Genbank	CDS	435756	436316	.	-	0	ID=cds319;Parent=gene345;Dbxref=NCBI_GP:ADH22272.1;Name=ADH22272.1;Note=identified by match to protein family HMM PF00719;gbkey=CDS;gene=ppa;product=inorganic diphosphatase;protein_id=ADH22272.1;transl_table=4
CP002027.1	Genbank	sequence_feature	436426	437505	.	+	.	ID=id452;Note=mmyc153%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	436455	437345	.	+	.	ID=gene346;Name=MMSYN1_0345;gbkey=Gene;locus_tag=MMSYN1_0345
CP002027.1	Genbank	CDS	436455	437345	.	+	0	ID=cds320;Parent=gene346;Dbxref=NCBI_GP:ADH21482.1;Name=ADH21482.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21482.1;transl_table=4
CP002027.1	Genbank	gene	437411	438106	.	+	.	ID=gene347;Name=MMSYN1_0346;gbkey=Gene;locus_tag=MMSYN1_0346
CP002027.1	Genbank	CDS	437411	438106	.	+	0	ID=cds321;Parent=gene347;Dbxref=NCBI_GP:ADH21571.1;Name=ADH21571.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21571.1;transl_table=4
CP002027.1	Genbank	sequence_feature	437426	438505	.	+	.	ID=id453;Note=mmyc154%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	438115	438777	.	+	.	ID=gene348;Name=cmk;gbkey=Gene;gene=cmk;locus_tag=MMSYN1_0347
CP002027.1	Genbank	CDS	438115	438777	.	+	0	ID=cds322;Parent=gene348;Dbxref=NCBI_GP:ADH21777.1;Name=ADH21777.1;Note=identified by match to protein family HMM PF02224%3B match to protein family HMM TIGR00017;gbkey=CDS;gene=cmk;product=cytidylate kinase;protein_id=ADH21777.1;transl_table=4
CP002027.1	Genbank	sequence_feature	438426	439505	.	+	.	ID=id454;Note=mmyc155%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	438784	440091	.	+	.	ID=gene349;Name=engA;gbkey=Gene;gene=engA;locus_tag=MMSYN1_0348
CP002027.1	Genbank	CDS	438784	440091	.	+	0	ID=cds323;Parent=gene349;Dbxref=NCBI_GP:ADH21607.1;Name=ADH21607.1;Note=identified by match to protein family HMM PF00071%3B match to protein family HMM PF01926%3B match to protein family HMM PF08477%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR03594;gbkey=CDS;gene=engA;product=ribosome-associated GTPase EngA;protein_id=ADH21607.1;transl_table=4
CP002027.1	Genbank	sequence_feature	439426	440505	.	+	.	ID=id455;Note=mmyc156%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	440093	441082	.	+	.	ID=gene350;Name=gpsA;gbkey=Gene;gene=gpsA;locus_tag=MMSYN1_0349
CP002027.1	Genbank	CDS	440093	441082	.	+	0	ID=cds324;Parent=gene350;Dbxref=NCBI_GP:ADH21984.1;Name=ADH21984.1;Note=identified by match to protein family HMM PF01210%3B match to protein family HMM PF07479;gbkey=CDS;gene=gpsA;product=glycerol-3-phosphate dehydrogenase [NAD(P)+] (NAD(P)H-dependent glycerol-3-phosphate dehydrogenase);protein_id=ADH21984.1;transl_table=4
CP002027.1	Genbank	sequence_feature	440426	441505	.	+	.	ID=id456;Note=mmyc157%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	441114	441386	.	+	.	ID=gene351;Name=hup;gbkey=Gene;gene=hup;locus_tag=MMSYN1_0350
CP002027.1	Genbank	CDS	441114	441386	.	+	0	ID=cds325;Parent=gene351;Dbxref=NCBI_GP:ADH21852.1;Name=ADH21852.1;Note=identified by match to protein family HMM PF00216;gbkey=CDS;gene=hup;product=DNA-binding protein HU;protein_id=ADH21852.1;transl_table=4
CP002027.1	Genbank	sequence_feature	441426	442505	.	+	.	ID=id457;Note=mmyc158%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	441441	441989	.	+	.	ID=gene352;Name=MMSYN1_0352;gbkey=Gene;locus_tag=MMSYN1_0352
CP002027.1	Genbank	CDS	441441	441989	.	+	0	ID=cds326;Parent=gene352;Dbxref=NCBI_GP:ADH21849.1;Name=ADH21849.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21849.1;transl_table=4
CP002027.1	Genbank	gene	441952	442461	.	-	.	ID=gene353;Name=recU;gbkey=Gene;gene=recU;locus_tag=MMSYN1_0351
CP002027.1	Genbank	CDS	441952	442461	.	-	0	ID=cds327;Parent=gene353;Dbxref=NCBI_GP:ADH22183.1;Name=ADH22183.1;Note=identified by match to protein family HMM PF03838;gbkey=CDS;gene=recU;product=recombination protein U;protein_id=ADH22183.1;transl_table=4
CP002027.1	Genbank	sequence_feature	442426	443505	.	+	.	ID=id458;Note=mmyc159%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	442525	442902	.	+	.	ID=gene354;Name=MMSYN1_0353;Note=DivIVA domain protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM TIGR03544;gbkey=Gene;locus_tag=MMSYN1_0353;pseudo=true
CP002027.1	Genbank	pseudogene	443061	444476	.	+	.	ID=gene355;Name=MMSYN1_0354;Note=putative lipoprotein%2C degenerate%3B this region contains one or more premature stops and/or frameshifts%3B identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=Gene;locus_tag=MMSYN1_0354;pseudo=true
CP002027.1	Genbank	sequence_feature	443426	444505	.	+	.	ID=id459;Note=mmyc160%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	444426	445505	.	+	.	ID=id460;Note=mmyc161%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	444649	445872	.	+	.	ID=gene356;Name=MMSYN1_0355;gbkey=Gene;locus_tag=MMSYN1_0355
CP002027.1	Genbank	CDS	444649	445872	.	+	0	ID=cds328;Parent=gene356;Dbxref=NCBI_GP:ADH22202.1;Name=ADH22202.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=putative liporotein;protein_id=ADH22202.1;transl_table=4
CP002027.1	Genbank	sequence_feature	445426	446505	.	+	.	ID=id461;Note=mmyc162%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	445958	446302	.	+	.	ID=gene357;Name=rnpB;gbkey=Gene;gene=rnpB;locus_tag=MMSYN1_0356
CP002027.1	Genbank	RNase_P_RNA	445958	446302	.	+	.	ID=rna11;Parent=gene357;gbkey=ncRNA;gene=rnpB;product=Bacterial RNase P class B
CP002027.1	Genbank	exon	445958	446302	.	+	.	ID=id462;Parent=rna11;gbkey=ncRNA;gene=rnpB;product=Bacterial RNase P class B
CP002027.1	Genbank	gene	446339	446809	.	+	.	ID=gene358;Name=MMSYN1_0357;gbkey=Gene;locus_tag=MMSYN1_0357
CP002027.1	Genbank	CDS	446339	446809	.	+	0	ID=cds329;Parent=gene358;Dbxref=NCBI_GP:ADH22104.1;Name=ADH22104.1;Note=identified by match to protein family HMM PF02464%3B match to protein family HMM TIGR00199;gbkey=CDS;product=putative competence-damage inducible protein;protein_id=ADH22104.1;transl_table=4
CP002027.1	Genbank	sequence_feature	446426	447505	.	+	.	ID=id463;Note=mmyc163%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	446852	447889	.	+	.	ID=gene359;Name=recA;gbkey=Gene;gene=recA;locus_tag=MMSYN1_0358
CP002027.1	Genbank	CDS	446852	447889	.	+	0	ID=cds330;Parent=gene359;Dbxref=NCBI_GP:ADH22247.1;Name=ADH22247.1;Note=identified by match to protein family HMM PF00154%3B match to protein family HMM TIGR02012;gbkey=CDS;gene=recA;product=protein RecA;protein_id=ADH22247.1;transl_table=4
CP002027.1	Genbank	sequence_feature	447426	448505	.	+	.	ID=id464;Note=mmyc164%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	448025	449554	.	+	.	ID=gene360;Name=MMSYN1_0359;gbkey=Gene;locus_tag=MMSYN1_0359
CP002027.1	Genbank	CDS	448025	449554	.	+	0	ID=cds331;Parent=gene360;Dbxref=NCBI_GP:ADH22154.1;Name=ADH22154.1;Note=identified by match to protein family HMM PF00013%3B match to protein family HMM PF01966%3B match to protein family HMM PF08668%3B match to protein family HMM TIGR00277%3B match to protein family HMM TIGR03319;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22154.1;transl_table=4
CP002027.1	Genbank	sequence_feature	448426	449505	.	+	.	ID=id465;Note=mmyc165%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	449426	450505	.	+	.	ID=id466;Note=mmyc166%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	449588	450931	.	+	.	ID=gene361;Name=ffh;gbkey=Gene;gene=ffh;locus_tag=MMSYN1_0360
CP002027.1	Genbank	CDS	449588	450931	.	+	0	ID=cds332;Parent=gene361;Dbxref=NCBI_GP:ADH21642.1;Name=ADH21642.1;Note=identified by match to protein family HMM PF00448%3B match to protein family HMM PF02881%3B match to protein family HMM PF02978%3B match to protein family HMM TIGR00959;gbkey=CDS;gene=ffh;product=signal recognition particle protein;protein_id=ADH21642.1;transl_table=4
CP002027.1	Genbank	sequence_feature	450426	451505	.	+	.	ID=id467;Note=mmyc167%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	450935	451402	.	+	.	ID=gene362;Name=MMSYN1_0361;gbkey=Gene;locus_tag=MMSYN1_0361
CP002027.1	Genbank	CDS	450935	451402	.	+	0	ID=cds333;Parent=gene362;Dbxref=NCBI_GP:ADH21785.1;Name=ADH21785.1;Note=identified by match to protein family HMM PF02590;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21785.1;transl_table=4
CP002027.1	Genbank	sequence_feature	451426	452505	.	+	.	ID=id468;Note=mmyc168%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	451493	451771	.	+	.	ID=gene363;Name=rpsP;gbkey=Gene;gene=rpsP;locus_tag=MMSYN1_0362
CP002027.1	Genbank	CDS	451493	451771	.	+	0	ID=cds334;Parent=gene363;Dbxref=NCBI_GP:ADH21832.1;Name=ADH21832.1;Note=identified by match to protein family HMM PF00886%3B match to protein family HMM TIGR00002;gbkey=CDS;gene=rpsP;product=ribosomal protein S16;protein_id=ADH21832.1;transl_table=4
CP002027.1	Genbank	gene	451803	452297	.	+	.	ID=gene364;Name=rimM;gbkey=Gene;gene=rimM;locus_tag=MMSYN1_0363
CP002027.1	Genbank	CDS	451803	452297	.	+	0	ID=cds335;Parent=gene364;Dbxref=NCBI_GP:ADH21936.1;Name=ADH21936.1;Note=identified by match to protein family HMM PF01782%3B match to protein family HMM TIGR02273;gbkey=CDS;gene=rimM;product=16S rRNA processing protein RimM;protein_id=ADH21936.1;transl_table=4
CP002027.1	Genbank	gene	452299	453021	.	+	.	ID=gene365;Name=trmD;gbkey=Gene;gene=trmD;locus_tag=MMSYN1_0364
CP002027.1	Genbank	CDS	452299	453021	.	+	0	ID=cds336;Parent=gene365;Dbxref=NCBI_GP:ADH22228.1;Name=ADH22228.1;Note=identified by match to protein family HMM PF01746%3B match to protein family HMM TIGR00088;gbkey=CDS;gene=trmD;product=tRNA (guanine-N1)-methyltransferase;protein_id=ADH22228.1;transl_table=4
CP002027.1	Genbank	sequence_feature	452426	453505	.	+	.	ID=id469;Note=mmyc169%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	453023	453406	.	+	.	ID=gene366;Name=rplS;gbkey=Gene;gene=rplS;locus_tag=MMSYN1_0365
CP002027.1	Genbank	CDS	453023	453406	.	+	0	ID=cds337;Parent=gene366;Dbxref=NCBI_GP:ADH21542.1;Name=ADH21542.1;Note=identified by match to protein family HMM PF01245%3B match to protein family HMM TIGR01024;gbkey=CDS;gene=rplS;product=ribosomal protein L19;protein_id=ADH21542.1;transl_table=4
CP002027.1	Genbank	sequence_feature	453426	454505	.	+	.	ID=id470;Note=mmyc170%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	453505	454455	.	+	.	ID=gene367;Name=ylqF;gbkey=Gene;gene=ylqF;locus_tag=MMSYN1_0366
CP002027.1	Genbank	CDS	453505	454455	.	+	0	ID=cds338;Parent=gene367;Dbxref=NCBI_GP:ADH22020.1;Name=ADH22020.1;Note=identified by match to protein family HMM PF01926%3B match to protein family HMM TIGR03596;gbkey=CDS;gene=ylqF;product=ribosome biogenesis GTP-binding protein YlqF;protein_id=ADH22020.1;transl_table=4
CP002027.1	Genbank	sequence_feature	454426	455505	.	+	.	ID=id471;Note=mmyc171%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	454449	455072	.	+	.	ID=gene368;Name=rnhB;gbkey=Gene;gene=rnhB;locus_tag=MMSYN1_0367
CP002027.1	Genbank	CDS	454449	455072	.	+	0	ID=cds339;Parent=gene368;Dbxref=NCBI_GP:ADH22112.1;Name=ADH22112.1;Note=identified by match to protein family HMM PF01351;gbkey=CDS;gene=rnhB;product=ribonuclease HII;protein_id=ADH22112.1;transl_table=4
CP002027.1	Genbank	gene	455094	456890	.	-	.	ID=gene369;Name=MMSYN1_0368;gbkey=Gene;locus_tag=MMSYN1_0368
CP002027.1	Genbank	CDS	455094	456890	.	-	0	ID=cds340;Parent=gene369;Dbxref=NCBI_GP:ADH21827.1;Name=ADH21827.1;Note=identified by match to protein family HMM PF00581%3B match to protein family HMM PF02852;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21827.1;transl_table=4
CP002027.1	Genbank	sequence_feature	455426	456505	.	+	.	ID=id472;Note=mmyc172%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	456426	457505	.	+	.	ID=id473;Note=mmyc173%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	456893	458131	.	-	.	ID=gene370;Name=MMSYN1_0369;gbkey=Gene;locus_tag=MMSYN1_0369
CP002027.1	Genbank	CDS	456893	458131	.	-	0	ID=cds341;Parent=gene370;Dbxref=NCBI_GP:ADH21920.1;Name=ADH21920.1;Note=identified by match to protein family HMM PF04143;gbkey=CDS;product=YeeE/YedE family protein%2C putative;protein_id=ADH21920.1;transl_table=4
CP002027.1	Genbank	sequence_feature	457426	458505	.	+	.	ID=id474;Note=mmyc174%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	458292	458597	.	+	.	ID=gene371;Name=MMSYN1_0370;gbkey=Gene;locus_tag=MMSYN1_0370
CP002027.1	Genbank	CDS	458292	458597	.	+	0	ID=cds342;Parent=gene371;Dbxref=NCBI_GP:ADH21628.1;Name=ADH21628.1;Note=identified by match to protein family HMM PF00436;gbkey=CDS;product=single-strand binding family protein;protein_id=ADH21628.1;transl_table=4
CP002027.1	Genbank	sequence_feature	458426	459505	.	+	.	ID=id475;Note=mmyc175%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	458816	460687	.	+	.	ID=gene372;Name=MMSYN1_0371;gbkey=Gene;locus_tag=MMSYN1_0371
CP002027.1	Genbank	CDS	458816	460687	.	+	0	ID=cds343;Parent=gene372;Dbxref=NCBI_GP:ADH21674.1;Name=ADH21674.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF00664;gbkey=CDS;product=ABC transporter%2C permease and ATP-binding componen;protein_id=ADH21674.1;transl_table=4
CP002027.1	Genbank	sequence_feature	459426	460505	.	+	.	ID=id476;Note=mmyc176%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	460426	461505	.	+	.	ID=id477;Note=mmyc177%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	460703	462556	.	+	.	ID=gene373;Name=MMSYN1_0372;gbkey=Gene;locus_tag=MMSYN1_0372
CP002027.1	Genbank	CDS	460703	462556	.	+	0	ID=cds344;Parent=gene373;Dbxref=NCBI_GP:ADH22243.1;Name=ADH22243.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF00664;gbkey=CDS;product=ABC transporter%2C permease and ATP-binding componen;protein_id=ADH22243.1;transl_table=4
CP002027.1	Genbank	sequence_feature	461426	462505	.	+	.	ID=id478;Note=mmyc178%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	462426	463505	.	+	.	ID=id479;Note=mmyc179%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	462590	464197	.	+	.	ID=gene374;Name=MMSYN1_0373;gbkey=Gene;locus_tag=MMSYN1_0373
CP002027.1	Genbank	CDS	462590	464197	.	+	0	ID=cds345;Parent=gene374;Dbxref=NCBI_GP:ADH21863.1;Name=ADH21863.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21863.1;transl_table=4
CP002027.1	Genbank	sequence_feature	463426	464505	.	+	.	ID=id480;Note=mmyc180%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	464253	464329	.	+	.	ID=gene375;Name=MMSYN1_0374;gbkey=Gene;locus_tag=MMSYN1_0374
CP002027.1	Genbank	tRNA	464253	464329	.	+	.	ID=rna12;Parent=gene375;gbkey=tRNA;product=tRNA-Arg
CP002027.1	Genbank	exon	464253	464329	.	+	.	ID=id481;Parent=rna12;gbkey=tRNA;product=tRNA-Arg
CP002027.1	Genbank	gene	464383	465123	.	+	.	ID=gene376;Name=MMSYN1_0375;gbkey=Gene;locus_tag=MMSYN1_0375
CP002027.1	Genbank	CDS	464383	465123	.	+	0	ID=cds346;Parent=gene376;Dbxref=NCBI_GP:ADH21888.1;Name=ADH21888.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21888.1;transl_table=4
CP002027.1	Genbank	sequence_feature	464426	465505	.	+	.	ID=id482;Note=mmyc181%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	465125	465439	.	+	.	ID=gene377;Name=MMSYN1_0376;gbkey=Gene;locus_tag=MMSYN1_0376
CP002027.1	Genbank	CDS	465125	465439	.	+	0	ID=cds347;Parent=gene377;Dbxref=NCBI_GP:ADH21773.1;Name=ADH21773.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21773.1;transl_table=4
CP002027.1	Genbank	sequence_feature	465426	466505	.	+	.	ID=id483;Note=mmyc182%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	465510	466811	.	+	.	ID=gene378;Name=cgtA;gbkey=Gene;gene=cgtA;locus_tag=MMSYN1_0377
CP002027.1	Genbank	CDS	465510	466811	.	+	0	ID=cds348;Parent=gene378;Dbxref=NCBI_GP:ADH22145.1;Name=ADH22145.1;Note=identified by match to protein family HMM PF01018%3B match to protein family HMM PF01926%3B match to protein family HMM PF09269%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR02729%3B match to protein family HMM TIGR03595;gbkey=CDS;gene=cgtA;product=Obg family GTPase CgtA;protein_id=ADH22145.1;transl_table=4
CP002027.1	Genbank	sequence_feature	466426	467505	.	+	.	ID=id484;Note=mmyc183%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	466813	467550	.	+	.	ID=gene379;Name=nadE;gbkey=Gene;gene=nadE;locus_tag=MMSYN1_0378
CP002027.1	Genbank	CDS	466813	467550	.	+	0	ID=cds349;Parent=gene379;Dbxref=NCBI_GP:ADH22005.1;Name=ADH22005.1;Note=identified by match to protein family HMM PF02540%3B match to protein family HMM TIGR00552;gbkey=CDS;gene=nadE;product=NAD+ synthetase;protein_id=ADH22005.1;transl_table=4
CP002027.1	Genbank	sequence_feature	467426	468505	.	+	.	ID=id485;Note=mmyc184%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	467567	467845	.	+	.	ID=gene380;Name=MMSYN1_0379;gbkey=Gene;locus_tag=MMSYN1_0379
CP002027.1	Genbank	CDS	467567	467845	.	+	0	ID=cds350;Parent=gene380;Dbxref=NCBI_GP:ADH21531.1;Name=ADH21531.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21531.1;transl_table=4
CP002027.1	Genbank	gene	467863	468960	.	+	.	ID=gene381;Name=MMSYN1_0380;gbkey=Gene;locus_tag=MMSYN1_0380
CP002027.1	Genbank	CDS	467863	468960	.	+	0	ID=cds351;Parent=gene381;Dbxref=NCBI_GP:ADH22278.1;Name=ADH22278.1;Note=identified by match to protein family HMM PF01467%3B match to protein family HMM PF01966%3B match to protein family HMM TIGR00125%3B match to protein family HMM TIGR00482%3B match to protein family HMM TIGR00488;gbkey=CDS;product=putative nicotinate-nucleotide adenylyltransferase;protein_id=ADH22278.1;transl_table=4
CP002027.1	Genbank	sequence_feature	468426	469505	.	+	.	ID=id486;Note=mmyc185%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	468965	469624	.	+	.	ID=gene382;Name=mtnN;gbkey=Gene;gene=mtnN;locus_tag=MMSYN1_0381
CP002027.1	Genbank	CDS	468965	469624	.	+	0	ID=cds352;Parent=gene382;Dbxref=NCBI_GP:ADH21466.1;Name=ADH21466.1;Note=identified by match to protein family HMM PF01048%3B match to protein family HMM TIGR01704;gbkey=CDS;gene=mtnN;product=MTA/SAH nucleosidase;protein_id=ADH21466.1;transl_table=4
CP002027.1	Genbank	sequence_feature	469426	470505	.	+	.	ID=id487;Note=mmyc186%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	469634	470272	.	+	.	ID=gene383;Name=MMSYN1_0382;gbkey=Gene;locus_tag=MMSYN1_0382
CP002027.1	Genbank	CDS	469634	470272	.	+	0	ID=cds353;Parent=gene383;Dbxref=NCBI_GP:ADH21646.1;Name=ADH21646.1;gbkey=CDS;product=deoxynucleoside kinase;protein_id=ADH21646.1;transl_table=4
CP002027.1	Genbank	gene	470394	471113	.	+	.	ID=gene384;Name=MMSYN1_0383;gbkey=Gene;locus_tag=MMSYN1_0383
CP002027.1	Genbank	CDS	470394	471113	.	+	0	ID=cds354;Parent=gene384;Dbxref=NCBI_GP:ADH21745.1;Name=ADH21745.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21745.1;transl_table=4
CP002027.1	Genbank	sequence_feature	470426	471505	.	+	.	ID=id488;Note=mmyc187%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	471190	471927	.	+	.	ID=gene385;Name=MMSYN1_0384;gbkey=Gene;locus_tag=MMSYN1_0384
CP002027.1	Genbank	CDS	471190	471927	.	+	0	ID=cds355;Parent=gene385;Dbxref=NCBI_GP:ADH21483.1;Name=ADH21483.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21483.1;transl_table=4
CP002027.1	Genbank	sequence_feature	471426	472505	.	+	.	ID=id489;Note=mmyc188%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	471937	472617	.	+	.	ID=gene386;Name=MMSYN1_0385;Note=putative liporotein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0385;pseudo=true
CP002027.1	Genbank	sequence_feature	472426	473505	.	+	.	ID=id490;Note=mmyc189%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	472656	473501	.	+	.	ID=gene387;Name=MMSYN1_0386;gbkey=Gene;locus_tag=MMSYN1_0386
CP002027.1	Genbank	CDS	472656	473501	.	+	0	ID=cds356;Parent=gene387;Dbxref=NCBI_GP:ADH21869.1;Name=ADH21869.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21869.1;transl_table=4
CP002027.1	Genbank	sequence_feature	473426	474505	.	+	.	ID=id491;Note=mmyc190%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	473609	474736	.	+	.	ID=gene388;Name=trmU;gbkey=Gene;gene=trmU;locus_tag=MMSYN1_0387
CP002027.1	Genbank	CDS	473609	474736	.	+	0	ID=cds357;Parent=gene388;Dbxref=NCBI_GP:ADH21749.1;Name=ADH21749.1;Note=identified by match to protein family HMM PF03054%3B match to protein family HMM TIGR00420;gbkey=CDS;gene=trmU;product=tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;protein_id=ADH21749.1;transl_table=4
CP002027.1	Genbank	sequence_feature	474426	475505	.	+	.	ID=id492;Note=mmyc191%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	474783	475400	.	+	.	ID=gene389;Name=MMSYN1_0388;gbkey=Gene;locus_tag=MMSYN1_0388
CP002027.1	Genbank	CDS	474783	475400	.	+	0	ID=cds358;Parent=gene389;Dbxref=NCBI_GP:ADH22061.1;Name=ADH22061.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22061.1;transl_table=4
CP002027.1	Genbank	sequence_feature	475426	476505	.	+	.	ID=id493;Note=mmyc192%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	475476	477620	.	+	.	ID=gene390;Name=MMSYN1_0389;gbkey=Gene;locus_tag=MMSYN1_0389
CP002027.1	Genbank	CDS	475476	477620	.	+	0	ID=cds359;Parent=gene390;Dbxref=NCBI_GP:ADH22047.1;Name=ADH22047.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22047.1;transl_table=4
CP002027.1	Genbank	sequence_feature	476426	477505	.	+	.	ID=id494;Note=mmyc193%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	477426	478505	.	+	.	ID=id495;Note=mmyc194%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	477610	478563	.	+	.	ID=gene391;Name=fmt;gbkey=Gene;gene=fmt;locus_tag=MMSYN1_0390
CP002027.1	Genbank	CDS	477610	478563	.	+	0	ID=cds360;Parent=gene391;Dbxref=NCBI_GP:ADH21947.1;Name=ADH21947.1;Note=identified by match to protein family HMM PF00551%3B match to protein family HMM PF02911%3B match to protein family HMM TIGR00460;gbkey=CDS;gene=fmt;product=methionyl-tRNA formyltransferase;protein_id=ADH21947.1;transl_table=4
CP002027.1	Genbank	sequence_feature	478426	479505	.	+	.	ID=id496;Note=mmyc195%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	478650	479204	.	+	.	ID=gene392;Name=efp;gbkey=Gene;gene=efp;locus_tag=MMSYN1_0391
CP002027.1	Genbank	CDS	478650	479204	.	+	0	ID=cds361;Parent=gene392;Dbxref=NCBI_GP:ADH21652.1;Name=ADH21652.1;Note=identified by match to protein family HMM PF01132%3B match to protein family HMM PF08207%3B match to protein family HMM PF09285%3B match to protein family HMM TIGR00038;gbkey=CDS;gene=efp;product=translation elongation factor P;protein_id=ADH21652.1;transl_table=4
CP002027.1	Genbank	gene	479222	479524	.	+	.	ID=gene393;Name=MMSYN1_0392;gbkey=Gene;locus_tag=MMSYN1_0392
CP002027.1	Genbank	CDS	479222	479524	.	+	0	ID=cds362;Parent=gene393;Dbxref=NCBI_GP:ADH22124.1;Name=ADH22124.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22124.1;transl_table=4
CP002027.1	Genbank	sequence_feature	479426	480505	.	+	.	ID=id497;Note=mmyc196%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	479541	480827	.	+	.	ID=gene394;Name=tig;gbkey=Gene;gene=tig;locus_tag=MMSYN1_0393
CP002027.1	Genbank	CDS	479541	480827	.	+	0	ID=cds363;Parent=gene394;Dbxref=NCBI_GP:ADH21522.1;Name=ADH21522.1;Note=identified by match to protein family HMM PF00254%3B match to protein family HMM PF05697%3B match to protein family HMM PF05698%3B match to protein family HMM TIGR00115;gbkey=CDS;gene=tig;product=trigger factor;protein_id=ADH21522.1;transl_table=4
CP002027.1	Genbank	sequence_feature	480426	481505	.	+	.	ID=id498;Note=mmyc197%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	480950	483310	.	+	.	ID=gene395;Name=lon;gbkey=Gene;gene=lon;locus_tag=MMSYN1_0394
CP002027.1	Genbank	CDS	480950	483310	.	+	0	ID=cds364;Parent=gene395;Dbxref=NCBI_GP:ADH22086.1;Name=ADH22086.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM PF05362%3B match to protein family HMM PF07728%3B match to protein family HMM TIGR00763;gbkey=CDS;gene=lon;product=ATP-dependent protease La;protein_id=ADH22086.1;transl_table=4
CP002027.1	Genbank	sequence_feature	481426	482505	.	+	.	ID=id499;Note=mmyc198%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=lon
CP002027.1	Genbank	sequence_feature	482426	483505	.	+	.	ID=id500;Note=mmyc199%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	483409	484644	.	+	.	ID=gene396;Name=rarA;gbkey=Gene;gene=rarA;locus_tag=MMSYN1_0395
CP002027.1	Genbank	CDS	483409	484644	.	+	0	ID=cds365;Parent=gene396;Dbxref=NCBI_GP:ADH22138.1;Name=ADH22138.1;Note=identified by match to protein family HMM PF00004;gbkey=CDS;gene=rarA;product=recombination factor protein RarA;protein_id=ADH22138.1;transl_table=4
CP002027.1	Genbank	sequence_feature	483426	484505	.	+	.	ID=id501;Note=mmyc200%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=rarA
CP002027.1	Genbank	sequence_feature	484426	485505	.	+	.	ID=id502;Note=mmyc201%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	484673	486898	.	-	.	ID=gene397;Name=MMSYN1_0396;gbkey=Gene;locus_tag=MMSYN1_0396
CP002027.1	Genbank	CDS	484673	486898	.	-	0	ID=cds366;Parent=gene397;Dbxref=NCBI_GP:ADH21902.1;Name=ADH21902.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21902.1;transl_table=4
CP002027.1	Genbank	sequence_feature	485426	486505	.	+	.	ID=id503;Note=mmyc202%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	486426	487505	.	+	.	ID=id504;Note=mmyc203%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	486949	489240	.	-	.	ID=gene398;Name=MMSYN1_0397;gbkey=Gene;locus_tag=MMSYN1_0397
CP002027.1	Genbank	CDS	486949	489240	.	-	0	ID=cds367;Parent=gene398;Dbxref=NCBI_GP:ADH21993.1;Name=ADH21993.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21993.1;transl_table=4
CP002027.1	Genbank	sequence_feature	487426	488505	.	+	.	ID=id505;Note=mmyc204%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	488426	489505	.	+	.	ID=id506;Note=mmyc205%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	489280	491742	.	-	.	ID=gene399;Name=MMSYN1_0398;gbkey=Gene;locus_tag=MMSYN1_0398
CP002027.1	Genbank	CDS	489280	491742	.	-	0	ID=cds368;Parent=gene399;Dbxref=NCBI_GP:ADH21660.1;Name=ADH21660.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21660.1;transl_table=4
CP002027.1	Genbank	sequence_feature	489426	490505	.	+	.	ID=id507;Note=mmyc206%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	490426	491505	.	+	.	ID=id508;Note=mmyc207%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	491426	492505	.	+	.	ID=id509;Note=mmyc208%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	491892	497153	.	+	.	ID=gene400;Name=MMSYN1_0399;Note=efflux ABC transporter%2C permease protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF02687;gbkey=Gene;locus_tag=MMSYN1_0399;pseudo=true
CP002027.1	Genbank	sequence_feature	492426	493505	.	+	.	ID=id510;Note=mmyc209%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	493426	494505	.	+	.	ID=id511;Note=mmyc210%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	494426	495505	.	+	.	ID=id512;Note=mmyc211%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	495426	496505	.	+	.	ID=id513;Note=mmyc212%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	496426	497505	.	+	.	ID=id514;Note=mmyc213%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	497201	497752	.	+	.	ID=gene401;Name=MMSYN1_0400;gbkey=Gene;locus_tag=MMSYN1_0400
CP002027.1	Genbank	CDS	497201	497752	.	+	0	ID=cds369;Parent=gene401;Dbxref=NCBI_GP:ADH22037.1;Name=ADH22037.1;Note=identified by match to protein family HMM PF01965%3B match to protein family HMM TIGR01383;gbkey=CDS;product=ThiJ/PfpI family protein;protein_id=ADH22037.1;transl_table=4
CP002027.1	Genbank	sequence_feature	497426	498505	.	+	.	ID=id515;Note=mmyc214%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	497850	499634	.	+	.	ID=gene402;Name=MMSYN1_0401;Note=peptidase C39 family protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF03412;gbkey=Gene;locus_tag=MMSYN1_0401;pseudo=true
CP002027.1	Genbank	sequence_feature	498426	499505	.	+	.	ID=id516;Note=mmyc215%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	499426	500505	.	+	.	ID=id517;Note=mmyc216%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	499639	500133	.	+	.	ID=gene403;Name=MMSYN1_0402;gbkey=Gene;locus_tag=MMSYN1_0402
CP002027.1	Genbank	CDS	499639	500133	.	+	0	ID=cds370;Parent=gene403;Dbxref=NCBI_GP:ADH22240.1;Name=ADH22240.1;Note=identified by match to protein family HMM PF02130%3B match to protein family HMM TIGR00043;gbkey=CDS;product=putative metalloprotease;protein_id=ADH22240.1;transl_table=4
CP002027.1	Genbank	gene	500137	501042	.	+	.	ID=gene404;Name=era;gbkey=Gene;gene=era;locus_tag=MMSYN1_0403
CP002027.1	Genbank	CDS	500137	501042	.	+	0	ID=cds371;Parent=gene404;Dbxref=NCBI_GP:ADH22248.1;Name=ADH22248.1;Note=identified by match to protein family HMM PF01926%3B match to protein family HMM PF07650%3B match to protein family HMM PF08477%3B match to protein family HMM TIGR00231%3B match to protein family HMM TIGR00436;gbkey=CDS;gene=era;product=GTP-binding protein Era;protein_id=ADH22248.1;transl_table=4
CP002027.1	Genbank	sequence_feature	500426	501505	.	+	.	ID=id518;Note=mmyc217%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	501042	501791	.	+	.	ID=gene405;Name=recO;gbkey=Gene;gene=recO;locus_tag=MMSYN1_0404
CP002027.1	Genbank	CDS	501042	501791	.	+	0	ID=cds372;Parent=gene405;Dbxref=NCBI_GP:ADH22195.1;Name=ADH22195.1;Note=identified by match to protein family HMM PF02565%3B match to protein family HMM TIGR00613;gbkey=CDS;gene=recO;product=DNA repair protein RecO;protein_id=ADH22195.1;transl_table=4
CP002027.1	Genbank	sequence_feature	501426	502505	.	+	.	ID=id519;Note=mmyc218%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	501855	503225	.	+	.	ID=gene406;Name=glyS;gbkey=Gene;gene=glyS;locus_tag=MMSYN1_0405
CP002027.1	Genbank	CDS	501855	503225	.	+	0	ID=cds373;Parent=gene406;Dbxref=NCBI_GP:ADH21721.1;Name=ADH21721.1;Note=identified by match to protein family HMM PF00587%3B match to protein family HMM PF03129%3B match to protein family HMM TIGR00389;gbkey=CDS;gene=glyS;product=glycine--tRNA ligase;protein_id=ADH21721.1;transl_table=4
CP002027.1	Genbank	sequence_feature	502426	503505	.	+	.	ID=id520;Note=mmyc219%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	503260	505098	.	+	.	ID=gene407;Name=dnaG;gbkey=Gene;gene=dnaG;locus_tag=MMSYN1_0406
CP002027.1	Genbank	CDS	503260	505098	.	+	0	ID=cds374;Parent=gene407;Dbxref=NCBI_GP:ADH21591.1;Name=ADH21591.1;Note=identified by match to protein family HMM PF01751%3B match to protein family HMM PF01807%3B match to protein family HMM PF08275%3B match to protein family HMM TIGR01391;gbkey=CDS;gene=dnaG;product=DNA primase;protein_id=ADH21591.1;transl_table=4
CP002027.1	Genbank	sequence_feature	503426	504505	.	+	.	ID=id521;Note=mmyc220%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=dnaG
CP002027.1	Genbank	sequence_feature	504426	505505	.	+	.	ID=id522;Note=mmyc221%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	505101	506621	.	+	.	ID=gene408;Name=rpoD;gbkey=Gene;gene=rpoD;locus_tag=MMSYN1_0407
CP002027.1	Genbank	CDS	505101	506621	.	+	0	ID=cds375;Parent=gene408;Dbxref=NCBI_GP:ADH21912.1;Name=ADH21912.1;Note=identified by match to protein family HMM PF04539%3B match to protein family HMM PF04542%3B match to protein family HMM TIGR02937;gbkey=CDS;gene=rpoD;product=RNA polymerase sigma-A factor;protein_id=ADH21912.1;transl_table=4
CP002027.1	Genbank	sequence_feature	505426	506505	.	+	.	ID=id523;Note=mmyc222%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=rpoD
CP002027.1	Genbank	sequence_feature	506426	507505	.	+	.	ID=id524;Note=mmyc223%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	506621	507298	.	+	.	ID=gene409;Name=MMSYN1_0408;gbkey=Gene;locus_tag=MMSYN1_0408
CP002027.1	Genbank	CDS	506621	507298	.	+	0	ID=cds376;Parent=gene409;Dbxref=NCBI_GP:ADH22033.1;Name=ADH22033.1;Note=identified by match to protein family HMM PF04816;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22033.1;transl_table=4
CP002027.1	Genbank	gene	507285	508061	.	+	.	ID=gene410;Name=MMSYN1_0409;gbkey=Gene;locus_tag=MMSYN1_0409
CP002027.1	Genbank	CDS	507285	508061	.	+	0	ID=cds377;Parent=gene410;Dbxref=NCBI_GP:ADH21686.1;Name=ADH21686.1;Note=identified by match to protein family HMM PF01784;gbkey=CDS;product=NIF3 family protein;protein_id=ADH21686.1;transl_table=4
CP002027.1	Genbank	sequence_feature	507426	508505	.	+	.	ID=id525;Note=mmyc224%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	508070	509431	.	+	.	ID=gene411;Name=MMSYN1_0410;gbkey=Gene;locus_tag=MMSYN1_0410
CP002027.1	Genbank	CDS	508070	509431	.	+	0	ID=cds378;Parent=gene411;Dbxref=NCBI_GP:ADH21915.1;Name=ADH21915.1;Note=identified by match to protein family HMM PF00270%3B match to protein family HMM PF00271;gbkey=CDS;product=superfamily II DNA and RNA helicase;protein_id=ADH21915.1;transl_table=4
CP002027.1	Genbank	sequence_feature	508426	509505	.	+	.	ID=id526;Note=mmyc225%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	509426	510505	.	+	.	ID=id527;Note=mmyc226%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	509471	510985	.	+	.	ID=gene412;Name=MMSYN1_0411;gbkey=Gene;locus_tag=MMSYN1_0411
CP002027.1	Genbank	CDS	509471	510985	.	+	0	ID=cds379;Parent=gene412;Dbxref=NCBI_GP:ADH22121.1;Name=ADH22121.1;Note=identified by match to protein family HMM PF02588;gbkey=CDS;product=putative membrane protein;protein_id=ADH22121.1;transl_table=4
CP002027.1	Genbank	sequence_feature	510426	511505	.	+	.	ID=id528;Note=mmyc227%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	511101	515255	.	+	.	ID=gene413;Name=MMSYN1_0412;gbkey=Gene;locus_tag=MMSYN1_0412
CP002027.1	Genbank	CDS	511101	515255	.	+	0	ID=cds380;Parent=gene413;Dbxref=NCBI_GP:ADH22070.1;Name=ADH22070.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22070.1;transl_table=4
CP002027.1	Genbank	sequence_feature	511426	512505	.	+	.	ID=id529;Note=mmyc228%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	512426	513505	.	+	.	ID=id530;Note=mmyc229%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	513426	514505	.	+	.	ID=id531;Note=mmyc230%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	514426	515505	.	+	.	ID=id532;Note=mmyc231%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	515267	515779	.	+	.	ID=gene414;Name=apt;gbkey=Gene;gene=apt;locus_tag=MMSYN1_0413
CP002027.1	Genbank	CDS	515267	515779	.	+	0	ID=cds381;Parent=gene414;Dbxref=NCBI_GP:ADH21513.1;Name=ADH21513.1;Note=identified by match to protein family HMM PF00156%3B match to protein family HMM TIGR01090;gbkey=CDS;gene=apt;product=adenine phosphoribosyltransferase;protein_id=ADH21513.1;transl_table=4
CP002027.1	Genbank	sequence_feature	515426	516505	.	+	.	ID=id533;Note=mmyc232%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	515862	518126	.	+	.	ID=gene415;Name=MMSYN1_0414;gbkey=Gene;locus_tag=MMSYN1_0414
CP002027.1	Genbank	CDS	515862	518126	.	+	0	ID=cds382;Parent=gene415;Dbxref=NCBI_GP:ADH21761.1;Name=ADH21761.1;Note=identified by match to protein family HMM PF01842%3B match to protein family HMM PF01966%3B match to protein family HMM PF02824%3B match to protein family HMM PF04607%3B match to protein family HMM TIGR00691;gbkey=CDS;product=RelA/SpoT family protein;protein_id=ADH21761.1;transl_table=4
CP002027.1	Genbank	sequence_feature	516426	517505	.	+	.	ID=id534;Note=mmyc233%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	517426	518505	.	+	.	ID=id535;Note=mmyc234%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	518163	521129	.	-	.	ID=gene416;Name=smc;gbkey=Gene;gene=smc;locus_tag=MMSYN1_0415
CP002027.1	Genbank	CDS	518163	521129	.	-	0	ID=cds383;Parent=gene416;Dbxref=NCBI_GP:ADH22212.1;Name=ADH22212.1;Note=identified by match to protein family HMM PF02463%3B match to protein family HMM PF06470%3B match to protein family HMM TIGR02168;gbkey=CDS;gene=smc;product=chromosome segregation protein SMC;protein_id=ADH22212.1;transl_table=4
CP002027.1	Genbank	sequence_feature	518426	519505	.	+	.	ID=id536;Note=mmyc235%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	519426	520505	.	+	.	ID=id537;Note=mmyc236%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	520426	521505	.	+	.	ID=id538;Note=mmyc237%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	521426	522505	.	+	.	ID=id539;Note=mmyc238%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	521435	521824	.	-	.	ID=gene417;Name=MMSYN1_0416;gbkey=Gene;locus_tag=MMSYN1_0416
CP002027.1	Genbank	CDS	521435	521824	.	-	0	ID=cds384;Parent=gene417;Dbxref=NCBI_GP:ADH21889.1;Name=ADH21889.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21889.1;transl_table=4
CP002027.1	Genbank	gene	521827	522282	.	-	.	ID=gene418;Name=MMSYN1_0417;gbkey=Gene;locus_tag=MMSYN1_0417
CP002027.1	Genbank	CDS	521827	522282	.	-	0	ID=cds385;Parent=gene418;Dbxref=NCBI_GP:ADH21543.1;Name=ADH21543.1;gbkey=CDS;product=cdse;protein_id=ADH21543.1;transl_table=4
CP002027.1	Genbank	gene	522415	523113	.	-	.	ID=gene419;Name=rnc;gbkey=Gene;gene=rnc;locus_tag=MMSYN1_0418
CP002027.1	Genbank	CDS	522415	523113	.	-	0	ID=cds386;Parent=gene419;Dbxref=NCBI_GP:ADH21641.1;Name=ADH21641.1;Note=identified by match to protein family HMM PF00035%3B match to protein family HMM PF00636%3B match to protein family HMM TIGR02191;gbkey=CDS;gene=rnc;product=ribonuclease III;protein_id=ADH21641.1;transl_table=4
CP002027.1	Genbank	sequence_feature	522426	523505	.	+	.	ID=id540;Note=mmyc239%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	523103	524107	.	-	.	ID=gene420;Name=plsX;gbkey=Gene;gene=plsX;locus_tag=MMSYN1_0419
CP002027.1	Genbank	CDS	523103	524107	.	-	0	ID=cds387;Parent=gene420;Dbxref=NCBI_GP:ADH21690.1;Name=ADH21690.1;Note=identified by match to protein family HMM PF02504%3B match to protein family HMM TIGR00182;gbkey=CDS;gene=plsX;product=fatty acid/phospholipid synthesis protein PlsX;protein_id=ADH21690.1;transl_table=4
CP002027.1	Genbank	sequence_feature	523426	524505	.	+	.	ID=id541;Note=mmyc240%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	524140	525783	.	-	.	ID=gene421;Name=MMSYN1_0420;gbkey=Gene;locus_tag=MMSYN1_0420
CP002027.1	Genbank	CDS	524140	525783	.	-	0	ID=cds388;Parent=gene421;Dbxref=NCBI_GP:ADH21789.1;Name=ADH21789.1;Note=identified by match to protein family HMM PF02734%3B match to protein family HMM TIGR03599;gbkey=CDS;product=dihydroxyacetone kinase 2 domain protein;protein_id=ADH21789.1;transl_table=4
CP002027.1	Genbank	sequence_feature	524426	525505	.	+	.	ID=id542;Note=mmyc241%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	525426	526505	.	+	.	ID=id543;Note=mmyc242%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	525808	526119	.	-	.	ID=gene422;Name=MMSYN1_0421;gbkey=Gene;locus_tag=MMSYN1_0421
CP002027.1	Genbank	CDS	525808	526119	.	-	0	ID=cds389;Parent=gene422;Dbxref=NCBI_GP:ADH22227.1;Name=ADH22227.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22227.1;transl_table=4
CP002027.1	Genbank	gene	526288	526485	.	+	.	ID=gene423;Name=rpmB;gbkey=Gene;gene=rpmB;locus_tag=MMSYN1_0422
CP002027.1	Genbank	CDS	526288	526485	.	+	0	ID=cds390;Parent=gene423;Dbxref=NCBI_GP:ADH22131.1;Name=ADH22131.1;Note=identified by match to protein family HMM PF00830%3B match to protein family HMM TIGR00009;gbkey=CDS;gene=rpmB;product=ribosomal protein L28;protein_id=ADH22131.1;transl_table=4
CP002027.1	Genbank	sequence_feature	526426	527505	.	+	.	ID=id544;Note=mmyc243%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	526549	526633	.	+	.	ID=gene424;Name=MMSYN1_0423;gbkey=Gene;locus_tag=MMSYN1_0423
CP002027.1	Genbank	tRNA	526549	526633	.	+	.	ID=rna13;Parent=gene424;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	exon	526549	526633	.	+	.	ID=id545;Parent=rna13;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	gene	526716	527159	.	+	.	ID=gene425;Name=MMSYN1_0424;gbkey=Gene;locus_tag=MMSYN1_0424
CP002027.1	Genbank	CDS	526716	527159	.	+	0	ID=cds391;Parent=gene425;Dbxref=NCBI_GP:ADH21676.1;Name=ADH21676.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21676.1;transl_table=4
CP002027.1	Genbank	gene	527248	528378	.	+	.	ID=gene426;Name=MMSYN1_0425;gbkey=Gene;locus_tag=MMSYN1_0425
CP002027.1	Genbank	CDS	527248	528378	.	+	0	ID=cds392;Parent=gene426;Dbxref=NCBI_GP:ADH21940.1;Name=ADH21940.1;gbkey=CDS;product=phosphate ABC transporter%2C substrate-binding component;protein_id=ADH21940.1;transl_table=4
CP002027.1	Genbank	sequence_feature	527426	528505	.	+	.	ID=id546;Note=mmyc244%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	528426	529505	.	+	.	ID=id547;Note=mmyc245%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	528430	530520	.	+	.	ID=gene427;Name=MMSYN1_0426;gbkey=Gene;locus_tag=MMSYN1_0426
CP002027.1	Genbank	CDS	528430	530520	.	+	0	ID=cds393;Parent=gene427;Dbxref=NCBI_GP:ADH21835.1;Name=ADH21835.1;Note=identified by match to protein family HMM PF00528%3B match to protein family HMM TIGR00974%3B match to protein family HMM TIGR02138;gbkey=CDS;product=phosphate ABC transport system%2C permease component;protein_id=ADH21835.1;transl_table=4
CP002027.1	Genbank	sequence_feature	529426	530505	.	+	.	ID=id548;Note=mmyc246%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	530426	531505	.	+	.	ID=id549;Note=mmyc247f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	530513	531322	.	+	.	ID=gene428;Name=pstB;gbkey=Gene;gene=pstB;locus_tag=MMSYN1_0427
CP002027.1	Genbank	CDS	530513	531322	.	+	0	ID=cds394;Parent=gene428;Dbxref=NCBI_GP:ADH21730.1;Name=ADH21730.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM TIGR00972;gbkey=CDS;gene=pstB;product=phosphate ABC transporter%2C ATP-binding protein;protein_id=ADH21730.1;transl_table=4
CP002027.1	Genbank	gene	531331	532005	.	+	.	ID=gene429;Name=phoU;gbkey=Gene;gene=phoU;locus_tag=MMSYN1_0428
CP002027.1	Genbank	CDS	531331	532005	.	+	0	ID=cds395;Parent=gene429;Dbxref=NCBI_GP:ADH21605.1;Name=ADH21605.1;Note=identified by match to protein family HMM PF01895%3B match to protein family HMM TIGR02135;gbkey=CDS;gene=phoU;product=phosphate transport system regulatory protein PhoU;protein_id=ADH21605.1;transl_table=4
CP002027.1	Genbank	sequence_feature	531426	532505	.	+	.	ID=id550;Note=mmyc248f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	532072	533301	.	+	.	ID=gene430;Name=MMSYN1_0429;gbkey=Gene;locus_tag=MMSYN1_0429
CP002027.1	Genbank	CDS	532072	533301	.	+	0	ID=cds396;Parent=gene430;Dbxref=NCBI_GP:ADH22113.1;Name=ADH22113.1;Note=identified by match to protein family HMM PF00448%3B match to protein family HMM PF02881%3B match to protein family HMM TIGR00064;gbkey=CDS;product=peptidase%2C M41 family;protein_id=ADH22113.1;transl_table=4
CP002027.1	Genbank	sequence_feature	532426	533505	.	+	.	ID=id551;Note=mmyc249%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	533291	533626	.	+	.	ID=gene431;Name=MMSYN1_0430;gbkey=Gene;locus_tag=MMSYN1_0430
CP002027.1	Genbank	CDS	533291	533626	.	+	0	ID=cds397;Parent=gene431;Dbxref=NCBI_GP:ADH22244.1;Name=ADH22244.1;Note=identified by match to protein family HMM PF04297%3B match to protein family HMM PF04967;gbkey=CDS;product=putative transcriptional regulator;protein_id=ADH22244.1;transl_table=4
CP002027.1	Genbank	sequence_feature	533426	534505	.	+	.	ID=id552;Note=mmyc250%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	533614	534387	.	+	.	ID=gene432;Name=MMSYN1_0431;gbkey=Gene;locus_tag=MMSYN1_0431
CP002027.1	Genbank	CDS	533614	534387	.	+	0	ID=cds398;Parent=gene432;Dbxref=NCBI_GP:ADH22218.1;Name=ADH22218.1;Note=identified by match to protein family HMM PF00149%3B match to protein family HMM TIGR00282;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22218.1;transl_table=4
CP002027.1	Genbank	sequence_feature	534426	535505	.	+	.	ID=id553;Note=mmyc251%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	534597	535760	.	+	.	ID=gene433;Name=metK;gbkey=Gene;gene=metK;locus_tag=MMSYN1_0432
CP002027.1	Genbank	CDS	534597	535760	.	+	0	ID=cds399;Parent=gene433;Dbxref=NCBI_GP:ADH21619.1;Name=ADH21619.1;Note=identified by match to protein family HMM PF00438%3B match to protein family HMM PF02772%3B match to protein family HMM PF02773%3B match to protein family HMM TIGR01034;gbkey=CDS;gene=metK;product=methionine adenosyltransferase;protein_id=ADH21619.1;transl_table=4
CP002027.1	Genbank	sequence_feature	535426	536505	.	+	.	ID=id554;Note=mmyc252%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	535751	536434	.	+	.	ID=gene434;Name=MMSYN1_0433;gbkey=Gene;locus_tag=MMSYN1_0433
CP002027.1	Genbank	CDS	535751	536434	.	+	0	ID=cds400;Parent=gene434;Dbxref=NCBI_GP:ADH22076.1;Name=ADH22076.1;Note=identified by match to protein family HMM PF03932;gbkey=CDS;product=copper homeostasis protein;protein_id=ADH22076.1;transl_table=4
CP002027.1	Genbank	sequence_feature	536426	537505	.	+	.	ID=id555;Note=mmyc253%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	536427	537743	.	+	.	ID=gene435;Name=trmFO;gbkey=Gene;gene=trmFO;locus_tag=MMSYN1_0434
CP002027.1	Genbank	CDS	536427	537743	.	+	0	ID=cds401;Parent=gene435;Dbxref=NCBI_GP:ADH22016.1;Name=ADH22016.1;Note=identified by match to protein family HMM PF01134%3B match to protein family HMM TIGR00137;gbkey=CDS;gene=trmFO;product=tRNA:M(5)U-54 methyltransferase;protein_id=ADH22016.1;transl_table=4
CP002027.1	Genbank	sequence_feature	537426	538505	.	+	.	ID=id556;Note=mmyc254%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	537769	538698	.	+	.	ID=gene436;Name=MMSYN1_0435;gbkey=Gene;locus_tag=MMSYN1_0435
CP002027.1	Genbank	CDS	537769	538698	.	+	0	ID=cds402;Parent=gene436;Dbxref=NCBI_GP:ADH21883.1;Name=ADH21883.1;Note=identified by match to protein family HMM PF01238;gbkey=CDS;product=phosphomannose isomerase type I;protein_id=ADH21883.1;transl_table=4
CP002027.1	Genbank	sequence_feature	538426	539505	.	+	.	ID=id557;Note=mmyc255%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	538691	539344	.	+	.	ID=gene437;Name=ung;gbkey=Gene;gene=ung;locus_tag=MMSYN1_0436
CP002027.1	Genbank	CDS	538691	539344	.	+	0	ID=cds403;Parent=gene437;Dbxref=NCBI_GP:ADH21987.1;Name=ADH21987.1;Note=identified by match to protein family HMM PF03167;gbkey=CDS;gene=ung;product=uracil-DNA glycosylase (UDG);protein_id=ADH21987.1;transl_table=4
CP002027.1	Genbank	gene	539417	540397	.	+	.	ID=gene438;Name=MMSYN1_0437;gbkey=Gene;locus_tag=MMSYN1_0437
CP002027.1	Genbank	CDS	539417	540397	.	+	0	ID=cds404;Parent=gene438;Dbxref=NCBI_GP:ADH21626.1;Name=ADH21626.1;Note=identified by match to protein family HMM PF01336%3B match to protein family HMM PF01966;gbkey=CDS;product=cmp-binding-factor;protein_id=ADH21626.1;transl_table=4
CP002027.1	Genbank	sequence_feature	539426	540505	.	+	.	ID=id558;Note=mmyc256%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	540426	541505	.	+	.	ID=id559;Note=mmyc257%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	540428	540826	.	-	.	ID=gene439;Name=MMSYN1_0438;gbkey=Gene;locus_tag=MMSYN1_0438
CP002027.1	Genbank	CDS	540428	540826	.	-	0	ID=cds405;Parent=gene439;Dbxref=NCBI_GP:ADH21719.1;Name=ADH21719.1;Note=identified by match to protein family HMM PF01230;gbkey=CDS;product=protein hit;protein_id=ADH21719.1;transl_table=4
CP002027.1	Genbank	gene	540829	542985	.	-	.	ID=gene440;Name=MMSYN1_0439;gbkey=Gene;locus_tag=MMSYN1_0439
CP002027.1	Genbank	CDS	540829	542985	.	-	0	ID=cds406;Parent=gene440;Dbxref=NCBI_GP:ADH22184.1;Name=ADH22184.1;Note=overlaps another CDS with the same product name;gbkey=CDS;product=putative liporotein;protein_id=ADH22184.1;transl_table=4
CP002027.1	Genbank	sequence_feature	541426	542505	.	+	.	ID=id560;Note=mmyc258%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	542426	543505	.	+	.	ID=id561;Note=mmyc259%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	542985	545921	.	-	.	ID=gene441;Name=MMSYN1_0440;gbkey=Gene;locus_tag=MMSYN1_0440
CP002027.1	Genbank	CDS	542985	545921	.	-	0	ID=cds407;Parent=gene441;Dbxref=NCBI_GP:ADH21462.1;Name=ADH21462.1;Note=overlaps another CDS with the same product name;gbkey=CDS;product=putative liporotein;protein_id=ADH21462.1;transl_table=4
CP002027.1	Genbank	sequence_feature	543426	544505	.	+	.	ID=id562;Note=mmyc260%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	544426	545505	.	+	.	ID=id563;Note=mmyc261%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	545426	546505	.	+	.	ID=id564;Note=mmyc262%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	546124	547362	.	+	.	ID=gene442;Name=MMSYN1_0441;gbkey=Gene;locus_tag=MMSYN1_0441
CP002027.1	Genbank	CDS	546124	547362	.	+	0	ID=cds408;Parent=gene442;Dbxref=NCBI_GP:ADH22192.1;Name=ADH22192.1;Note=identified by match to protein family HMM PF00266;gbkey=CDS;product=probable cysteine desulfurase;protein_id=ADH22192.1;transl_table=4
CP002027.1	Genbank	sequence_feature	546426	547505	.	+	.	ID=id565;Note=mmyc263%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	547365	547802	.	+	.	ID=gene443;Name=MMSYN1_0442;gbkey=Gene;locus_tag=MMSYN1_0442
CP002027.1	Genbank	CDS	547365	547802	.	+	0	ID=cds409;Parent=gene443;Dbxref=NCBI_GP:ADH22045.1;Name=ADH22045.1;Note=identified by match to protein family HMM PF01592;gbkey=CDS;product=nitrogen fixation protein nifu;protein_id=ADH22045.1;transl_table=4
CP002027.1	Genbank	sequence_feature	547426	548505	.	+	.	ID=id566;Note=mmyc264%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	547795	548358	.	+	.	ID=gene444;Name=mthfs;gbkey=Gene;gene=mthfs;locus_tag=MMSYN1_0443
CP002027.1	Genbank	CDS	547795	548358	.	+	0	ID=cds410;Parent=gene444;Dbxref=NCBI_GP:ADH21802.1;Name=ADH21802.1;Note=identified by match to protein family HMM PF01812%3B match to protein family HMM TIGR02727;gbkey=CDS;gene=mthfs;product=5-formyltetrahydrofolate cyclo-ligase;protein_id=ADH21802.1;transl_table=4
CP002027.1	Genbank	gene	548379	550274	.	+	.	ID=gene445;Name=MMSYN1_0444;gbkey=Gene;locus_tag=MMSYN1_0444
CP002027.1	Genbank	CDS	548379	550274	.	+	0	ID=cds411;Parent=gene445;Dbxref=NCBI_GP:ADH21908.1;Name=ADH21908.1;Note=identified by match to protein family HMM PF01431%3B match to protein family HMM PF05649;gbkey=CDS;product=endopeptidase O;protein_id=ADH21908.1;transl_table=4
CP002027.1	Genbank	sequence_feature	548426	549505	.	+	.	ID=id567;Note=mmyc265%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	549426	550505	.	+	.	ID=id568;Note=mmyc266%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	550426	551505	.	+	.	ID=id569;Note=mmyc267%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	550494	551777	.	+	.	ID=gene446;Name=pgi;gbkey=Gene;gene=pgi;locus_tag=MMSYN1_0445
CP002027.1	Genbank	CDS	550494	551777	.	+	0	ID=cds412;Parent=gene446;Dbxref=NCBI_GP:ADH21865.1;Name=ADH21865.1;Note=identified by match to protein family HMM PF00342;gbkey=CDS;gene=pgi;product=glucose-6-phosphate isomerase;protein_id=ADH21865.1;transl_table=4
CP002027.1	Genbank	sequence_feature	551426	552505	.	+	.	ID=id570;Note=mmyc268%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	551789	552253	.	+	.	ID=gene447;Name=MMSYN1_0446;gbkey=Gene;locus_tag=MMSYN1_0446
CP002027.1	Genbank	CDS	551789	552253	.	+	0	ID=cds413;Parent=gene447;Dbxref=NCBI_GP:ADH21528.1;Name=ADH21528.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21528.1;transl_table=4
CP002027.1	Genbank	gene	552275	552778	.	+	.	ID=gene448;Name=MMSYN1_0447;gbkey=Gene;locus_tag=MMSYN1_0447
CP002027.1	Genbank	CDS	552275	552778	.	+	0	ID=cds414;Parent=gene448;Dbxref=NCBI_GP:ADH21555.1;Name=ADH21555.1;Note=identified by match to protein family HMM PF08761;gbkey=CDS;product=dUTPase superfamily;protein_id=ADH21555.1;transl_table=4
CP002027.1	Genbank	sequence_feature	552426	553505	.	+	.	ID=id571;Note=mmyc269%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	552795	553562	.	+	.	ID=gene449;Name=MMSYN1_0448;gbkey=Gene;locus_tag=MMSYN1_0448
CP002027.1	Genbank	CDS	552795	553562	.	+	0	ID=cds415;Parent=gene449;Dbxref=NCBI_GP:ADH22119.1;Name=ADH22119.1;Note=identified by match to protein family HMM PF00588%3B match to protein family HMM PF08032;gbkey=CDS;product=rRNA methylase;protein_id=ADH22119.1;transl_table=4
CP002027.1	Genbank	sequence_feature	553426	554505	.	+	.	ID=id572;Note=mmyc270%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	553645	554187	.	+	.	ID=gene450;Name=tnpA_2;gbkey=Gene;gene=tnpA_2;locus_tag=MMSYN1_0449
CP002027.1	Genbank	CDS	553645	554187	.	+	0	ID=cds416;Parent=gene450;Dbxref=NCBI_GP:ADH22241.1;Name=ADH22241.1;gbkey=CDS;gene=tnpA_2;product=IS1296 transposase protein A;protein_id=ADH22241.1;transl_table=4
CP002027.1	Genbank	gene	554325	555056	.	+	.	ID=gene451;Name=tnpB_2;gbkey=Gene;gene=tnpB_2;locus_tag=MMSYN1_0450
CP002027.1	Genbank	CDS	554325	555056	.	+	0	ID=cds417;Parent=gene451;Dbxref=NCBI_GP:ADH21939.1;Name=ADH21939.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_2;product=IS1296 transposase protein B;protein_id=ADH21939.1;transl_table=4
CP002027.1	Genbank	sequence_feature	554426	555505	.	+	.	ID=id573;Note=mmyc271%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	555218	556633	.	+	.	ID=gene452;Name=MMSYN1_0451;gbkey=Gene;locus_tag=MMSYN1_0451
CP002027.1	Genbank	CDS	555218	556633	.	+	0	ID=cds418;Parent=gene452;Dbxref=NCBI_GP:ADH21782.1;Name=ADH21782.1;Note=identified by match to protein family HMM PF00171;gbkey=CDS;product=NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase)(glyceraldehyde-3-phosphate dehydrogenase [nadp+]) (triosephosphatedehydrogenase);protein_id=ADH21782.1;transl_table=4
CP002027.1	Genbank	sequence_feature	555426	556505	.	+	.	ID=id574;Note=mmyc272%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	556426	557505	.	+	.	ID=id575;Note=mmyc273%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	556820	558751	.	+	.	ID=gene453;Name=parE;gbkey=Gene;gene=parE;locus_tag=MMSYN1_0452
CP002027.1	Genbank	CDS	556820	558751	.	+	0	ID=cds419;Parent=gene453;Dbxref=NCBI_GP:ADH21677.1;Name=ADH21677.1;Note=identified by match to protein family HMM PF00204%3B match to protein family HMM PF00986%3B match to protein family HMM PF02518%3B match to protein family HMM TIGR01058;gbkey=CDS;gene=parE;product=DNA topoisomerase IV%2C B subunit;protein_id=ADH21677.1;transl_table=4
CP002027.1	Genbank	sequence_feature	557426	558505	.	+	.	ID=id576;Note=mmyc274%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=parE
CP002027.1	Genbank	sequence_feature	558426	559505	.	+	.	ID=id577;Note=mmyc275%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	558753	561449	.	+	.	ID=gene454;Name=parC;gbkey=Gene;gene=parC;locus_tag=MMSYN1_0453
CP002027.1	Genbank	CDS	558753	561449	.	+	0	ID=cds420;Parent=gene454;Dbxref=NCBI_GP:ADH21695.1;Name=ADH21695.1;Note=identified by match to protein family HMM PF00521%3B match to protein family HMM PF03989%3B match to protein family HMM TIGR01061;gbkey=CDS;gene=parC;product=DNA topoisomerase IV%2C A subunit;protein_id=ADH21695.1;transl_table=4
CP002027.1	Genbank	sequence_feature	559426	560505	.	+	.	ID=id578;Note=mmyc276%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=parC
CP002027.1	Genbank	sequence_feature	560426	561505	.	+	.	ID=id579;Note=mmyc277%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	561426	562505	.	+	.	ID=id580;Note=mmyc278%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	561557	563740	.	+	.	ID=gene455;Name=MMSYN1_0454;gbkey=Gene;locus_tag=MMSYN1_0454
CP002027.1	Genbank	CDS	561557	563740	.	+	0	ID=cds421;Parent=gene455;Dbxref=NCBI_GP:ADH22014.1;Name=ADH22014.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22014.1;transl_table=4
CP002027.1	Genbank	sequence_feature	562426	563505	.	+	.	ID=id581;Note=mmyc279%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	563426	564505	.	+	.	ID=id582;Note=mmyc280%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	563782	565299	.	-	.	ID=gene456;Name=MMSYN1_0455;Note=putative membrane protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0455;pseudo=true
CP002027.1	Genbank	sequence_feature	564426	565505	.	+	.	ID=id583;Note=mmyc281%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	565426	566655	.	+	.	ID=id584;Note=mmycWM1%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	565789	566184	.	+	.	ID=gene457;Name=MMSYN1_0924;gbkey=Gene;locus_tag=MMSYN1_0924
CP002027.1	Genbank	CDS	565789	566184	.	+	0	ID=cds422;Parent=gene457;Dbxref=NCBI_GP:ADH21602.1;Name=ADH21602.1;gbkey=CDS;product=conserved domain protein;protein_id=ADH21602.1;transl_table=4
CP002027.1	Genbank	sequence_feature	566576	567655	.	+	.	ID=id585;Note=mmyc288%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	566641	570003	.	+	.	ID=gene458;Name=MMSYN1_0460;gbkey=Gene;locus_tag=MMSYN1_0460
CP002027.1	Genbank	CDS	566641	570003	.	+	0	ID=cds423;Parent=gene458;Dbxref=NCBI_GP:ADH22214.1;Name=ADH22214.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=bacterial surface protein 26-residue repeat protein (3 repeats);protein_id=ADH22214.1;transl_table=4
CP002027.1	Genbank	sequence_feature	567576	568655	.	+	.	ID=id586;Note=mmyc289%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	568576	569655	.	+	.	ID=id587;Note=mmyc290%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	569576	570655	.	+	.	ID=id588;Note=mmyc291%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	570054	570785	.	-	.	ID=gene459;Name=tnpB_3;gbkey=Gene;gene=tnpB_3;locus_tag=MMSYN1_0461
CP002027.1	Genbank	CDS	570054	570785	.	-	0	ID=cds424;Parent=gene459;Dbxref=NCBI_GP:ADH22109.1;Name=ADH22109.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_3;product=IS1296 transposase protein B;protein_id=ADH22109.1;transl_table=4
CP002027.1	Genbank	sequence_feature	570576	571655	.	+	.	ID=id589;Note=mmyc292%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	570923	571465	.	-	.	ID=gene460;Name=tnpA_3;gbkey=Gene;gene=tnpA_3;locus_tag=MMSYN1_0462
CP002027.1	Genbank	CDS	570923	571465	.	-	0	ID=cds425;Parent=gene460;Dbxref=NCBI_GP:ADH22146.1;Name=ADH22146.1;gbkey=CDS;gene=tnpA_3;product=IS1296 transposase protein A;protein_id=ADH22146.1;transl_table=4
CP002027.1	Genbank	gene	571530	572708	.	-	.	ID=gene461;Name=MMSYN1_0463;gbkey=Gene;locus_tag=MMSYN1_0463
CP002027.1	Genbank	CDS	571530	572708	.	-	0	ID=cds426;Parent=gene461;Dbxref=NCBI_GP:ADH22046.1;Name=ADH22046.1;Note=identified by match to protein family HMM PF00724;gbkey=CDS;product=NADH dependent flavin oxidoreductase;protein_id=ADH22046.1;transl_table=4
CP002027.1	Genbank	sequence_feature	571576	572655	.	+	.	ID=id590;Note=mmyc293%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	572576	573655	.	+	.	ID=id591;Note=mmyc294%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	572708	573745	.	-	.	ID=gene462;Name=MMSYN1_0464;gbkey=Gene;locus_tag=MMSYN1_0464
CP002027.1	Genbank	CDS	572708	573745	.	-	0	ID=cds427;Parent=gene462;Dbxref=NCBI_GP:ADH21951.1;Name=ADH21951.1;Note=identified by match to protein family HMM PF03099%3B match to protein family HMM TIGR00545;gbkey=CDS;product=lipoate--protein ligase;protein_id=ADH21951.1;transl_table=4
CP002027.1	Genbank	sequence_feature	573576	574655	.	+	.	ID=id592;Note=mmyc295%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	573723	574580	.	-	.	ID=gene463;Name=MMSYN1_0465;gbkey=Gene;locus_tag=MMSYN1_0465
CP002027.1	Genbank	CDS	573723	574580	.	-	0	ID=cds428;Parent=gene463;Dbxref=NCBI_GP:ADH21845.1;Name=ADH21845.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21845.1;transl_table=4
CP002027.1	Genbank	sequence_feature	574576	575655	.	+	.	ID=id593;Note=mmyc296%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	574582	574926	.	-	.	ID=gene464;Name=MMSYN1_0466;gbkey=Gene;locus_tag=MMSYN1_0466
CP002027.1	Genbank	CDS	574582	574926	.	-	0	ID=cds429;Parent=gene464;Dbxref=NCBI_GP:ADH21623.1;Name=ADH21623.1;gbkey=CDS;product=glycine cleavage system H protein;protein_id=ADH21623.1;transl_table=4
CP002027.1	Genbank	gene	575113	575907	.	+	.	ID=gene465;Name=MMSYN1_0467;gbkey=Gene;locus_tag=MMSYN1_0467
CP002027.1	Genbank	CDS	575113	575907	.	+	0	ID=cds430;Parent=gene465;Dbxref=NCBI_GP:ADH21693.1;Name=ADH21693.1;Note=identified by match to protein family HMM PF00561;gbkey=CDS;product=triacylglycerol lipase;protein_id=ADH21693.1;transl_table=4
CP002027.1	Genbank	sequence_feature	575576	576655	.	+	.	ID=id594;Note=mmyc297%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	575909	576703	.	+	.	ID=gene466;Name=MMSYN1_0468;gbkey=Gene;locus_tag=MMSYN1_0468
CP002027.1	Genbank	CDS	575909	576703	.	+	0	ID=cds431;Parent=gene466;Dbxref=NCBI_GP:ADH21737.1;Name=ADH21737.1;Note=identified by match to protein family HMM PF00561%3B overlaps another CDS with the same product name;gbkey=CDS;product=lipase-esterase;protein_id=ADH21737.1;transl_table=4
CP002027.1	Genbank	sequence_feature	576576	577655	.	+	.	ID=id595;Note=mmyc298%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	576697	577506	.	+	.	ID=gene467;Name=MMSYN1_0469;gbkey=Gene;locus_tag=MMSYN1_0469
CP002027.1	Genbank	CDS	576697	577506	.	+	0	ID=cds432;Parent=gene467;Dbxref=NCBI_GP:ADH22002.1;Name=ADH22002.1;Note=identified by match to protein family HMM PF00561%3B overlaps another CDS with the same product name;gbkey=CDS;product=lipase-esterase;protein_id=ADH22002.1;transl_table=4
CP002027.1	Genbank	gene	577525	578658	.	-	.	ID=gene468;Name=MMSYN1_0470;gbkey=Gene;locus_tag=MMSYN1_0470
CP002027.1	Genbank	CDS	577525	578658	.	-	0	ID=cds433;Parent=gene468;Dbxref=NCBI_GP:ADH21554.1;Name=ADH21554.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21554.1;transl_table=4
CP002027.1	Genbank	sequence_feature	577576	578655	.	+	.	ID=id596;Note=mmyc299%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	578576	579655	.	+	.	ID=id597;Note=mmyc300%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	578789	578920	.	-	.	ID=gene469;Name=MMSYN1_0471;gbkey=Gene;locus_tag=MMSYN1_0471
CP002027.1	Genbank	CDS	578789	578920	.	-	0	ID=cds434;Parent=gene469;Dbxref=NCBI_GP:ADH21592.1;Name=ADH21592.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21592.1;transl_table=4
CP002027.1	Genbank	gene	578922	580322	.	+	.	ID=gene470;Name=MMSYN1_0472;gbkey=Gene;locus_tag=MMSYN1_0472
CP002027.1	Genbank	CDS	578922	580322	.	+	0	ID=cds435;Parent=gene470;Dbxref=NCBI_GP:ADH22142.1;Name=ADH22142.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22142.1;transl_table=4
CP002027.1	Genbank	sequence_feature	579576	580655	.	+	.	ID=id598;Note=mmyc301%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	580469	581188	.	+	.	ID=gene471;Name=MMSYN1_0473;gbkey=Gene;locus_tag=MMSYN1_0473
CP002027.1	Genbank	CDS	580469	581188	.	+	0	ID=cds436;Parent=gene471;Dbxref=NCBI_GP:ADH21640.1;Name=ADH21640.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=ABC transporter%2C ATP binding protein;protein_id=ADH21640.1;transl_table=4
CP002027.1	Genbank	sequence_feature	580576	581655	.	+	.	ID=id599;Note=mmyc302%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	581188	581943	.	+	.	ID=gene472;Name=MMSYN1_0474;gbkey=Gene;locus_tag=MMSYN1_0474
CP002027.1	Genbank	CDS	581188	581943	.	+	0	ID=cds437;Parent=gene472;Dbxref=NCBI_GP:ADH21929.1;Name=ADH21929.1;Note=identified by match to protein family HMM PF01061;gbkey=CDS;product=integral membrane protein;protein_id=ADH21929.1;transl_table=4
CP002027.1	Genbank	sequence_feature	581576	582655	.	+	.	ID=id600;Note=mmyc303%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	582072	583028	.	-	.	ID=gene473;Name=ldh;gbkey=Gene;gene=ldh;locus_tag=MMSYN1_0475
CP002027.1	Genbank	CDS	582072	583028	.	-	0	ID=cds438;Parent=gene473;Dbxref=NCBI_GP:ADH22250.1;Name=ADH22250.1;Note=identified by match to protein family HMM PF00056%3B match to protein family HMM PF02866%3B match to protein family HMM TIGR01771;gbkey=CDS;gene=ldh;product=L-lactate dehydrogenase;protein_id=ADH22250.1;transl_table=4
CP002027.1	Genbank	sequence_feature	582576	583655	.	+	.	ID=id601;Note=mmyc304%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	583080	584237	.	-	.	ID=gene474;Name=nagA;gbkey=Gene;gene=nagA;locus_tag=MMSYN1_0476
CP002027.1	Genbank	CDS	583080	584237	.	-	0	ID=cds439;Parent=gene474;Dbxref=NCBI_GP:ADH21530.1;Name=ADH21530.1;Note=identified by match to protein family HMM PF01979%3B match to protein family HMM TIGR00221;gbkey=CDS;gene=nagA;product=N-acetylglucosamine-6-phosphate deacetylase;protein_id=ADH21530.1;transl_table=4
CP002027.1	Genbank	sequence_feature	583576	584655	.	+	.	ID=id602;Note=mmyc305%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	584406	585140	.	+	.	ID=gene475;Name=MMSYN1_0477;gbkey=Gene;locus_tag=MMSYN1_0477
CP002027.1	Genbank	CDS	584406	585140	.	+	0	ID=cds440;Parent=gene475;Dbxref=NCBI_GP:ADH21830.1;Name=ADH21830.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21830.1;transl_table=4
CP002027.1	Genbank	sequence_feature	584576	585655	.	+	.	ID=id603;Note=mmyc306%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	585152	585736	.	-	.	ID=gene476;Name=MMSYN1_0478;gbkey=Gene;locus_tag=MMSYN1_0478
CP002027.1	Genbank	CDS	585152	585736	.	-	0	ID=cds441;Parent=gene476;Dbxref=NCBI_GP:ADH21713.1;Name=ADH21713.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21713.1;transl_table=4
CP002027.1	Genbank	sequence_feature	585576	586655	.	+	.	ID=id604;Note=mmyc307%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	585741	587387	.	-	.	ID=gene477;Name=MMSYN1_0479;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0479;pseudo=true
CP002027.1	Genbank	sequence_feature	586576	587655	.	+	.	ID=id605;Note=mmyc308%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	587539	589539	.	+	.	ID=gene478;Name=MMSYN1_0480;gbkey=Gene;locus_tag=MMSYN1_0480
CP002027.1	Genbank	CDS	587539	589539	.	+	0	ID=cds442;Parent=gene478;Dbxref=NCBI_GP:ADH21736.1;Name=ADH21736.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21736.1;transl_table=4
CP002027.1	Genbank	sequence_feature	587576	588655	.	+	.	ID=id606;Note=mmyc309%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	588576	589655	.	+	.	ID=id607;Note=mmyc310%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	589576	590655	.	+	.	ID=id608;Note=mmyc311%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	589611	590048	.	-	.	ID=gene479;Name=vlcE;gbkey=Gene;gene=vlcE;locus_tag=MMSYN1_0481
CP002027.1	Genbank	CDS	589611	590048	.	-	0	ID=cds443;Parent=gene479;Dbxref=NCBI_GP:ADH21476.1;Name=ADH21476.1;gbkey=CDS;gene=vlcE;product=lipoprotein%2C putative (VlcE);protein_id=ADH21476.1;transl_table=4
CP002027.1	Genbank	gene	590364	590528	.	+	.	ID=gene480;Name=rpsU;gbkey=Gene;gene=rpsU;locus_tag=MMSYN1_0482
CP002027.1	Genbank	CDS	590364	590528	.	+	0	ID=cds444;Parent=gene480;Dbxref=NCBI_GP:ADH21475.1;Name=ADH21475.1;Note=identified by match to protein family HMM TIGR00030;gbkey=CDS;gene=rpsU;product=ribosomal protein S21;protein_id=ADH21475.1;transl_table=4
CP002027.1	Genbank	sequence_feature	590576	591655	.	+	.	ID=id609;Note=mmyc312%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	590637	591197	.	+	.	ID=gene481;Name=ruvA;gbkey=Gene;gene=ruvA;locus_tag=MMSYN1_0483
CP002027.1	Genbank	CDS	590637	591197	.	+	0	ID=cds445;Parent=gene481;Dbxref=NCBI_GP:ADH22229.1;Name=ADH22229.1;gbkey=CDS;gene=ruvA;product=holliday junction DNA helicase RuvA;protein_id=ADH22229.1;transl_table=4
CP002027.1	Genbank	gene	591214	592137	.	+	.	ID=gene482;Name=ruvB;gbkey=Gene;gene=ruvB;locus_tag=MMSYN1_0484
CP002027.1	Genbank	CDS	591214	592137	.	+	0	ID=cds446;Parent=gene482;Dbxref=NCBI_GP:ADH22221.1;Name=ADH22221.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM PF05491%3B match to protein family HMM PF05496%3B match to protein family HMM PF07728;gbkey=CDS;gene=ruvB;product=holliday junction ATP-dependent DNA helicase RuvB;protein_id=ADH22221.1;transl_table=4
CP002027.1	Genbank	sequence_feature	591576	592655	.	+	.	ID=id610;Note=mmyc313%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	592215	593573	.	+	.	ID=gene483;Name=MMSYN1_0485;gbkey=Gene;locus_tag=MMSYN1_0485
CP002027.1	Genbank	CDS	592215	593573	.	+	0	ID=cds447;Parent=gene483;Dbxref=NCBI_GP:ADH21877.1;Name=ADH21877.1;Note=identified by match to protein family HMM PF00070%3B match to protein family HMM PF02852%3B match to protein family HMM PF07992;gbkey=CDS;product=dihydrolipoamide dehydrogenase;protein_id=ADH21877.1;transl_table=4
CP002027.1	Genbank	sequence_feature	592576	593655	.	+	.	ID=id611;Note=mmyc314%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	593576	594655	.	+	.	ID=id612;Note=mmyc315%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	593589	594398	.	-	.	ID=gene484;Name=MMSYN1_0486;gbkey=Gene;locus_tag=MMSYN1_0486
CP002027.1	Genbank	CDS	593589	594398	.	-	0	ID=cds448;Parent=gene484;Dbxref=NCBI_GP:ADH22176.1;Name=ADH22176.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22176.1;transl_table=4
CP002027.1	Genbank	gene	594474	595394	.	+	.	ID=gene485;Name=MMSYN1_0487;gbkey=Gene;locus_tag=MMSYN1_0487
CP002027.1	Genbank	CDS	594474	595394	.	+	0	ID=cds449;Parent=gene485;Dbxref=NCBI_GP:ADH22038.1;Name=ADH22038.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22038.1;transl_table=4
CP002027.1	Genbank	sequence_feature	594576	595655	.	+	.	ID=id613;Note=mmyc316%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	595403	596506	.	+	.	ID=gene486;Name=yqeH;gbkey=Gene;gene=yqeH;locus_tag=MMSYN1_0488
CP002027.1	Genbank	CDS	595403	596506	.	+	0	ID=cds450;Parent=gene486;Dbxref=NCBI_GP:ADH21562.1;Name=ADH21562.1;Note=identified by match to protein family HMM TIGR03597;gbkey=CDS;gene=yqeH;product=ribosome biogenesis GTPase YqeH;protein_id=ADH21562.1;transl_table=4
CP002027.1	Genbank	sequence_feature	595576	596655	.	+	.	ID=id614;Note=mmyc317%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	596515	597738	.	-	.	ID=gene487;Name=dinB;gbkey=Gene;gene=dinB;locus_tag=MMSYN1_0489
CP002027.1	Genbank	CDS	596515	597738	.	-	0	ID=cds451;Parent=gene487;Dbxref=NCBI_GP:ADH21465.1;Name=ADH21465.1;Note=identified by match to protein family HMM PF00817;gbkey=CDS;gene=dinB;product=DNA polymerase IV;protein_id=ADH21465.1;transl_table=4
CP002027.1	Genbank	sequence_feature	596576	597655	.	+	.	ID=id615;Note=mmyc318%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	597576	598655	.	+	.	ID=id616;Note=mmyc319%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	597882	600620	.	+	.	ID=gene488;Name=MMSYN1_0490;gbkey=Gene;locus_tag=MMSYN1_0490
CP002027.1	Genbank	CDS	597882	600620	.	+	0	ID=cds452;Parent=gene488;Dbxref=NCBI_GP:ADH22199.1;Name=ADH22199.1;Note=identified by match to protein family HMM PF00112;gbkey=CDS;product=papain family cysteine protease%2C putative;protein_id=ADH22199.1;transl_table=4
CP002027.1	Genbank	sequence_feature	598576	599655	.	+	.	ID=id617;Note=mmyc320%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	599576	600655	.	+	.	ID=id618;Note=mmyc321%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	600576	601655	.	+	.	ID=id619;Note=mmyc322%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	600698	601321	.	-	.	ID=gene489;Name=udk;gbkey=Gene;gene=udk;locus_tag=MMSYN1_0491
CP002027.1	Genbank	CDS	600698	601321	.	-	0	ID=cds453;Parent=gene489;Dbxref=NCBI_GP:ADH21905.1;Name=ADH21905.1;Note=identified by match to protein family HMM PF00485%3B match to protein family HMM TIGR00235;gbkey=CDS;gene=udk;product=uridine kinase;protein_id=ADH21905.1;transl_table=4
CP002027.1	Genbank	gene	601345	601785	.	-	.	ID=gene490;Name=MMSYN1_0492;gbkey=Gene;locus_tag=MMSYN1_0492
CP002027.1	Genbank	CDS	601345	601785	.	-	0	ID=cds454;Parent=gene490;Dbxref=NCBI_GP:ADH22023.1;Name=ADH22023.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22023.1;transl_table=4
CP002027.1	Genbank	sequence_feature	601576	602655	.	+	.	ID=id620;Note=mmyc323%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	601858	603207	.	-	.	ID=gene491;Name=MMSYN1_0493;gbkey=Gene;locus_tag=MMSYN1_0493
CP002027.1	Genbank	CDS	601858	603207	.	-	0	ID=cds455;Parent=gene491;Dbxref=NCBI_GP:ADH21718.1;Name=ADH21718.1;Note=identified by match to protein family HMM PF01546%3B match to protein family HMM TIGR01887;gbkey=CDS;product=Xaa-His dipeptidase;protein_id=ADH21718.1;transl_table=4
CP002027.1	Genbank	sequence_feature	602576	603655	.	+	.	ID=id621;Note=mmyc324%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	603363	604043	.	-	.	ID=gene492;Name=MMSYN1_0494;gbkey=Gene;locus_tag=MMSYN1_0494
CP002027.1	Genbank	CDS	603363	604043	.	-	0	ID=cds456;Parent=gene492;Dbxref=NCBI_GP:ADH21791.1;Name=ADH21791.1;Note=identified by match to protein family HMM PF04131;gbkey=CDS;product=putative N-acetylmannosamine-6-phosphate 2-epimerase (ManNAc-6-P epimerase);protein_id=ADH21791.1;transl_table=4
CP002027.1	Genbank	sequence_feature	603576	604655	.	+	.	ID=id622;Note=mmyc325%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	604102	604977	.	-	.	ID=gene493;Name=MMSYN1_0495;gbkey=Gene;locus_tag=MMSYN1_0495
CP002027.1	Genbank	CDS	604102	604977	.	-	0	ID=cds457;Parent=gene493;Dbxref=NCBI_GP:ADH21507.1;Name=ADH21507.1;Note=identified by match to protein family HMM PF00480;gbkey=CDS;product=ROK family protein;protein_id=ADH21507.1;transl_table=4
CP002027.1	Genbank	sequence_feature	604576	605655	.	+	.	ID=id623;Note=mmyc326%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	604970	605419	.	-	.	ID=gene494;Name=MMSYN1_0496;Note=conserved hypothetical cytosolic protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF04074%3B match to protein family HMM TIGR00022;gbkey=Gene;locus_tag=MMSYN1_0496;pseudo=true
CP002027.1	Genbank	gene	605428	607131	.	-	.	ID=gene495;Name=MMSYN1_0497;gbkey=Gene;locus_tag=MMSYN1_0497
CP002027.1	Genbank	CDS	605428	607131	.	-	0	ID=cds458;Parent=gene495;Dbxref=NCBI_GP:ADH21813.1;Name=ADH21813.1;Note=identified by match to protein family HMM PF00474;gbkey=CDS;product=sodium:solute symporter family;protein_id=ADH21813.1;transl_table=4
CP002027.1	Genbank	sequence_feature	605576	606655	.	+	.	ID=id624;Note=mmyc327%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	606576	607655	.	+	.	ID=id625;Note=mmyc328%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	607133	608020	.	-	.	ID=gene496;Name=nanA;gbkey=Gene;gene=nanA;locus_tag=MMSYN1_0498
CP002027.1	Genbank	CDS	607133	608020	.	-	0	ID=cds459;Parent=gene496;Dbxref=NCBI_GP:ADH21727.1;Name=ADH21727.1;Note=identified by match to protein family HMM PF00701;gbkey=CDS;gene=nanA;product=N-acetylneuraminate lyase (N-acetylneuraminic acidaldolase) (N-acetylneuraminate pyruvate-lyase) (Sialic acid lyase)(Sialate lyase) (Sialic acid aldolase);protein_id=ADH21727.1;transl_table=4
CP002027.1	Genbank	sequence_feature	607576	608655	.	+	.	ID=id626;Note=mmyc329%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	608185	608466	.	-	.	ID=gene497;Name=rpmA;gbkey=Gene;gene=rpmA;locus_tag=MMSYN1_0499
CP002027.1	Genbank	CDS	608185	608466	.	-	0	ID=cds460;Parent=gene497;Dbxref=NCBI_GP:ADH21838.1;Name=ADH21838.1;Note=identified by match to protein family HMM PF01016%3B match to protein family HMM TIGR00062;gbkey=CDS;gene=rpmA;product=ribosomal protein L27;protein_id=ADH21838.1;transl_table=4
CP002027.1	Genbank	gene	608468	608731	.	-	.	ID=gene498;Name=MMSYN1_0500;gbkey=Gene;locus_tag=MMSYN1_0500
CP002027.1	Genbank	CDS	608468	608731	.	-	0	ID=cds461;Parent=gene498;Dbxref=NCBI_GP:ADH21553.1;Name=ADH21553.1;Note=identified by match to protein family HMM PF04327;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21553.1;transl_table=4
CP002027.1	Genbank	sequence_feature	608576	609655	.	+	.	ID=id627;Note=mmyc330%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	608785	609087	.	-	.	ID=gene499;Name=rplU;gbkey=Gene;gene=rplU;locus_tag=MMSYN1_0501
CP002027.1	Genbank	CDS	608785	609087	.	-	0	ID=cds462;Parent=gene499;Dbxref=NCBI_GP:ADH21612.1;Name=ADH21612.1;Note=identified by match to protein family HMM PF00829%3B match to protein family HMM TIGR00061;gbkey=CDS;gene=rplU;product=ribosomal protein L21;protein_id=ADH21612.1;transl_table=4
CP002027.1	Genbank	sequence_feature	609094	609167	.	-	.	ID=id628;Note=Ribosomal protein L21 leader;gbkey=misc_feature
CP002027.1	Genbank	gene	609233	609634	.	-	.	ID=gene500;Name=MMSYN1_0503;gbkey=Gene;locus_tag=MMSYN1_0503
CP002027.1	Genbank	CDS	609233	609634	.	-	0	ID=cds463;Parent=gene500;Dbxref=NCBI_GP:ADH21909.1;Name=ADH21909.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21909.1;transl_table=4
CP002027.1	Genbank	sequence_feature	609576	610655	.	+	.	ID=id629;Note=mmyc331%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	609657	610544	.	-	.	ID=gene501;Name=MMSYN1_0504;gbkey=Gene;locus_tag=MMSYN1_0504
CP002027.1	Genbank	CDS	609657	610544	.	-	0	ID=cds464;Parent=gene501;Dbxref=NCBI_GP:ADH22269.1;Name=ADH22269.1;Note=identified by match to protein family HMM PF00590%3B match to protein family HMM TIGR00096;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22269.1;transl_table=4
CP002027.1	Genbank	sequence_feature	610576	611655	.	+	.	ID=id630;Note=mmyc332%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	610920	611993	.	+	.	ID=gene502;Name=MMSYN1_0505;gbkey=Gene;locus_tag=MMSYN1_0505
CP002027.1	Genbank	CDS	610920	611993	.	+	0	ID=cds465;Parent=gene502;Dbxref=NCBI_GP:ADH21670.1;Name=ADH21670.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21670.1;transl_table=4
CP002027.1	Genbank	sequence_feature	611576	612655	.	+	.	ID=id631;Note=mmyc333%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	612086	612174	.	-	.	ID=gene503;Name=MMSYN1_0506;gbkey=Gene;locus_tag=MMSYN1_0506
CP002027.1	Genbank	tRNA	612086	612174	.	-	.	ID=rna14;Parent=gene503;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	exon	612086	612174	.	-	.	ID=id632;Parent=rna14;gbkey=tRNA;product=tRNA-Leu
CP002027.1	Genbank	gene	612185	612260	.	-	.	ID=gene504;Name=MMSYN1_0507;gbkey=Gene;locus_tag=MMSYN1_0507
CP002027.1	Genbank	tRNA	612185	612260	.	-	.	ID=rna15;Parent=gene504;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	exon	612185	612260	.	-	.	ID=id633;Parent=rna15;gbkey=tRNA;product=tRNA-Lys
CP002027.1	Genbank	gene	612265	612339	.	-	.	ID=gene505;Name=MMSYN1_0508;gbkey=Gene;locus_tag=MMSYN1_0508
CP002027.1	Genbank	tRNA	612265	612339	.	-	.	ID=rna16;Parent=gene505;gbkey=tRNA;product=tRNA-Gln
CP002027.1	Genbank	exon	612265	612339	.	-	.	ID=id634;Parent=rna16;gbkey=tRNA;product=tRNA-Gln
CP002027.1	Genbank	gene	612346	612429	.	-	.	ID=gene506;Name=MMSYN1_0509;gbkey=Gene;locus_tag=MMSYN1_0509
CP002027.1	Genbank	tRNA	612346	612429	.	-	.	ID=rna17;Parent=gene506;gbkey=tRNA;product=tRNA-Tyr
CP002027.1	Genbank	exon	612346	612429	.	-	.	ID=id635;Parent=rna17;gbkey=tRNA;product=tRNA-Tyr
CP002027.1	Genbank	gene	612436	612511	.	-	.	ID=gene507;Name=MMSYN1_0510;gbkey=Gene;locus_tag=MMSYN1_0510
CP002027.1	Genbank	tRNA	612436	612511	.	-	.	ID=rna18;Parent=gene507;gbkey=tRNA;product=tRNA-Thr
CP002027.1	Genbank	exon	612436	612511	.	-	.	ID=id636;Parent=rna18;gbkey=tRNA;product=tRNA-Thr
CP002027.1	Genbank	sequence_feature	612576	613655	.	+	.	ID=id637;Note=mmyc334%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	612638	613261	.	-	.	ID=gene508;Name=MMSYN1_0511;gbkey=Gene;locus_tag=MMSYN1_0511
CP002027.1	Genbank	CDS	612638	613261	.	-	0	ID=cds466;Parent=gene508;Dbxref=NCBI_GP:ADH22050.1;Name=ADH22050.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22050.1;transl_table=4
CP002027.1	Genbank	gene	613310	614248	.	-	.	ID=gene509;Name=plsC;gbkey=Gene;gene=plsC;locus_tag=MMSYN1_0512
CP002027.1	Genbank	CDS	613310	614248	.	-	0	ID=cds467;Parent=gene509;Dbxref=NCBI_GP:ADH21826.1;Name=ADH21826.1;Note=identified by match to protein family HMM PF01553;gbkey=CDS;gene=plsC;product=1-acyl-sn-glycerol-3-phosphate acyltransferase;protein_id=ADH21826.1;transl_table=4
CP002027.1	Genbank	sequence_feature	613576	614655	.	+	.	ID=id638;Note=mmyc335%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	614414	614746	.	-	.	ID=gene510;Name=acpS;gbkey=Gene;gene=acpS;locus_tag=MMSYN1_0513
CP002027.1	Genbank	CDS	614414	614746	.	-	0	ID=cds468;Parent=gene510;Dbxref=NCBI_GP:ADH21968.1;Name=ADH21968.1;Note=identified by match to protein family HMM PF01648%3B match to protein family HMM TIGR00556;gbkey=CDS;gene=acpS;product=holo-[acyl-carrier-protein] synthase;protein_id=ADH21968.1;transl_table=4
CP002027.1	Genbank	sequence_feature	614576	615655	.	+	.	ID=id639;Note=mmyc336%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	614766	615842	.	-	.	ID=gene511;Name=MMSYN1_0514;gbkey=Gene;locus_tag=MMSYN1_0514
CP002027.1	Genbank	CDS	614766	615842	.	-	0	ID=cds469;Parent=gene511;Dbxref=NCBI_GP:ADH22216.1;Name=ADH22216.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22216.1;transl_table=4
CP002027.1	Genbank	sequence_feature	615576	616655	.	+	.	ID=id640;Note=mmyc337%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	615883	616365	.	-	.	ID=gene512;Name=MMSYN1_0515;gbkey=Gene;locus_tag=MMSYN1_0515
CP002027.1	Genbank	CDS	615883	616365	.	-	0	ID=cds470;Parent=gene512;Dbxref=NCBI_GP:ADH21805.1;Name=ADH21805.1;Note=identified by match to protein family HMM PF00383;gbkey=CDS;product=deoxycytidylate deaminase (dCMP deaminase);protein_id=ADH21805.1;transl_table=4
CP002027.1	Genbank	gene	616368	617669	.	-	.	ID=gene513;Name=MMSYN1_0516;gbkey=Gene;locus_tag=MMSYN1_0516
CP002027.1	Genbank	CDS	616368	617669	.	-	0	ID=cds471;Parent=gene513;Dbxref=NCBI_GP:ADH21497.1;Name=ADH21497.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21497.1;transl_table=4
CP002027.1	Genbank	sequence_feature	616576	617655	.	+	.	ID=id641;Note=mmyc338%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	617576	618655	.	+	.	ID=id642;Note=mmyc339%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	617662	618594	.	-	.	ID=gene514;Name=MMSYN1_0517;gbkey=Gene;locus_tag=MMSYN1_0517
CP002027.1	Genbank	CDS	617662	618594	.	-	0	ID=cds472;Parent=gene514;Dbxref=NCBI_GP:ADH21954.1;Name=ADH21954.1;Note=identified by match to protein family HMM PF00849%3B match to protein family HMM PF01479%3B match to protein family HMM TIGR00005;gbkey=CDS;product=ribosomal large subunit pseudouridine synthase D;protein_id=ADH21954.1;transl_table=4
CP002027.1	Genbank	gene	618575	619183	.	-	.	ID=gene515;Name=lspA;gbkey=Gene;gene=lspA;locus_tag=MMSYN1_0518
CP002027.1	Genbank	CDS	618575	619183	.	-	0	ID=cds473;Parent=gene515;Dbxref=NCBI_GP:ADH22052.1;Name=ADH22052.1;gbkey=CDS;gene=lspA;product=signal peptidase II;protein_id=ADH22052.1;transl_table=4
CP002027.1	Genbank	sequence_feature	618576	619655	.	+	.	ID=id643;Note=mmyc340%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	619174	621921	.	-	.	ID=gene516;Name=ileS;gbkey=Gene;gene=ileS;locus_tag=MMSYN1_0519
CP002027.1	Genbank	CDS	619174	621921	.	-	0	ID=cds474;Parent=gene516;Dbxref=NCBI_GP:ADH22143.1;Name=ADH22143.1;Note=identified by match to protein family HMM PF00133%3B match to protein family HMM PF06827%3B match to protein family HMM PF08264%3B match to protein family HMM PF09334%3B match to protein family HMM TIGR00392;gbkey=CDS;gene=ileS;product=isoleucine--tRNA ligase;protein_id=ADH22143.1;transl_table=4
CP002027.1	Genbank	sequence_feature	619576	620655	.	+	.	ID=id644;Note=mmyc341%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	620576	621655	.	+	.	ID=id645;Note=mmyc342f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	621576	622655	.	+	.	ID=id646;Note=mmyc343%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	622576	623655	.	+	.	ID=id647;Note=mmyc344%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	622614	623603	.	-	.	ID=gene517;Name=MMSYN1_0520;gbkey=Gene;locus_tag=MMSYN1_0520
CP002027.1	Genbank	CDS	622614	623603	.	-	0	ID=cds475;Parent=gene517;Dbxref=NCBI_GP:ADH22217.1;Name=ADH22217.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22217.1;transl_table=4
CP002027.1	Genbank	sequence_feature	623576	624655	.	+	.	ID=id648;Note=mmyc345%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	623616	624032	.	-	.	ID=gene518;Name=MMSYN1_0521;gbkey=Gene;locus_tag=MMSYN1_0521
CP002027.1	Genbank	CDS	623616	624032	.	-	0	ID=cds476;Parent=gene518;Dbxref=NCBI_GP:ADH21551.1;Name=ADH21551.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21551.1;transl_table=4
CP002027.1	Genbank	gene	624044	625201	.	-	.	ID=gene519;Name=ftsZ;gbkey=Gene;gene=ftsZ;locus_tag=MMSYN1_0522
CP002027.1	Genbank	CDS	624044	625201	.	-	0	ID=cds477;Parent=gene519;Dbxref=NCBI_GP:ADH21635.1;Name=ADH21635.1;Note=identified by match to protein family HMM PF00091%3B match to protein family HMM PF03953%3B match to protein family HMM TIGR00065;gbkey=CDS;gene=ftsZ;product=cell division protein FtsZ;protein_id=ADH21635.1;transl_table=4
CP002027.1	Genbank	sequence_feature	624576	625655	.	+	.	ID=id649;Note=mmyc346%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	625316	626476	.	-	.	ID=gene520;Name=MMSYN1_0523;gbkey=Gene;locus_tag=MMSYN1_0523
CP002027.1	Genbank	CDS	625316	626476	.	-	0	ID=cds478;Parent=gene520;Dbxref=NCBI_GP:ADH22085.1;Name=ADH22085.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22085.1;transl_table=4
CP002027.1	Genbank	sequence_feature	625576	626655	.	+	.	ID=id650;Note=mmyc347%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	626485	627411	.	-	.	ID=gene521;Name=mraW;gbkey=Gene;gene=mraW;locus_tag=MMSYN1_0524
CP002027.1	Genbank	CDS	626485	627411	.	-	0	ID=cds479;Parent=gene521;Dbxref=NCBI_GP:ADH21524.1;Name=ADH21524.1;Note=identified by match to protein family HMM PF01795%3B match to protein family HMM TIGR00006;gbkey=CDS;gene=mraW;product=S-adenosyl-methyltransferase MraW;protein_id=ADH21524.1;transl_table=4
CP002027.1	Genbank	sequence_feature	626576	627655	.	+	.	ID=id651;Note=mmyc348%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	627420	627821	.	-	.	ID=gene522;Name=mraZ;gbkey=Gene;gene=mraZ;locus_tag=MMSYN1_0525
CP002027.1	Genbank	CDS	627420	627821	.	-	0	ID=cds480;Parent=gene522;Dbxref=NCBI_GP:ADH21661.1;Name=ADH21661.1;Note=identified by match to protein family HMM PF02381;gbkey=CDS;gene=mraZ;product=protein MraZ;protein_id=ADH21661.1;transl_table=4
CP002027.1	Genbank	sequence_feature	627576	628655	.	+	.	ID=id652;Note=mmyc349%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	627928	628107	.	-	.	ID=gene523;Name=rpmF;gbkey=Gene;gene=rpmF;locus_tag=MMSYN1_0526
CP002027.1	Genbank	CDS	627928	628107	.	-	0	ID=cds481;Parent=gene523;Dbxref=NCBI_GP:ADH21527.1;Name=ADH21527.1;Note=identified by match to protein family HMM PF01783%3B match to protein family HMM TIGR01031;gbkey=CDS;gene=rpmF;product=ribosomal protein L32;protein_id=ADH21527.1;transl_table=4
CP002027.1	Genbank	gene	628122	628640	.	-	.	ID=gene524;Name=MMSYN1_0527;gbkey=Gene;locus_tag=MMSYN1_0527
CP002027.1	Genbank	CDS	628122	628640	.	-	0	ID=cds482;Parent=gene524;Dbxref=NCBI_GP:ADH21906.1;Name=ADH21906.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21906.1;transl_table=4
CP002027.1	Genbank	sequence_feature	628576	629655	.	+	.	ID=id653;Note=mmyc350%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	628640	631024	.	-	.	ID=gene525;Name=pheT;gbkey=Gene;gene=pheT;locus_tag=MMSYN1_0528
CP002027.1	Genbank	CDS	628640	631024	.	-	0	ID=cds483;Parent=gene525;Dbxref=NCBI_GP:ADH21712.1;Name=ADH21712.1;Note=identified by match to protein family HMM PF01588%3B match to protein family HMM PF03147%3B match to protein family HMM PF03484%3B match to protein family HMM TIGR00472;gbkey=CDS;gene=pheT;product=phenylalanyl-tRNA synthetase%2C beta subunit;protein_id=ADH21712.1;transl_table=4
CP002027.1	Genbank	sequence_feature	629576	630655	.	+	.	ID=id654;Note=mmyc351%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	630576	631655	.	+	.	ID=id655;Note=mmyc352%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	631033	632085	.	-	.	ID=gene526;Name=pheS;gbkey=Gene;gene=pheS;locus_tag=MMSYN1_0529
CP002027.1	Genbank	CDS	631033	632085	.	-	0	ID=cds484;Parent=gene526;Dbxref=NCBI_GP:ADH22017.1;Name=ADH22017.1;Note=identified by match to protein family HMM PF01409%3B match to protein family HMM PF02912%3B match to protein family HMM TIGR00468;gbkey=CDS;gene=pheS;product=phenylalanyl-tRNA synthetase%2C alpha subunit;protein_id=ADH22017.1;transl_table=4
CP002027.1	Genbank	sequence_feature	631576	632655	.	+	.	ID=id656;Note=mmyc353%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	632115	632723	.	-	.	ID=gene527;Name=MMSYN1_0530;gbkey=Gene;locus_tag=MMSYN1_0530
CP002027.1	Genbank	CDS	632115	632723	.	-	0	ID=cds485;Parent=gene527;Dbxref=NCBI_GP:ADH21957.1;Name=ADH21957.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21957.1;transl_table=4
CP002027.1	Genbank	sequence_feature	632576	633655	.	+	.	ID=id657;Note=mmyc354%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	632732	637180	.	-	.	ID=gene528;Name=MMSYN1_0531;gbkey=Gene;locus_tag=MMSYN1_0531
CP002027.1	Genbank	CDS	632732	637180	.	-	0	ID=cds486;Parent=gene528;Dbxref=NCBI_GP:ADH22236.1;Name=ADH22236.1;Note=identified by match to protein family HMM PF02687;gbkey=CDS;product=efflux ABC transporter%2C permease protein;protein_id=ADH22236.1;transl_table=4
CP002027.1	Genbank	sequence_feature	633576	634655	.	+	.	ID=id658;Note=mmyc355%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	634576	635655	.	+	.	ID=id659;Note=mmyc356%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	635576	636655	.	+	.	ID=id660;Note=mmyc357%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	636576	637655	.	+	.	ID=id661;Note=mmyc358%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	637296	637404	.	-	.	ID=gene529;Name=rrf;gbkey=Gene;gene=rrf;locus_tag=MMSYN1_0532
CP002027.1	Genbank	rRNA	637296	637404	.	-	.	ID=rna19;Parent=gene529;gbkey=rRNA;gene=rrf;product=5S ribosomal RNA
CP002027.1	Genbank	exon	637296	637404	.	-	.	ID=id662;Parent=rna19;gbkey=rRNA;gene=rrf;product=5S ribosomal RNA
CP002027.1	Genbank	gene	637479	640373	.	-	.	ID=gene530;Name=rrl;gbkey=Gene;gene=rrl;locus_tag=MMSYN1_0533
CP002027.1	Genbank	rRNA	637479	640373	.	-	.	ID=rna20;Parent=gene530;gbkey=rRNA;gene=rrl;product=23S ribosomal RNA
CP002027.1	Genbank	exon	637479	640373	.	-	.	ID=id663;Parent=rna20;gbkey=rRNA;gene=rrl;product=23S ribosomal RNA
CP002027.1	Genbank	sequence_feature	637576	638655	.	+	.	ID=id664;Note=mmyc359%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	638576	639655	.	+	.	ID=id665;Note=mmyc360%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	639088	640167	.	+	.	ID=id666;Note=mmyc907%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	639576	640655	.	+	.	ID=id667;Note=mmyc361%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	640576	641655	.	+	.	ID=id668;Note=mmyc362%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	640604	642127	.	-	.	ID=gene531;Name=rrs;gbkey=Gene;gene=rrs;locus_tag=MMSYN1_0534
CP002027.1	Genbank	rRNA	640604	642127	.	-	.	ID=rna21;Parent=gene531;gbkey=rRNA;gene=rrs;product=16S ribosomal RNA
CP002027.1	Genbank	exon	640604	642127	.	-	.	ID=id669;Parent=rna21;gbkey=rRNA;gene=rrs;product=16S ribosomal RNA
CP002027.1	Genbank	sequence_feature	641576	642655	.	+	.	ID=id670;Note=mmyc363%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	642339	644003	.	-	.	ID=gene532;Name=argS;gbkey=Gene;gene=argS;locus_tag=MMSYN1_0535
CP002027.1	Genbank	CDS	642339	644003	.	-	0	ID=cds487;Parent=gene532;Dbxref=NCBI_GP:ADH22169.1;Name=ADH22169.1;Note=identified by match to protein family HMM PF00750%3B match to protein family HMM PF03485%3B match to protein family HMM PF05746%3B match to protein family HMM PF09334%3B match to protein family HMM TIGR00456;gbkey=CDS;gene=argS;product=arginine--tRNA ligase;protein_id=ADH22169.1;transl_table=4
CP002027.1	Genbank	sequence_feature	642576	643655	.	+	.	ID=id671;Note=mmyc364%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	643576	644655	.	+	.	ID=id672;Note=mmyc365%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	644005	644553	.	-	.	ID=gene533;Name=frr;gbkey=Gene;gene=frr;locus_tag=MMSYN1_0536
CP002027.1	Genbank	CDS	644005	644553	.	-	0	ID=cds488;Parent=gene533;Dbxref=NCBI_GP:ADH22039.1;Name=ADH22039.1;Note=identified by match to protein family HMM PF01765%3B match to protein family HMM TIGR00496;gbkey=CDS;gene=frr;product=ribosome recycling factor;protein_id=ADH22039.1;transl_table=4
CP002027.1	Genbank	gene	644564	645277	.	-	.	ID=gene534;Name=pyrH;gbkey=Gene;gene=pyrH;locus_tag=MMSYN1_0537
CP002027.1	Genbank	CDS	644564	645277	.	-	0	ID=cds489;Parent=gene534;Dbxref=NCBI_GP:ADH22156.1;Name=ADH22156.1;Note=identified by match to protein family HMM PF00696%3B match to protein family HMM TIGR02075;gbkey=CDS;gene=pyrH;product=UMP kinase;protein_id=ADH22156.1;transl_table=4
CP002027.1	Genbank	sequence_feature	644576	645655	.	+	.	ID=id673;Note=mmyc366%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	645411	646016	.	-	.	ID=gene535;Name=MMSYN1_0538;gbkey=Gene;locus_tag=MMSYN1_0538
CP002027.1	Genbank	CDS	645411	646016	.	-	0	ID=cds490;Parent=gene535;Dbxref=NCBI_GP:ADH22242.1;Name=ADH22242.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22242.1;transl_table=4
CP002027.1	Genbank	sequence_feature	645576	646655	.	+	.	ID=id674;Note=mmyc367%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	646016	646903	.	-	.	ID=gene536;Name=tsf;gbkey=Gene;gene=tsf;locus_tag=MMSYN1_0539
CP002027.1	Genbank	CDS	646016	646903	.	-	0	ID=cds491;Parent=gene536;Dbxref=NCBI_GP:ADH21922.1;Name=ADH21922.1;Note=identified by match to protein family HMM PF00627%3B match to protein family HMM PF00889%3B match to protein family HMM TIGR00116;gbkey=CDS;gene=tsf;product=translation elongation factor Ts;protein_id=ADH21922.1;transl_table=4
CP002027.1	Genbank	sequence_feature	646576	647655	.	+	.	ID=id675;Note=mmyc368%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	646915	647793	.	-	.	ID=gene537;Name=rpsB;gbkey=Gene;gene=rpsB;locus_tag=MMSYN1_0540
CP002027.1	Genbank	CDS	646915	647793	.	-	0	ID=cds492;Parent=gene537;Dbxref=NCBI_GP:ADH22066.1;Name=ADH22066.1;Note=identified by match to protein family HMM PF00318%3B match to protein family HMM TIGR01011;gbkey=CDS;gene=rpsB;product=ribosomal protein S2;protein_id=ADH22066.1;transl_table=4
CP002027.1	Genbank	sequence_feature	647576	648655	.	+	.	ID=id676;Note=mmyc369%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	648001	649119	.	-	.	ID=gene538;Name=dnaJ;gbkey=Gene;gene=dnaJ;locus_tag=MMSYN1_0541
CP002027.1	Genbank	CDS	648001	649119	.	-	0	ID=cds493;Parent=gene538;Dbxref=NCBI_GP:ADH21728.1;Name=ADH21728.1;Note=identified by match to protein family HMM PF00226%3B match to protein family HMM PF00684%3B match to protein family HMM PF01556%3B match to protein family HMM TIGR02349;gbkey=CDS;gene=dnaJ;product=chaperone protein DnaJ;protein_id=ADH21728.1;transl_table=4
CP002027.1	Genbank	sequence_feature	648576	649655	.	+	.	ID=id677;Note=mmyc370%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	649183	650958	.	-	.	ID=gene539;Name=dnaK;gbkey=Gene;gene=dnaK;locus_tag=MMSYN1_0542
CP002027.1	Genbank	CDS	649183	650958	.	-	0	ID=cds494;Parent=gene539;Dbxref=NCBI_GP:ADH21821.1;Name=ADH21821.1;Note=identified by match to protein family HMM PF00012%3B match to protein family HMM TIGR02350;gbkey=CDS;gene=dnaK;product=chaperone protein DnaK;protein_id=ADH21821.1;transl_table=4
CP002027.1	Genbank	sequence_feature	649576	650655	.	+	.	ID=id678;Note=mmyc371%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	650576	651655	.	+	.	ID=id679;Note=mmyc372%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	651017	651619	.	-	.	ID=gene540;Name=grpE;gbkey=Gene;gene=grpE;locus_tag=MMSYN1_0543
CP002027.1	Genbank	CDS	651017	651619	.	-	0	ID=cds495;Parent=gene540;Dbxref=NCBI_GP:ADH21616.1;Name=ADH21616.1;Note=identified by match to protein family HMM PF01025;gbkey=CDS;gene=grpE;product=co-chaperone GrpE;protein_id=ADH21616.1;transl_table=4
CP002027.1	Genbank	sequence_feature	651576	652655	.	+	.	ID=id680;Note=mmyc373%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	651621	652643	.	-	.	ID=gene541;Name=hrcA;gbkey=Gene;gene=hrcA;locus_tag=MMSYN1_0544
CP002027.1	Genbank	CDS	651621	652643	.	-	0	ID=cds496;Parent=gene541;Dbxref=NCBI_GP:ADH21574.1;Name=ADH21574.1;Note=identified by match to protein family HMM PF01628%3B match to protein family HMM TIGR00331;gbkey=CDS;gene=hrcA;product=heat-inducible transcription repressor HrcA;protein_id=ADH21574.1;transl_table=4
CP002027.1	Genbank	sequence_feature	652576	653655	.	+	.	ID=id681;Note=mmyc374%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	652648	654789	.	-	.	ID=gene542;Name=MMSYN1_0545;gbkey=Gene;locus_tag=MMSYN1_0545
CP002027.1	Genbank	CDS	652648	654789	.	-	0	ID=cds497;Parent=gene542;Dbxref=NCBI_GP:ADH22245.1;Name=ADH22245.1;Note=identified by match to protein family HMM PF00004%3B match to protein family HMM PF07724%3B match to protein family HMM PF07728;gbkey=CDS;product=ATPase family associated with various cellular activities (AAA) protein;protein_id=ADH22245.1;transl_table=4
CP002027.1	Genbank	sequence_feature	653576	654655	.	+	.	ID=id682;Note=mmyc375%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	654576	655655	.	+	.	ID=id683;Note=mmyc376%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	654952	655188	.	-	.	ID=gene543;Name=MMSYN1_0546;Note=putative hydrolase of the HAD family%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0546;pseudo=true
CP002027.1	Genbank	pseudogene	655176	655817	.	-	.	ID=gene544;Name=MMSYN1_0547;Note=putative hydrolase of the HAD family%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF08282;gbkey=Gene;locus_tag=MMSYN1_0547;pseudo=true
CP002027.1	Genbank	sequence_feature	655576	656655	.	+	.	ID=id684;Note=mmyc377%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	655817	656362	.	-	.	ID=gene545;Name=MMSYN1_0548;gbkey=Gene;locus_tag=MMSYN1_0548
CP002027.1	Genbank	CDS	655817	656362	.	-	0	ID=cds498;Parent=gene545;Dbxref=NCBI_GP:ADH21500.1;Name=ADH21500.1;Note=identified by match to protein family HMM PF00588;gbkey=CDS;product=rRNA Methylase;protein_id=ADH21500.1;transl_table=4
CP002027.1	Genbank	gene	656375	656977	.	-	.	ID=gene546;Name=MMSYN1_0549;gbkey=Gene;locus_tag=MMSYN1_0549
CP002027.1	Genbank	CDS	656375	656977	.	-	0	ID=cds499;Parent=gene546;Dbxref=NCBI_GP:ADH22189.1;Name=ADH22189.1;Note=identified by match to protein family HMM PF01725;gbkey=CDS;product=Ham1 family;protein_id=ADH22189.1;transl_table=4
CP002027.1	Genbank	sequence_feature	656576	657655	.	+	.	ID=id685;Note=mmyc378%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	657179	659694	.	+	.	ID=gene547;Name=MMSYN1_0550;Note=putative lipoprotein%2C authentic frameshift%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0550;pseudo=true
CP002027.1	Genbank	sequence_feature	657576	658655	.	+	.	ID=id686;Note=mmyc379%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	658576	659655	.	+	.	ID=id687;Note=mmyc380%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	659576	660655	.	+	.	ID=id688;Note=mmyc381%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	659874	662378	.	+	.	ID=gene548;Name=MMSYN1_0551;gbkey=Gene;locus_tag=MMSYN1_0551
CP002027.1	Genbank	CDS	659874	662378	.	+	0	ID=cds500;Parent=gene548;Dbxref=NCBI_GP:ADH21780.1;Name=ADH21780.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21780.1;transl_table=4
CP002027.1	Genbank	sequence_feature	660576	661655	.	+	.	ID=id689;Note=mmyc382%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	661576	662655	.	+	.	ID=id690;Note=mmyc383%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	662576	663655	.	+	.	ID=id691;Note=mmyc384%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	662695	663483	.	+	.	ID=gene549;Name=MMSYN1_0552;gbkey=Gene;locus_tag=MMSYN1_0552
CP002027.1	Genbank	CDS	662695	663483	.	+	0	ID=cds501;Parent=gene549;Dbxref=NCBI_GP:ADH21724.1;Name=ADH21724.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21724.1;transl_table=4
CP002027.1	Genbank	sequence_feature	663576	664655	.	+	.	ID=id692;Note=mmyc385%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	663752	664993	.	+	.	ID=gene550;Name=MMSYN1_0553;gbkey=Gene;locus_tag=MMSYN1_0553
CP002027.1	Genbank	CDS	663752	664993	.	+	0	ID=cds502;Parent=gene550;Dbxref=NCBI_GP:ADH21654.1;Name=ADH21654.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21654.1;transl_table=4
CP002027.1	Genbank	sequence_feature	664576	665655	.	+	.	ID=id693;Note=mmyc386%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	665166	665999	.	+	.	ID=gene551;Name=MMSYN1_0554;gbkey=Gene;locus_tag=MMSYN1_0554
CP002027.1	Genbank	CDS	665166	665999	.	+	0	ID=cds503;Parent=gene551;Dbxref=NCBI_GP:ADH21491.1;Name=ADH21491.1;gbkey=CDS;product=C-5 cytosine-specific DNA methylase;protein_id=ADH21491.1;transl_table=4
CP002027.1	Genbank	sequence_feature	665576	666655	.	+	.	ID=id694;Note=mmyc387%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	666028	668043	.	+	.	ID=gene552;Name=MMSYN1_0555;gbkey=Gene;locus_tag=MMSYN1_0555
CP002027.1	Genbank	CDS	666028	668043	.	+	0	ID=cds504;Parent=gene552;Dbxref=NCBI_GP:ADH21926.1;Name=ADH21926.1;gbkey=CDS;product=membrane protein%2C putative (TraD/TraG family);protein_id=ADH21926.1;transl_table=4
CP002027.1	Genbank	sequence_feature	666576	667655	.	+	.	ID=id695;Note=mmyc388%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	667576	668655	.	+	.	ID=id696;Note=mmyc389%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	668059	669015	.	+	.	ID=gene553;Name=MMSYN1_0556;gbkey=Gene;locus_tag=MMSYN1_0556
CP002027.1	Genbank	CDS	668059	669015	.	+	0	ID=cds505;Parent=gene553;Dbxref=NCBI_GP:ADH21775.1;Name=ADH21775.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167%3B overlaps another CDS with the same product name;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21775.1;transl_table=4
CP002027.1	Genbank	sequence_feature	668576	669655	.	+	.	ID=id697;Note=mmyc390%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	668999	669916	.	+	.	ID=gene554;Name=MMSYN1_0557;gbkey=Gene;locus_tag=MMSYN1_0557
CP002027.1	Genbank	CDS	668999	669916	.	+	0	ID=cds506;Parent=gene554;Dbxref=NCBI_GP:ADH21480.1;Name=ADH21480.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167%3B overlaps another CDS with the same product name;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21480.1;transl_table=4
CP002027.1	Genbank	sequence_feature	669576	670655	.	+	.	ID=id698;Note=mmyc391%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	669931	670347	.	+	.	ID=gene555;Name=MMSYN1_0558;gbkey=Gene;locus_tag=MMSYN1_0558
CP002027.1	Genbank	CDS	669931	670347	.	+	0	ID=cds507;Parent=gene555;Dbxref=NCBI_GP:ADH21588.1;Name=ADH21588.1;Note=identified by match to protein family HMM PF00436%3B match to protein family HMM PF01336;gbkey=CDS;product=single-strand binding family protein;protein_id=ADH21588.1;transl_table=4
CP002027.1	Genbank	sequence_feature	670576	671655	.	+	.	ID=id699;Note=mmyc392%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	670612	671802	.	+	.	ID=gene556;Name=MMSYN1_0559;gbkey=Gene;locus_tag=MMSYN1_0559
CP002027.1	Genbank	CDS	670612	671802	.	+	0	ID=cds508;Parent=gene556;Dbxref=NCBI_GP:ADH21664.1;Name=ADH21664.1;Note=identified by match to protein family HMM PF06114;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21664.1;transl_table=4
CP002027.1	Genbank	sequence_feature	671576	672655	.	+	.	ID=id700;Note=mmyc393%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	672040	673572	.	+	.	ID=gene557;Name=MMSYN1_0560;gbkey=Gene;locus_tag=MMSYN1_0560
CP002027.1	Genbank	CDS	672040	673572	.	+	0	ID=cds509;Parent=gene557;Dbxref=NCBI_GP:ADH21765.1;Name=ADH21765.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21765.1;transl_table=4
CP002027.1	Genbank	sequence_feature	672576	673655	.	+	.	ID=id701;Note=mmyc394%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	673574	673765	.	+	.	ID=gene558;Name=MMSYN1_0561;gbkey=Gene;locus_tag=MMSYN1_0561
CP002027.1	Genbank	CDS	673574	673765	.	+	0	ID=cds510;Parent=gene558;Dbxref=NCBI_GP:ADH21963.1;Name=ADH21963.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21963.1;transl_table=4
CP002027.1	Genbank	sequence_feature	673576	674655	.	+	.	ID=id702;Note=mmyc395%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	673862	674092	.	+	.	ID=gene559;Name=MMSYN1_0562;gbkey=Gene;locus_tag=MMSYN1_0562
CP002027.1	Genbank	CDS	673862	674092	.	+	0	ID=cds511;Parent=gene559;Dbxref=NCBI_GP:ADH22205.1;Name=ADH22205.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH22205.1;transl_table=4
CP002027.1	Genbank	gene	674120	676843	.	+	.	ID=gene560;Name=MMSYN1_0563;gbkey=Gene;locus_tag=MMSYN1_0563
CP002027.1	Genbank	CDS	674120	676843	.	+	0	ID=cds512;Parent=gene560;Dbxref=NCBI_GP:ADH22103.1;Name=ADH22103.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22103.1;transl_table=4
CP002027.1	Genbank	sequence_feature	674576	675655	.	+	.	ID=id703;Note=mmyc396%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	675576	676655	.	+	.	ID=id704;Note=mmyc397%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	676576	677655	.	+	.	ID=id705;Note=mmyc398%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	676950	677135	.	+	.	ID=gene561;Name=MMSYN1_0564;gbkey=Gene;locus_tag=MMSYN1_0564
CP002027.1	Genbank	CDS	676950	677135	.	+	0	ID=cds513;Parent=gene561;Dbxref=NCBI_GP:ADH21579.1;Name=ADH21579.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21579.1;transl_table=4
CP002027.1	Genbank	gene	677225	677602	.	+	.	ID=gene562;Name=MMSYN1_0565;gbkey=Gene;locus_tag=MMSYN1_0565
CP002027.1	Genbank	CDS	677225	677602	.	+	0	ID=cds514;Parent=gene562;Dbxref=NCBI_GP:ADH21464.1;Name=ADH21464.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21464.1;transl_table=4
CP002027.1	Genbank	sequence_feature	677576	678655	.	+	.	ID=id706;Note=mmyc399f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	677609	679531	.	+	.	ID=gene563;Name=MMSYN1_0566;Note=putative membrane protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0566;pseudo=true
CP002027.1	Genbank	sequence_feature	678576	679655	.	+	.	ID=id707;Note=mmyc400f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	679556	682399	.	+	.	ID=gene564;Name=MMSYN1_0567;gbkey=Gene;locus_tag=MMSYN1_0567
CP002027.1	Genbank	CDS	679556	682399	.	+	0	ID=cds515;Parent=gene564;Dbxref=NCBI_GP:ADH21512.1;Name=ADH21512.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21512.1;transl_table=4
CP002027.1	Genbank	sequence_difference	679610	679610	.	+	.	ID=id708;Note=SNP%3B A (JCVI-syn1) -> G (sMmYCp235-1)%2C Ser (JCVI-syn1) -> Gly (sMmYCp235-1)%2C CDS: hypothetical protein;gbkey=misc_difference;replace=a
CP002027.1	Genbank	sequence_feature	679576	680655	.	+	.	ID=id709;Note=mmyc401%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	680576	681655	.	+	.	ID=id710;Note=mmyc402%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	681576	682655	.	+	.	ID=id711;Note=mmyc403%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	682412	683077	.	+	.	ID=gene565;Name=MMSYN1_0568;gbkey=Gene;locus_tag=MMSYN1_0568
CP002027.1	Genbank	CDS	682412	683077	.	+	0	ID=cds516;Parent=gene565;Dbxref=NCBI_GP:ADH21558.1;Name=ADH21558.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH21558.1;transl_table=4
CP002027.1	Genbank	sequence_feature	682576	683655	.	+	.	ID=id712;Note=mmyc404%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	683124	688091	.	+	.	ID=gene566;Name=MMSYN1_0569;gbkey=Gene;locus_tag=MMSYN1_0569
CP002027.1	Genbank	CDS	683124	688091	.	+	0	ID=cds517;Parent=gene566;Dbxref=NCBI_GP:ADH22091.1;Name=ADH22091.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22091.1;transl_table=4
CP002027.1	Genbank	sequence_feature	683576	684655	.	+	.	ID=id713;Note=mmyc405%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	684576	685655	.	+	.	ID=id714;Note=mmyc406%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	685576	686655	.	+	.	ID=id715;Note=mmyc407%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	686576	687655	.	+	.	ID=id716;Note=mmyc408%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	687576	688655	.	+	.	ID=id717;Note=mmyc409%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	688547	689293	.	+	.	ID=gene567;Name=MMSYN1_0570;gbkey=Gene;locus_tag=MMSYN1_0570
CP002027.1	Genbank	CDS	688547	689293	.	+	0	ID=cds518;Parent=gene567;Dbxref=NCBI_GP:ADH22194.1;Name=ADH22194.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH22194.1;transl_table=4
CP002027.1	Genbank	sequence_feature	688576	689655	.	+	.	ID=id718;Note=mmyc410%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	689489	689854	.	+	.	ID=gene568;Name=MMSYN1_0571;gbkey=Gene;locus_tag=MMSYN1_0571
CP002027.1	Genbank	CDS	689489	689854	.	+	0	ID=cds519;Parent=gene568;Dbxref=NCBI_GP:ADH22022.1;Name=ADH22022.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH22022.1;transl_table=4
CP002027.1	Genbank	sequence_feature	689576	690655	.	+	.	ID=id719;Note=mmyc411%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	690078	690992	.	+	.	ID=gene569;Name=MMSYN1_0572;gbkey=Gene;locus_tag=MMSYN1_0572
CP002027.1	Genbank	CDS	690078	690992	.	+	0	ID=cds520;Parent=gene569;Dbxref=NCBI_GP:ADH21859.1;Name=ADH21859.1;Note=identified by match to protein family HMM PF01656;gbkey=CDS;product=CobQ/CobB/MinD/ParA nucleotide binding domain%2C putative;protein_id=ADH21859.1;transl_table=4
CP002027.1	Genbank	sequence_feature	690576	691655	.	+	.	ID=id720;Note=mmyc412%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	691042	692274	.	+	.	ID=gene570;Name=MMSYN1_0573;gbkey=Gene;locus_tag=MMSYN1_0573
CP002027.1	Genbank	CDS	691042	692274	.	+	0	ID=cds521;Parent=gene570;Dbxref=NCBI_GP:ADH22094.1;Name=ADH22094.1;gbkey=CDS;product=conserved hypothetical integrative conjugal element protein;protein_id=ADH22094.1;transl_table=4
CP002027.1	Genbank	sequence_feature	691576	692655	.	+	.	ID=id721;Note=mmyc413%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	692576	693655	.	+	.	ID=id722;Note=mmyc414%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	692861	695401	.	+	.	ID=gene571;Name=MMSYN1_0574;gbkey=Gene;locus_tag=MMSYN1_0574
CP002027.1	Genbank	CDS	692861	695401	.	+	0	ID=cds522;Parent=gene571;Dbxref=NCBI_GP:ADH22011.1;Name=ADH22011.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22011.1;transl_table=4
CP002027.1	Genbank	sequence_feature	693576	694655	.	+	.	ID=id723;Note=mmyc415%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	694576	695655	.	+	.	ID=id724;Note=mmyc416%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	695457	696836	.	-	.	ID=gene572;Name=atpD_1;gbkey=Gene;gene=atpD_1;locus_tag=MMSYN1_0575
CP002027.1	Genbank	CDS	695457	696836	.	-	0	ID=cds523;Parent=gene572;Dbxref=NCBI_GP:ADH21613.1;Name=ADH21613.1;Note=identified by match to protein family HMM PF00006%3B match to protein family HMM PF00306%3B match to protein family HMM TIGR01039;gbkey=CDS;gene=atpD_1;product=ATP synthase F1%2C beta subunit;protein_id=ADH21613.1;transl_table=4
CP002027.1	Genbank	sequence_feature	695576	696655	.	+	.	ID=id725;Note=mmyc417%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	696576	697655	.	+	.	ID=id726;Note=mmyc418%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	696836	698383	.	-	.	ID=gene573;Name=atpA_1;gbkey=Gene;gene=atpA_1;locus_tag=MMSYN1_0576
CP002027.1	Genbank	CDS	696836	698383	.	-	0	ID=cds524;Parent=gene573;Dbxref=NCBI_GP:ADH21953.1;Name=ADH21953.1;Note=identified by match to protein family HMM PF00006;gbkey=CDS;gene=atpA_1;product=FOF1 ATP synthase%2C alpha subunit;protein_id=ADH21953.1;transl_table=4
CP002027.1	Genbank	sequence_feature	697576	698655	.	+	.	ID=id727;Note=mmyc419%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	698388	700691	.	-	.	ID=gene574;Name=MMSYN1_0577;gbkey=Gene;locus_tag=MMSYN1_0577
CP002027.1	Genbank	CDS	698388	700691	.	-	0	ID=cds525;Parent=gene574;Dbxref=NCBI_GP:ADH21545.1;Name=ADH21545.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21545.1;transl_table=4
CP002027.1	Genbank	sequence_feature	698576	699655	.	+	.	ID=id728;Note=mmyc420%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	699576	700655	.	+	.	ID=id729;Note=mmyc421%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	700576	701655	.	+	.	ID=id730;Note=mmyc422%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	700693	701136	.	-	.	ID=gene575;Name=MMSYN1_0578;gbkey=Gene;locus_tag=MMSYN1_0578
CP002027.1	Genbank	CDS	700693	701136	.	-	0	ID=cds526;Parent=gene575;Dbxref=NCBI_GP:ADH21653.1;Name=ADH21653.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21653.1;transl_table=4
CP002027.1	Genbank	gene	701136	702047	.	-	.	ID=gene576;Name=MMSYN1_0579;gbkey=Gene;locus_tag=MMSYN1_0579
CP002027.1	Genbank	CDS	701136	702047	.	-	0	ID=cds527;Parent=gene576;Dbxref=NCBI_GP:ADH21708.1;Name=ADH21708.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21708.1;transl_table=4
CP002027.1	Genbank	sequence_feature	701576	702655	.	+	.	ID=id731;Note=mmyc423%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	702049	702543	.	-	.	ID=gene577;Name=MMSYN1_0580;gbkey=Gene;locus_tag=MMSYN1_0580
CP002027.1	Genbank	CDS	702049	702543	.	-	0	ID=cds528;Parent=gene577;Dbxref=NCBI_GP:ADH21808.1;Name=ADH21808.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21808.1;transl_table=4
CP002027.1	Genbank	gene	702518	703981	.	-	.	ID=gene578;Name=MMSYN1_0581;gbkey=Gene;locus_tag=MMSYN1_0581
CP002027.1	Genbank	CDS	702518	703981	.	-	0	ID=cds529;Parent=gene578;Dbxref=NCBI_GP:ADH21793.1;Name=ADH21793.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21793.1;transl_table=4
CP002027.1	Genbank	sequence_feature	702576	703655	.	+	.	ID=id732;Note=mmyc424%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	703576	704655	.	+	.	ID=id733;Note=mmyc425%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	704013	706598	.	-	.	ID=gene579;Name=MMSYN1_0582;gbkey=Gene;locus_tag=MMSYN1_0582
CP002027.1	Genbank	CDS	704013	706598	.	-	0	ID=cds530;Parent=gene579;Dbxref=NCBI_GP:ADH21899.1;Name=ADH21899.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21899.1;transl_table=4
CP002027.1	Genbank	sequence_feature	704576	705655	.	+	.	ID=id734;Note=mmyc426%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	705576	706655	.	+	.	ID=id735;Note=mmyc427%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	706576	707655	.	+	.	ID=id736;Note=mmyc428%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	706621	708873	.	-	.	ID=gene580;Name=MMSYN1_0583;gbkey=Gene;locus_tag=MMSYN1_0583
CP002027.1	Genbank	CDS	706621	708873	.	-	0	ID=cds531;Parent=gene580;Dbxref=NCBI_GP:ADH22071.1;Name=ADH22071.1;Note=identified by match to protein family HMM PF09610%3B match to protein family HMM TIGR02184;gbkey=CDS;product=mycoplasma virulence signal region (Myco_arth_vir_N) family;protein_id=ADH22071.1;transl_table=4
CP002027.1	Genbank	sequence_feature	707576	708655	.	+	.	ID=id737;Note=mmyc429%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	708576	709655	.	+	.	ID=id738;Note=mmyc430%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	709145	711715	.	-	.	ID=gene581;Name=MMSYN1_0584;gbkey=Gene;locus_tag=MMSYN1_0584
CP002027.1	Genbank	CDS	709145	711715	.	-	0	ID=cds532;Parent=gene581;Dbxref=NCBI_GP:ADH22069.1;Name=ADH22069.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22069.1;transl_table=4
CP002027.1	Genbank	sequence_feature	709576	710655	.	+	.	ID=id739;Note=mmyc431%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	710576	711655	.	+	.	ID=id740;Note=mmyc432%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	711576	712655	.	+	.	ID=id741;Note=mmyc433%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	711735	713984	.	-	.	ID=gene582;Name=MMSYN1_0585;gbkey=Gene;locus_tag=MMSYN1_0585
CP002027.1	Genbank	CDS	711735	713984	.	-	0	ID=cds533;Parent=gene582;Dbxref=NCBI_GP:ADH22263.1;Name=ADH22263.1;Note=identified by match to protein family HMM PF09610%3B match to protein family HMM TIGR02184;gbkey=CDS;product=mycoplasma virulence signal region (Myco_arth_vir_N) family;protein_id=ADH22263.1;transl_table=4
CP002027.1	Genbank	sequence_feature	712576	713655	.	+	.	ID=id742;Note=mmyc434%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	713576	714655	.	+	.	ID=id743;Note=mmyc435%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	714177	716732	.	-	.	ID=gene583;Name=MMSYN1_0586;gbkey=Gene;locus_tag=MMSYN1_0586
CP002027.1	Genbank	CDS	714177	716732	.	-	0	ID=cds534;Parent=gene583;Dbxref=NCBI_GP:ADH21992.1;Name=ADH21992.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21992.1;transl_table=4
CP002027.1	Genbank	sequence_feature	714576	715655	.	+	.	ID=id744;Note=mmyc436%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	715576	716655	.	+	.	ID=id745;Note=mmyc437%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	716576	717655	.	+	.	ID=id746;Note=mmyc438%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	716747	718999	.	-	.	ID=gene584;Name=MMSYN1_0587;gbkey=Gene;locus_tag=MMSYN1_0587
CP002027.1	Genbank	CDS	716747	718999	.	-	0	ID=cds535;Parent=gene584;Dbxref=NCBI_GP:ADH21658.1;Name=ADH21658.1;Note=identified by match to protein family HMM PF09610%3B match to protein family HMM TIGR02184;gbkey=CDS;product=mycoplasma virulence signal region (Myco_arth_vir_N) family;protein_id=ADH21658.1;transl_table=4
CP002027.1	Genbank	sequence_feature	717576	718655	.	+	.	ID=id747;Note=mmyc439%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	718576	719655	.	+	.	ID=id748;Note=mmyc440%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	719219	721780	.	-	.	ID=gene585;Name=MMSYN1_0588;gbkey=Gene;locus_tag=MMSYN1_0588
CP002027.1	Genbank	CDS	719219	721780	.	-	0	ID=cds536;Parent=gene585;Dbxref=NCBI_GP:ADH21970.1;Name=ADH21970.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21970.1;transl_table=4
CP002027.1	Genbank	sequence_feature	719576	720655	.	+	.	ID=id749;Note=mmyc441%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	720576	721655	.	+	.	ID=id750;Note=mmyc442%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	721576	722655	.	+	.	ID=id751;Note=mmyc443%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	721800	724058	.	-	.	ID=gene586;Name=MMSYN1_0589;gbkey=Gene;locus_tag=MMSYN1_0589
CP002027.1	Genbank	CDS	721800	724058	.	-	0	ID=cds537;Parent=gene586;Dbxref=NCBI_GP:ADH22056.1;Name=ADH22056.1;Note=identified by match to protein family HMM PF09610%3B match to protein family HMM TIGR02184;gbkey=CDS;product=mycoplasma virulence signal region (Myco_arth_vir_N) family;protein_id=ADH22056.1;transl_table=4
CP002027.1	Genbank	sequence_feature	722576	723655	.	+	.	ID=id752;Note=mmyc444%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	723576	724655	.	+	.	ID=id753;Note=mmyc445%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	724576	725655	.	+	.	ID=id754;Note=mmyc446%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	724657	725553	.	-	.	ID=gene587;Name=MMSYN1_0925;gbkey=Gene;locus_tag=MMSYN1_0925
CP002027.1	Genbank	CDS	724657	725553	.	-	0	ID=cds538;Parent=gene587;Dbxref=NCBI_GP:ADH22164.1;Name=ADH22164.1;gbkey=CDS;product=conserved domain protein;protein_id=ADH22164.1;transl_table=4
CP002027.1	Genbank	sequence_feature	725576	726640	.	+	.	ID=id755;Note=mmycWM2b%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	725660	726226	.	-	.	ID=gene588;Name=MMSYN1_0926;gbkey=Gene;locus_tag=MMSYN1_0926
CP002027.1	Genbank	CDS	725660	726226	.	-	0	ID=cds539;Parent=gene588;Dbxref=NCBI_GP:ADH22167.1;Name=ADH22167.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22167.1;transl_table=4
CP002027.1	Genbank	gene	726177	726560	.	+	.	ID=gene589;Name=MMSYN1_0927;gbkey=Gene;locus_tag=MMSYN1_0927
CP002027.1	Genbank	CDS	726177	726560	.	+	0	ID=cds540;Parent=gene589;Dbxref=NCBI_GP:ADH21590.1;Name=ADH21590.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21590.1;transl_table=4
CP002027.1	Genbank	gene	726553	727071	.	-	.	ID=gene590;Name=MMSYN1_0590;gbkey=Gene;locus_tag=MMSYN1_0590
CP002027.1	Genbank	CDS	726553	727071	.	-	0	ID=cds541;Parent=gene590;Dbxref=NCBI_GP:ADH22234.1;Name=ADH22234.1;Note=identified by match to protein family HMM PF04851;gbkey=CDS;product=type III restriction enzyme%2C res subunit;protein_id=ADH22234.1;transl_table=4
CP002027.1	Genbank	sequence_feature	726561	727640	.	+	.	ID=id756;Note=mmyc448%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	727058	728260	.	-	.	ID=gene591;Name=mmyCImod;Note=Type III restriction-modification system (MmyCI) adenine DNA methyltransferase subunit%2C authentic frameshift%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF01555;gbkey=Gene;gene=mmyCImod;locus_tag=MMSYN1_0591;pseudo=true
CP002027.1	Genbank	sequence_feature	727561	728640	.	+	.	ID=id757;Note=mmyc449%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	728561	729640	.	+	.	ID=id758;Note=mmyc450%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	729115	730587	.	-	.	ID=gene592;Name=MMSYN1_0592;gbkey=Gene;locus_tag=MMSYN1_0592
CP002027.1	Genbank	CDS	729115	730587	.	-	0	ID=cds542;Parent=gene592;Dbxref=NCBI_GP:ADH21710.1;Name=ADH21710.1;gbkey=CDS;product=cdsf;protein_id=ADH21710.1;transl_table=4
CP002027.1	Genbank	sequence_feature	729561	730640	.	+	.	ID=id759;Note=mmyc451%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	730561	731640	.	+	.	ID=id760;Note=mmyc452%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	730811	731089	.	-	.	ID=gene593;Name=MMSYN1_0593;gbkey=Gene;locus_tag=MMSYN1_0593
CP002027.1	Genbank	CDS	730811	731089	.	-	0	ID=cds543;Parent=gene593;Dbxref=NCBI_GP:ADH21946.1;Name=ADH21946.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21946.1;transl_table=4
CP002027.1	Genbank	gene	731220	732998	.	-	.	ID=gene594;Name=MMSYN1_0594;gbkey=Gene;locus_tag=MMSYN1_0594
CP002027.1	Genbank	CDS	731220	732998	.	-	0	ID=cds544;Parent=gene594;Dbxref=NCBI_GP:ADH21477.1;Name=ADH21477.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21477.1;transl_table=4
CP002027.1	Genbank	sequence_feature	731561	732640	.	+	.	ID=id761;Note=mmyc453%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	732561	733640	.	+	.	ID=id762;Note=mmyc454%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	733270	734646	.	+	.	ID=gene595;Name=MMSYN1_0595;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0595;pseudo=true
CP002027.1	Genbank	sequence_feature	733561	734640	.	+	.	ID=id763;Note=mmyc455%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	734561	735640	.	+	.	ID=id764;Note=mmyc456%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	735282	737948	.	+	.	ID=gene596;Name=MMSYN1_0596;gbkey=Gene;locus_tag=MMSYN1_0596
CP002027.1	Genbank	CDS	735282	737948	.	+	0	ID=cds545;Parent=gene596;Dbxref=NCBI_GP:ADH22126.1;Name=ADH22126.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22126.1;transl_table=4
CP002027.1	Genbank	sequence_difference	736183	736183	.	+	.	ID=id765;Note=SNP%3B G (JCVI-syn1) -> A (sMmYCp235-1)%2C Gly (JCVI-syn1) -> Glu (sMmYCp235-1)%2C CDS: hypothetical protein;gbkey=misc_difference;replace=g
CP002027.1	Genbank	sequence_feature	735561	736640	.	+	.	ID=id766;Note=mmyc457%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	736561	737640	.	+	.	ID=id767;Note=mmyc458%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	737561	738640	.	+	.	ID=id768;Note=mmyc459%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	738368	738793	.	+	.	ID=gene597;Name=MMSYN1_0597;Note=Fic family protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF02661;gbkey=Gene;locus_tag=MMSYN1_0597;pseudo=true
CP002027.1	Genbank	sequence_feature	738561	739640	.	+	.	ID=id769;Note=mmyc460%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	739136	740662	.	+	.	ID=gene598;Name=MMSYN1_0598;gbkey=Gene;locus_tag=MMSYN1_0598
CP002027.1	Genbank	CDS	739136	740662	.	+	0	ID=cds546;Parent=gene598;Dbxref=NCBI_GP:ADH22266.1;Name=ADH22266.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22266.1;transl_table=4
CP002027.1	Genbank	sequence_feature	739561	740640	.	+	.	ID=id770;Note=mmyc461%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	740561	741640	.	+	.	ID=id771;Note=mmyc462%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	740801	740941	.	-	.	ID=gene599;Name=MMSYN1_0599;gbkey=Gene;locus_tag=MMSYN1_0599
CP002027.1	Genbank	CDS	740801	740941	.	-	0	ID=cds547;Parent=gene599;Dbxref=NCBI_GP:ADH21933.1;Name=ADH21933.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21933.1;transl_table=4
CP002027.1	Genbank	sequence_feature	741561	742640	.	+	.	ID=id772;Note=mmyc463%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	741755	743587	.	+	.	ID=gene600;Name=MMSYN1_0600;gbkey=Gene;locus_tag=MMSYN1_0600
CP002027.1	Genbank	CDS	741755	743587	.	+	0	ID=cds548;Parent=gene600;Dbxref=NCBI_GP:ADH21699.1;Name=ADH21699.1;Note=identified by match to protein family HMM PF00753%3B match to protein family HMM PF07521;gbkey=CDS;product=RNA-metabolising metallo-beta-lactamase family;protein_id=ADH21699.1;transl_table=4
CP002027.1	Genbank	sequence_feature	742561	743640	.	+	.	ID=id773;Note=mmyc464%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	743561	744640	.	+	.	ID=id774;Note=mmyc465%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	743662	744606	.	+	.	ID=gene601;Name=MMSYN1_0601;gbkey=Gene;locus_tag=MMSYN1_0601
CP002027.1	Genbank	CDS	743662	744606	.	+	0	ID=cds549;Parent=gene601;Dbxref=NCBI_GP:ADH21795.1;Name=ADH21795.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21795.1;transl_table=4
CP002027.1	Genbank	sequence_feature	744561	745640	.	+	.	ID=id775;Note=mmyc466%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	744738	746000	.	+	.	ID=gene602;Name=MMSYN1_0602;Note=conserved hypothetical protein%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0602;pseudo=true
CP002027.1	Genbank	sequence_feature	745561	746640	.	+	.	ID=id776;Note=mmyc467%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	746503	747171	.	+	.	ID=gene603;Name=MMSYN1_0604;gbkey=Gene;locus_tag=MMSYN1_0604
CP002027.1	Genbank	CDS	746503	747171	.	+	0	ID=cds550;Parent=gene603;Dbxref=NCBI_GP:ADH21698.1;Name=ADH21698.1;Note=identified by match to protein family HMM PF04011;gbkey=CDS;product=LemA family;protein_id=ADH21698.1;transl_table=4
CP002027.1	Genbank	sequence_feature	746561	747640	.	+	.	ID=id777;Note=mmyc468%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	746854	746941	.	+	.	ID=gene604;Name=MMSYN1_0603;gbkey=Gene;locus_tag=MMSYN1_0603
CP002027.1	Genbank	ncRNA	746854	746941	.	+	.	ID=rna22;Parent=gene604;Note=Small nucleolar RNA snR69%3B Rfam score 29.14;gbkey=ncRNA;inference=nucleotide motif:RFAM:RF00475;product=Small nucleolar RNA snR69
CP002027.1	Genbank	exon	746854	746941	.	+	.	ID=id778;Parent=rna22;Note=Small nucleolar RNA snR69%3B Rfam score 29.14;gbkey=ncRNA;inference=nucleotide motif:RFAM:RF00475;product=Small nucleolar RNA snR69
CP002027.1	Genbank	gene	747354	747662	.	+	.	ID=gene605;Name=MMSYN1_0605;gbkey=Gene;locus_tag=MMSYN1_0605
CP002027.1	Genbank	CDS	747354	747662	.	+	0	ID=cds551;Parent=gene605;Dbxref=NCBI_GP:ADH21540.1;Name=ADH21540.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21540.1;transl_table=4
CP002027.1	Genbank	sequence_feature	747561	748640	.	+	.	ID=id779;Note=mmyc469%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	747929	749143	.	-	.	ID=gene606;Name=pgk;gbkey=Gene;gene=pgk;locus_tag=MMSYN1_0606
CP002027.1	Genbank	CDS	747929	749143	.	-	0	ID=cds552;Parent=gene606;Dbxref=NCBI_GP:ADH21754.1;Name=ADH21754.1;Note=identified by match to protein family HMM PF00162;gbkey=CDS;gene=pgk;product=phosphoglycerate kinase;protein_id=ADH21754.1;transl_table=4
CP002027.1	Genbank	sequence_feature	748561	749640	.	+	.	ID=id780;Note=mmyc470%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	749255	750271	.	-	.	ID=gene607;Name=gap;gbkey=Gene;gene=gap;locus_tag=MMSYN1_0607
CP002027.1	Genbank	CDS	749255	750271	.	-	0	ID=cds553;Parent=gene607;Dbxref=NCBI_GP:ADH21858.1;Name=ADH21858.1;Note=identified by match to protein family HMM PF00044%3B match to protein family HMM PF02800%3B match to protein family HMM TIGR01534;gbkey=CDS;gene=gap;product=glyceraldehyde-3-phosphate dehydrogenase%2C type I;protein_id=ADH21858.1;transl_table=4
CP002027.1	Genbank	sequence_feature	749561	750640	.	+	.	ID=id781;Note=mmyc471%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	750372	751310	.	-	.	ID=gene608;Name=MMSYN1_0608;gbkey=Gene;locus_tag=MMSYN1_0608
CP002027.1	Genbank	CDS	750372	751310	.	-	0	ID=cds554;Parent=gene608;Dbxref=NCBI_GP:ADH21903.1;Name=ADH21903.1;gbkey=CDS;product=primosomal protein;protein_id=ADH21903.1;transl_table=4
CP002027.1	Genbank	sequence_feature	750561	751640	.	+	.	ID=id782;Note=mmyc472%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	751320	752504	.	-	.	ID=gene609;Name=MMSYN1_0609;gbkey=Gene;locus_tag=MMSYN1_0609
CP002027.1	Genbank	CDS	751320	752504	.	-	0	ID=cds555;Parent=gene609;Dbxref=NCBI_GP:ADH21753.1;Name=ADH21753.1;Note=identified by match to protein family HMM PF07261;gbkey=CDS;product=chromosome replication initiation/membrane attachment protein;protein_id=ADH21753.1;transl_table=4
CP002027.1	Genbank	sequence_feature	751561	752640	.	+	.	ID=id783;Note=mmyc473%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	752561	753640	.	+	.	ID=id784;Note=mmyc474%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	752661	753485	.	-	.	ID=gene610;Name=mutM;gbkey=Gene;gene=mutM;locus_tag=MMSYN1_0610
CP002027.1	Genbank	CDS	752661	753485	.	-	0	ID=cds556;Parent=gene610;Dbxref=NCBI_GP:ADH22099.1;Name=ADH22099.1;Note=identified by match to protein family HMM PF01149%3B match to protein family HMM PF06831%3B match to protein family HMM TIGR00577;gbkey=CDS;gene=mutM;product=DNA-formamidopyrimidine glycosylase;protein_id=ADH22099.1;transl_table=4
CP002027.1	Genbank	gene	753496	756231	.	-	.	ID=gene611;Name=polA;gbkey=Gene;gene=polA;locus_tag=MMSYN1_0611
CP002027.1	Genbank	CDS	753496	756231	.	-	0	ID=cds557;Parent=gene611;Dbxref=NCBI_GP:ADH22206.1;Name=ADH22206.1;Note=identified by match to protein family HMM PF00476%3B match to protein family HMM PF01367%3B match to protein family HMM PF02739%3B match to protein family HMM TIGR00593;gbkey=CDS;gene=polA;product=DNA polymerase I superfamily;protein_id=ADH22206.1;transl_table=4
CP002027.1	Genbank	sequence_feature	753561	754640	.	+	.	ID=id785;Note=mmyc475%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	754561	755640	.	+	.	ID=id786;Note=mmyc476%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	755561	756640	.	+	.	ID=id787;Note=mmyc477%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	756240	759203	.	-	.	ID=gene612;Name=MMSYN1_0612;gbkey=Gene;locus_tag=MMSYN1_0612
CP002027.1	Genbank	CDS	756240	759203	.	-	0	ID=cds558;Parent=gene612;Dbxref=NCBI_GP:ADH22084.1;Name=ADH22084.1;Note=identified by match to protein family HMM PF01336%3B match to protein family HMM PF07733%3B match to protein family HMM TIGR00594;gbkey=CDS;product=DNA polymerase III%2C alpha subunit subfamily%2C putative;protein_id=ADH22084.1;transl_table=4
CP002027.1	Genbank	sequence_feature	756561	757640	.	+	.	ID=id788;Note=mmyc478%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	757561	758640	.	+	.	ID=id789;Note=mmyc479%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	758561	759640	.	+	.	ID=id790;Note=mmyc480%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	759398	760642	.	-	.	ID=gene613;Name=tyrS;gbkey=Gene;gene=tyrS;locus_tag=MMSYN1_0613
CP002027.1	Genbank	CDS	759398	760642	.	-	0	ID=cds559;Parent=gene613;Dbxref=NCBI_GP:ADH21499.1;Name=ADH21499.1;Note=identified by match to protein family HMM PF00579%3B match to protein family HMM PF01479%3B match to protein family HMM TIGR00234;gbkey=CDS;gene=tyrS;product=tyrosine--tRNA ligase;protein_id=ADH21499.1;transl_table=4
CP002027.1	Genbank	sequence_feature	759561	760640	.	+	.	ID=id791;Note=mmyc481%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	760561	761640	.	+	.	ID=id792;Note=mmyc482%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	760651	761712	.	-	.	ID=gene614;Name=MMSYN1_0614;gbkey=Gene;locus_tag=MMSYN1_0614
CP002027.1	Genbank	CDS	760651	761712	.	-	0	ID=cds560;Parent=gene614;Dbxref=NCBI_GP:ADH22149.1;Name=ADH22149.1;gbkey=CDS;product=nicotinate phosphoribosyltransferase;protein_id=ADH22149.1;transl_table=4
CP002027.1	Genbank	sequence_feature	761561	762640	.	+	.	ID=id793;Note=mmyc483%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	761690	762298	.	-	.	ID=gene615;Name=MMSYN1_0615;gbkey=Gene;locus_tag=MMSYN1_0615
CP002027.1	Genbank	CDS	761690	762298	.	-	0	ID=cds561;Parent=gene615;Dbxref=NCBI_GP:ADH21952.1;Name=ADH21952.1;Note=identified by match to protein family HMM PF01588;gbkey=CDS;product=phenylalanine-tRNA ligase;protein_id=ADH21952.1;transl_table=4
CP002027.1	Genbank	gene	762373	763212	.	+	.	ID=gene616;Name=MMSYN1_0616;gbkey=Gene;locus_tag=MMSYN1_0616
CP002027.1	Genbank	CDS	762373	763212	.	+	0	ID=cds562;Parent=gene616;Dbxref=NCBI_GP:ADH21818.1;Name=ADH21818.1;Note=identified by match to protein family HMM PF02645%3B match to protein family HMM TIGR00762;gbkey=CDS;product=EDD domain protein%2C DegV family%2C putative;protein_id=ADH21818.1;transl_table=4
CP002027.1	Genbank	sequence_feature	762561	763640	.	+	.	ID=id794;Note=mmyc484%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	763223	764074	.	+	.	ID=gene617;Name=MMSYN1_0617;gbkey=Gene;locus_tag=MMSYN1_0617
CP002027.1	Genbank	CDS	763223	764074	.	+	0	ID=cds563;Parent=gene617;Dbxref=NCBI_GP:ADH22030.1;Name=ADH22030.1;Note=identified by match to protein family HMM PF02645%3B match to protein family HMM TIGR00762;gbkey=CDS;product=DegV family protein;protein_id=ADH22030.1;transl_table=4
CP002027.1	Genbank	sequence_feature	763561	764640	.	+	.	ID=id795;Note=mmyc485%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	764110	764184	.	-	.	ID=gene618;Name=MMSYN1_0618;gbkey=Gene;locus_tag=MMSYN1_0618
CP002027.1	Genbank	tRNA	764110	764184	.	-	.	ID=rna23;Parent=gene618;gbkey=tRNA;product=tRNA-Trp
CP002027.1	Genbank	exon	764110	764184	.	-	.	ID=id796;Parent=rna23;gbkey=tRNA;product=tRNA-Trp
CP002027.1	Genbank	gene	764222	764297	.	-	.	ID=gene619;Name=MMSYN1_0619;gbkey=Gene;locus_tag=MMSYN1_0619
CP002027.1	Genbank	tRNA	764222	764297	.	-	.	ID=rna24;Parent=gene619;gbkey=tRNA;product=tRNA-Sec
CP002027.1	Genbank	exon	764222	764297	.	-	.	ID=id797;Parent=rna24;gbkey=tRNA;product=tRNA-Sec
CP002027.1	Genbank	gene	764373	764837	.	-	.	ID=gene620;Name=MMSYN1_0620;gbkey=Gene;locus_tag=MMSYN1_0620
CP002027.1	Genbank	CDS	764373	764837	.	-	0	ID=cds564;Parent=gene620;Dbxref=NCBI_GP:ADH22163.1;Name=ADH22163.1;Note=identified by match to protein family HMM PF01475;gbkey=CDS;product=ferric uptake regulator;protein_id=ADH22163.1;transl_table=4
CP002027.1	Genbank	sequence_feature	764561	765640	.	+	.	ID=id798;Note=mmyc486%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	764838	765059	.	-	.	ID=gene621;Name=MMSYN1_0621;gbkey=Gene;locus_tag=MMSYN1_0621
CP002027.1	Genbank	CDS	764838	765059	.	-	0	ID=cds565;Parent=gene621;Dbxref=NCBI_GP:ADH21567.1;Name=ADH21567.1;Note=identified by match to protein family HMM PF00550;gbkey=CDS;product=conserved domain protein;protein_id=ADH21567.1;transl_table=4
CP002027.1	Genbank	gene	765083	765445	.	-	.	ID=gene622;Name=MMSYN1_0622;gbkey=Gene;locus_tag=MMSYN1_0622
CP002027.1	Genbank	CDS	765083	765445	.	-	0	ID=cds566;Parent=gene622;Dbxref=NCBI_GP:ADH21627.1;Name=ADH21627.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21627.1;transl_table=4
CP002027.1	Genbank	gene	765432	766502	.	-	.	ID=gene623;Name=MMSYN1_0623;gbkey=Gene;locus_tag=MMSYN1_0623
CP002027.1	Genbank	CDS	765432	766502	.	-	0	ID=cds567;Parent=gene623;Dbxref=NCBI_GP:ADH22128.1;Name=ADH22128.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22128.1;transl_table=4
CP002027.1	Genbank	sequence_feature	765561	766640	.	+	.	ID=id799;Note=mmyc487%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	766561	767640	.	+	.	ID=id800;Note=mmyc488%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	766603	766678	.	-	.	ID=gene624;Name=MMSYN1_0624;gbkey=Gene;locus_tag=MMSYN1_0624
CP002027.1	Genbank	tRNA	766603	766678	.	-	.	ID=rna25;Parent=gene624;gbkey=tRNA;product=tRNA-His
CP002027.1	Genbank	exon	766603	766678	.	-	.	ID=id801;Parent=rna25;gbkey=tRNA;product=tRNA-His
CP002027.1	Genbank	gene	766799	767731	.	-	.	ID=gene625;Name=arcC_1;gbkey=Gene;gene=arcC_1;locus_tag=MMSYN1_0625
CP002027.1	Genbank	CDS	766799	767731	.	-	0	ID=cds568;Parent=gene625;Dbxref=NCBI_GP:ADH22238.1;Name=ADH22238.1;Note=identified by match to protein family HMM PF00696;gbkey=CDS;gene=arcC_1;product=carbamate kinase 1;protein_id=ADH22238.1;transl_table=4
CP002027.1	Genbank	sequence_feature	767561	768640	.	+	.	ID=id802;Note=mmyc489%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	767848	768942	.	-	.	ID=gene626;Name=aguA;gbkey=Gene;gene=aguA;locus_tag=MMSYN1_0626
CP002027.1	Genbank	CDS	767848	768942	.	-	0	ID=cds569;Parent=gene626;Dbxref=NCBI_GP:ADH21706.1;Name=ADH21706.1;Note=identified by match to protein family HMM PF04371%3B match to protein family HMM TIGR03380;gbkey=CDS;gene=aguA;product=agmatine deiminase;protein_id=ADH21706.1;transl_table=4
CP002027.1	Genbank	sequence_feature	768561	769640	.	+	.	ID=id803;Note=mmyc490%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	768949	770367	.	-	.	ID=gene627;Name=MMSYN1_0627;Note=amino acid permease family protein%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF00324;gbkey=Gene;locus_tag=MMSYN1_0627;pseudo=true
CP002027.1	Genbank	sequence_feature	769561	770640	.	+	.	ID=id804;Note=mmyc491%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	770394	771491	.	-	.	ID=gene628;Name=argF;gbkey=Gene;gene=argF;locus_tag=MMSYN1_0628
CP002027.1	Genbank	CDS	770394	771491	.	-	0	ID=cds570;Parent=gene628;Dbxref=NCBI_GP:ADH21468.1;Name=ADH21468.1;Note=identified by match to protein family HMM PF00185%3B match to protein family HMM PF02729%3B match to protein family HMM TIGR00658;gbkey=CDS;gene=argF;product=ornithine carbamoyltransferase;protein_id=ADH21468.1;transl_table=4
CP002027.1	Genbank	sequence_feature	770561	771640	.	+	.	ID=id805;Note=mmyc492%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	771561	772640	.	+	.	ID=id806;Note=mmyc493%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	771786	772163	.	-	.	ID=gene629;Name=MMSYN1_0629;gbkey=Gene;locus_tag=MMSYN1_0629
CP002027.1	Genbank	CDS	771786	772163	.	-	0	ID=cds571;Parent=gene629;Dbxref=NCBI_GP:ADH21557.1;Name=ADH21557.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21557.1;transl_table=4
CP002027.1	Genbank	gene	772384	773271	.	+	.	ID=gene630;Name=MMSYN1_0630;gbkey=Gene;locus_tag=MMSYN1_0630
CP002027.1	Genbank	CDS	772384	773271	.	+	0	ID=cds572;Parent=gene630;Dbxref=NCBI_GP:ADH21684.1;Name=ADH21684.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=ABC transporter%2C ATP-binding component;protein_id=ADH21684.1;transl_table=4
CP002027.1	Genbank	sequence_feature	772561	773640	.	+	.	ID=id807;Note=mmyc494%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	773273	774037	.	+	.	ID=gene631;Name=MMSYN1_0631;Note=ABC transporter%2C permease protein %2C putative%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0631;pseudo=true
CP002027.1	Genbank	sequence_feature	773561	774640	.	+	.	ID=id808;Note=mmyc495%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	774071	774547	.	-	.	ID=gene632;Name=MMSYN1_0632;gbkey=Gene;locus_tag=MMSYN1_0632
CP002027.1	Genbank	CDS	774071	774547	.	-	0	ID=cds573;Parent=gene632;Dbxref=NCBI_GP:ADH22021.1;Name=ADH22021.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22021.1;transl_table=4
CP002027.1	Genbank	sequence_feature	774561	775640	.	+	.	ID=id809;Note=mmyc496%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	774638	776197	.	-	.	ID=gene633;Name=MMSYN1_0633;gbkey=Gene;locus_tag=MMSYN1_0633
CP002027.1	Genbank	CDS	774638	776197	.	-	0	ID=cds574;Parent=gene633;Dbxref=NCBI_GP:ADH22114.1;Name=ADH22114.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22114.1;transl_table=4
CP002027.1	Genbank	sequence_feature	775561	776640	.	+	.	ID=id810;Note=mmyc497%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	776264	778678	.	-	.	ID=gene634;Name=leuS;gbkey=Gene;gene=leuS;locus_tag=MMSYN1_0634
CP002027.1	Genbank	CDS	776264	778678	.	-	0	ID=cds575;Parent=gene634;Dbxref=NCBI_GP:ADH21504.1;Name=ADH21504.1;Note=identified by match to protein family HMM PF00133%3B match to protein family HMM PF08264%3B match to protein family HMM PF09334%3B match to protein family HMM TIGR00396;gbkey=CDS;gene=leuS;product=leucine--tRNA ligase;protein_id=ADH21504.1;transl_table=4
CP002027.1	Genbank	sequence_feature	776561	777640	.	+	.	ID=id811;Note=mmyc498%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	777561	778640	.	+	.	ID=id812;Note=mmyc499%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	778561	779640	.	+	.	ID=id813;Note=mmyc500%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	778816	778892	.	-	.	ID=gene635;Name=MMSYN1_0635;gbkey=Gene;locus_tag=MMSYN1_0635
CP002027.1	Genbank	tRNA	778816	778892	.	-	.	ID=rna26;Parent=gene635;gbkey=tRNA;product=tRNA-Ile
CP002027.1	Genbank	exon	778816	778892	.	-	.	ID=id814;Parent=rna26;gbkey=tRNA;product=tRNA-Ile
CP002027.1	Genbank	gene	778965	781754	.	-	.	ID=gene636;Name=MMSYN1_0636;gbkey=Gene;locus_tag=MMSYN1_0636
CP002027.1	Genbank	CDS	778965	781754	.	-	0	ID=cds576;Parent=gene636;Dbxref=NCBI_GP:ADH21651.1;Name=ADH21651.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21651.1;transl_table=4
CP002027.1	Genbank	sequence_feature	779561	780640	.	+	.	ID=id815;Note=mmyc501%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	780561	781640	.	+	.	ID=id816;Note=mmyc502%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	781561	782640	.	+	.	ID=id817;Note=mmyc503%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	781913	782311	.	-	.	ID=gene637;Name=rpsI;gbkey=Gene;gene=rpsI;locus_tag=MMSYN1_0637
CP002027.1	Genbank	CDS	781913	782311	.	-	0	ID=cds577;Parent=gene637;Dbxref=NCBI_GP:ADH22185.1;Name=ADH22185.1;Note=identified by match to protein family HMM PF00380;gbkey=CDS;gene=rpsI;product=ribosomal protein S9;protein_id=ADH22185.1;transl_table=4
CP002027.1	Genbank	gene	782311	782766	.	-	.	ID=gene638;Name=rplM;gbkey=Gene;gene=rplM;locus_tag=MMSYN1_0638
CP002027.1	Genbank	CDS	782311	782766	.	-	0	ID=cds578;Parent=gene638;Dbxref=NCBI_GP:ADH22080.1;Name=ADH22080.1;Note=identified by match to protein family HMM PF00572%3B match to protein family HMM TIGR01066;gbkey=CDS;gene=rplM;product=ribosomal protein L13;protein_id=ADH22080.1;transl_table=4
CP002027.1	Genbank	sequence_feature	782561	783640	.	+	.	ID=id818;Note=mmyc504%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	782896	787041	.	-	.	ID=gene639;Name=MMSYN1_0639;gbkey=Gene;locus_tag=MMSYN1_0639
CP002027.1	Genbank	CDS	782896	787041	.	-	0	ID=cds579;Parent=gene639;Dbxref=NCBI_GP:ADH22277.1;Name=ADH22277.1;Note=identified by match to protein family HMM PF02687;gbkey=CDS;product=efflux ABC transporter%2C permease protein;protein_id=ADH22277.1;transl_table=4
CP002027.1	Genbank	sequence_feature	783561	784640	.	+	.	ID=id819;Note=mmyc505%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	784561	785640	.	+	.	ID=id820;Note=mmyc506%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	785561	786640	.	+	.	ID=id821;Note=mmyc507%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	786561	787640	.	+	.	ID=id822;Note=mmyc508%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	787136	787891	.	-	.	ID=gene640;Name=MMSYN1_0640;gbkey=Gene;locus_tag=MMSYN1_0640
CP002027.1	Genbank	CDS	787136	787891	.	-	0	ID=cds580;Parent=gene640;Dbxref=NCBI_GP:ADH21995.1;Name=ADH21995.1;Note=identified by match to protein family HMM PF01416;gbkey=CDS;product=tRNA pseudouridine synthase A (tRNA-uridine isomeraseI) (tRNA pseudouridylate synthase I);protein_id=ADH21995.1;transl_table=4
CP002027.1	Genbank	sequence_feature	787561	788640	.	+	.	ID=id823;Note=mmyc509%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	787894	788904	.	-	.	ID=gene641;Name=MMSYN1_0641;gbkey=Gene;locus_tag=MMSYN1_0641
CP002027.1	Genbank	CDS	787894	788904	.	-	0	ID=cds581;Parent=gene641;Dbxref=NCBI_GP:ADH21907.1;Name=ADH21907.1;Note=identified by match to protein family HMM PF02361;gbkey=CDS;product=ABC transporter%2C permease component;protein_id=ADH21907.1;transl_table=4
CP002027.1	Genbank	sequence_feature	788561	789640	.	+	.	ID=id824;Note=mmyc510%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	788918	789829	.	-	.	ID=gene642;Name=MMSYN1_0642;gbkey=Gene;locus_tag=MMSYN1_0642
CP002027.1	Genbank	CDS	788918	789829	.	-	0	ID=cds582;Parent=gene642;Dbxref=NCBI_GP:ADH21769.1;Name=ADH21769.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=cobalt import ATP-binding protein CbiO 1;protein_id=ADH21769.1;transl_table=4
CP002027.1	Genbank	sequence_feature	789561	790640	.	+	.	ID=id825;Note=mmyc511%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	789817	791043	.	-	.	ID=gene643;Name=MMSYN1_0643;gbkey=Gene;locus_tag=MMSYN1_0643
CP002027.1	Genbank	CDS	789817	791043	.	-	0	ID=cds583;Parent=gene643;Dbxref=NCBI_GP:ADH21506.1;Name=ADH21506.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=cobalt import ATP-binding protein CbiO 2;protein_id=ADH21506.1;transl_table=4
CP002027.1	Genbank	sequence_feature	790561	791640	.	+	.	ID=id826;Note=mmyc512%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	791151	791510	.	-	.	ID=gene644;Name=rplQ;gbkey=Gene;gene=rplQ;locus_tag=MMSYN1_0644
CP002027.1	Genbank	CDS	791151	791510	.	-	0	ID=cds584;Parent=gene644;Dbxref=NCBI_GP:ADH21633.1;Name=ADH21633.1;Note=identified by match to protein family HMM PF01196%3B match to protein family HMM TIGR00059;gbkey=CDS;gene=rplQ;product=ribosomal protein L17;protein_id=ADH21633.1;transl_table=4
CP002027.1	Genbank	gene	791530	792483	.	-	.	ID=gene645;Name=rpoA;gbkey=Gene;gene=rpoA;locus_tag=MMSYN1_0645
CP002027.1	Genbank	CDS	791530	792483	.	-	0	ID=cds585;Parent=gene645;Dbxref=NCBI_GP:ADH22088.1;Name=ADH22088.1;Note=identified by match to protein family HMM PF01000%3B match to protein family HMM PF01193%3B match to protein family HMM PF03118%3B match to protein family HMM TIGR02027;gbkey=CDS;gene=rpoA;product=DNA-directed RNA polymerase%2C alpha subunit;protein_id=ADH22088.1;transl_table=4
CP002027.1	Genbank	sequence_feature	791561	792640	.	+	.	ID=id827;Note=mmyc513%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	792487	792876	.	-	.	ID=gene646;Name=rpsK;gbkey=Gene;gene=rpsK;locus_tag=MMSYN1_0646
CP002027.1	Genbank	CDS	792487	792876	.	-	0	ID=cds586;Parent=gene646;Dbxref=NCBI_GP:ADH22279.1;Name=ADH22279.1;Note=identified by match to protein family HMM PF00411%3B match to protein family HMM TIGR03632;gbkey=CDS;gene=rpsK;product=30S ribosomal protein S11;protein_id=ADH22279.1;transl_table=4
CP002027.1	Genbank	sequence_feature	792561	793640	.	+	.	ID=id828;Note=mmyc514%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	792902	793267	.	-	.	ID=gene647;Name=rpsM;gbkey=Gene;gene=rpsM;locus_tag=MMSYN1_0647
CP002027.1	Genbank	CDS	792902	793267	.	-	0	ID=cds587;Parent=gene647;Dbxref=NCBI_GP:ADH22093.1;Name=ADH22093.1;Note=identified by match to protein family HMM PF00416%3B match to protein family HMM TIGR03631;gbkey=CDS;gene=rpsM;product=30S ribosomal protein S13;protein_id=ADH22093.1;transl_table=4
CP002027.1	Genbank	gene	793304	793417	.	-	.	ID=gene648;Name=rpmJ;gbkey=Gene;gene=rpmJ;locus_tag=MMSYN1_0648
CP002027.1	Genbank	CDS	793304	793417	.	-	0	ID=cds588;Parent=gene648;Dbxref=NCBI_GP:ADH22010.1;Name=ADH22010.1;Note=identified by match to protein family HMM PF00444%3B match to protein family HMM TIGR01022;gbkey=CDS;gene=rpmJ;product=ribosomal protein L36;protein_id=ADH22010.1;transl_table=4
CP002027.1	Genbank	gene	793486	793710	.	-	.	ID=gene649;Name=infA;gbkey=Gene;gene=infA;locus_tag=MMSYN1_0649
CP002027.1	Genbank	CDS	793486	793710	.	-	0	ID=cds589;Parent=gene649;Dbxref=NCBI_GP:ADH21535.1;Name=ADH21535.1;Note=identified by match to protein family HMM PF00575%3B match to protein family HMM PF01176%3B match to protein family HMM TIGR00008;gbkey=CDS;gene=infA;product=translation initiation factor IF-1;protein_id=ADH21535.1;transl_table=4
CP002027.1	Genbank	sequence_feature	793561	794640	.	+	.	ID=id829;Note=mmyc515%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	793722	794477	.	-	.	ID=gene650;Name=map;gbkey=Gene;gene=map;locus_tag=MMSYN1_0650
CP002027.1	Genbank	CDS	793722	794477	.	-	0	ID=cds590;Parent=gene650;Dbxref=NCBI_GP:ADH21851.1;Name=ADH21851.1;Note=identified by match to protein family HMM PF00557%3B match to protein family HMM TIGR00500;gbkey=CDS;gene=map;product=methionine aminopeptidase%2C type I;protein_id=ADH21851.1;transl_table=4
CP002027.1	Genbank	gene	794477	795118	.	-	.	ID=gene651;Name=adk;gbkey=Gene;gene=adk;locus_tag=MMSYN1_0651
CP002027.1	Genbank	CDS	794477	795118	.	-	0	ID=cds591;Parent=gene651;Dbxref=NCBI_GP:ADH21786.1;Name=ADH21786.1;Note=identified by match to protein family HMM PF00406%3B match to protein family HMM PF05191%3B match to protein family HMM TIGR01351;gbkey=CDS;gene=adk;product=adenylate kinase;protein_id=ADH21786.1;transl_table=4
CP002027.1	Genbank	sequence_feature	794561	795640	.	+	.	ID=id830;Note=mmyc516%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	795246	796694	.	-	.	ID=gene652;Name=secY;gbkey=Gene;gene=secY;locus_tag=MMSYN1_0652
CP002027.1	Genbank	CDS	795246	796694	.	-	0	ID=cds592;Parent=gene652;Dbxref=NCBI_GP:ADH21498.1;Name=ADH21498.1;Note=identified by match to protein family HMM PF00344%3B match to protein family HMM TIGR00967;gbkey=CDS;gene=secY;product=preprotein translocase%2C SecY subunit;protein_id=ADH21498.1;transl_table=4
CP002027.1	Genbank	sequence_feature	795561	796640	.	+	.	ID=id831;Note=mmyc517%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	796561	797640	.	+	.	ID=id832;Note=mmyc518%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	796694	797131	.	-	.	ID=gene653;Name=rplO;gbkey=Gene;gene=rplO;locus_tag=MMSYN1_0653
CP002027.1	Genbank	CDS	796694	797131	.	-	0	ID=cds593;Parent=gene653;Dbxref=NCBI_GP:ADH22053.1;Name=ADH22053.1;Note=identified by match to protein family HMM PF00256%3B match to protein family HMM PF01305%3B match to protein family HMM TIGR01071;gbkey=CDS;gene=rplO;product=ribosomal protein L15;protein_id=ADH22053.1;transl_table=4
CP002027.1	Genbank	gene	797150	797914	.	-	.	ID=gene654;Name=rpsE;gbkey=Gene;gene=rpsE;locus_tag=MMSYN1_0654
CP002027.1	Genbank	CDS	797150	797914	.	-	0	ID=cds594;Parent=gene654;Dbxref=NCBI_GP:ADH21747.1;Name=ADH21747.1;Note=identified by match to protein family HMM PF00333%3B match to protein family HMM PF03719%3B match to protein family HMM TIGR01021;gbkey=CDS;gene=rpsE;product=30S ribosomal protein S5;protein_id=ADH21747.1;transl_table=4
CP002027.1	Genbank	sequence_feature	797561	798640	.	+	.	ID=id833;Note=mmyc519%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	797933	798283	.	-	.	ID=gene655;Name=rplR;gbkey=Gene;gene=rplR;locus_tag=MMSYN1_0655
CP002027.1	Genbank	CDS	797933	798283	.	-	0	ID=cds595;Parent=gene655;Dbxref=NCBI_GP:ADH21878.1;Name=ADH21878.1;Note=identified by match to protein family HMM PF00861%3B match to protein family HMM TIGR00060;gbkey=CDS;gene=rplR;product=ribosomal protein L18;protein_id=ADH21878.1;transl_table=4
CP002027.1	Genbank	gene	798309	798851	.	-	.	ID=gene656;Name=rplF;gbkey=Gene;gene=rplF;locus_tag=MMSYN1_0656
CP002027.1	Genbank	CDS	798309	798851	.	-	0	ID=cds596;Parent=gene656;Dbxref=NCBI_GP:ADH22162.1;Name=ADH22162.1;Note=identified by match to protein family HMM PF00347%3B match to protein family HMM TIGR03654;gbkey=CDS;gene=rplF;product=ribosomal protein L6;protein_id=ADH22162.1;transl_table=4
CP002027.1	Genbank	sequence_feature	798561	799640	.	+	.	ID=id834;Note=mmyc520%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	798865	799254	.	-	.	ID=gene657;Name=rpsH;gbkey=Gene;gene=rpsH;locus_tag=MMSYN1_0657
CP002027.1	Genbank	CDS	798865	799254	.	-	0	ID=cds597;Parent=gene657;Dbxref=NCBI_GP:ADH22210.1;Name=ADH22210.1;Note=identified by match to protein family HMM PF00410;gbkey=CDS;gene=rpsH;product=ribosomal protein S8;protein_id=ADH22210.1;transl_table=4
CP002027.1	Genbank	gene	799274	799459	.	-	.	ID=gene658;Name=rpsN;gbkey=Gene;gene=rpsN;locus_tag=MMSYN1_0658
CP002027.1	Genbank	CDS	799274	799459	.	-	0	ID=cds598;Parent=gene658;Dbxref=NCBI_GP:ADH21467.1;Name=ADH21467.1;Note=identified by match to protein family HMM PF00253;gbkey=CDS;gene=rpsN;product=ribosomal protein S14p/S29e;protein_id=ADH21467.1;transl_table=4
CP002027.1	Genbank	gene	799478	800020	.	-	.	ID=gene659;Name=rplE;gbkey=Gene;gene=rplE;locus_tag=MMSYN1_0659
CP002027.1	Genbank	CDS	799478	800020	.	-	0	ID=cds599;Parent=gene659;Dbxref=NCBI_GP:ADH21746.1;Name=ADH21746.1;Note=identified by match to protein family HMM PF00281%3B match to protein family HMM PF00673;gbkey=CDS;gene=rplE;product=50S ribosomal protein L5 (BL6);protein_id=ADH21746.1;transl_table=4
CP002027.1	Genbank	sequence_feature	799561	800640	.	+	.	ID=id835;Note=mmyc521%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	800039	800365	.	-	.	ID=gene660;Name=rplX;gbkey=Gene;gene=rplX;locus_tag=MMSYN1_0660
CP002027.1	Genbank	CDS	800039	800365	.	-	0	ID=cds600;Parent=gene660;Dbxref=NCBI_GP:ADH21681.1;Name=ADH21681.1;Note=identified by match to protein family HMM PF00467%3B match to protein family HMM TIGR01079;gbkey=CDS;gene=rplX;product=ribosomal protein L24;protein_id=ADH21681.1;transl_table=4
CP002027.1	Genbank	gene	800379	800747	.	-	.	ID=gene661;Name=rplN;gbkey=Gene;gene=rplN;locus_tag=MMSYN1_0661
CP002027.1	Genbank	CDS	800379	800747	.	-	0	ID=cds601;Parent=gene661;Dbxref=NCBI_GP:ADH22100.1;Name=ADH22100.1;Note=identified by match to protein family HMM PF00238%3B match to protein family HMM TIGR01067;gbkey=CDS;gene=rplN;product=ribosomal protein L14;protein_id=ADH22100.1;transl_table=4
CP002027.1	Genbank	sequence_feature	800561	801640	.	+	.	ID=id836;Note=mmyc522%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	800763	801020	.	-	.	ID=gene662;Name=rpsQ;gbkey=Gene;gene=rpsQ;locus_tag=MMSYN1_0662
CP002027.1	Genbank	CDS	800763	801020	.	-	0	ID=cds602;Parent=gene662;Dbxref=NCBI_GP:ADH21895.1;Name=ADH21895.1;Note=identified by match to protein family HMM PF00366%3B match to protein family HMM TIGR03635;gbkey=CDS;gene=rpsQ;product=30S ribosomal protein S17;protein_id=ADH21895.1;transl_table=4
CP002027.1	Genbank	gene	801020	801436	.	-	.	ID=gene663;Name=rpmC;gbkey=Gene;gene=rpmC;locus_tag=MMSYN1_0663
CP002027.1	Genbank	CDS	801020	801436	.	-	0	ID=cds603;Parent=gene663;Dbxref=NCBI_GP:ADH21487.1;Name=ADH21487.1;Note=identified by match to protein family HMM PF00831%3B match to protein family HMM TIGR00012;gbkey=CDS;gene=rpmC;product=50S ribosomal protein L29;protein_id=ADH21487.1;transl_table=4
CP002027.1	Genbank	gene	801436	801849	.	-	.	ID=gene664;Name=rplP;gbkey=Gene;gene=rplP;locus_tag=MMSYN1_0664
CP002027.1	Genbank	CDS	801436	801849	.	-	0	ID=cds604;Parent=gene664;Dbxref=NCBI_GP:ADH22177.1;Name=ADH22177.1;Note=identified by match to protein family HMM PF00252%3B match to protein family HMM TIGR01164;gbkey=CDS;gene=rplP;product=ribosomal protein L16;protein_id=ADH22177.1;transl_table=4
CP002027.1	Genbank	sequence_feature	801561	802640	.	+	.	ID=id837;Note=mmyc523%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	801852	802553	.	-	.	ID=gene665;Name=rpsC;gbkey=Gene;gene=rpsC;locus_tag=MMSYN1_0665
CP002027.1	Genbank	CDS	801852	802553	.	-	0	ID=cds605;Parent=gene665;Dbxref=NCBI_GP:ADH21825.1;Name=ADH21825.1;Note=identified by match to protein family HMM PF00189%3B match to protein family HMM PF00417%3B match to protein family HMM PF07650%3B match to protein family HMM TIGR01009;gbkey=CDS;gene=rpsC;product=ribosomal protein S3;protein_id=ADH21825.1;transl_table=4
CP002027.1	Genbank	sequence_feature	802561	803640	.	+	.	ID=id838;Note=mmyc524%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	802571	802906	.	-	.	ID=gene666;Name=rplV;gbkey=Gene;gene=rplV;locus_tag=MMSYN1_0666
CP002027.1	Genbank	CDS	802571	802906	.	-	0	ID=cds606;Parent=gene666;Dbxref=NCBI_GP:ADH21742.1;Name=ADH21742.1;Note=identified by match to protein family HMM PF00237%3B match to protein family HMM TIGR01044;gbkey=CDS;gene=rplV;product=ribosomal protein L22;protein_id=ADH21742.1;transl_table=4
CP002027.1	Genbank	gene	802930	803196	.	-	.	ID=gene667;Name=rpsS;gbkey=Gene;gene=rpsS;locus_tag=MMSYN1_0667
CP002027.1	Genbank	CDS	802930	803196	.	-	0	ID=cds607;Parent=gene667;Dbxref=NCBI_GP:ADH21738.1;Name=ADH21738.1;Note=identified by match to protein family HMM PF00203%3B match to protein family HMM TIGR01050;gbkey=CDS;gene=rpsS;product=ribosomal protein S19;protein_id=ADH21738.1;transl_table=4
CP002027.1	Genbank	gene	803218	804066	.	-	.	ID=gene668;Name=rplB;gbkey=Gene;gene=rplB;locus_tag=MMSYN1_0668
CP002027.1	Genbank	CDS	803218	804066	.	-	0	ID=cds608;Parent=gene668;Dbxref=NCBI_GP:ADH21692.1;Name=ADH21692.1;Note=identified by match to protein family HMM PF00181%3B match to protein family HMM PF03947%3B match to protein family HMM TIGR01171;gbkey=CDS;gene=rplB;product=ribosomal protein L2;protein_id=ADH21692.1;transl_table=4
CP002027.1	Genbank	sequence_feature	803561	804640	.	+	.	ID=id839;Note=mmyc525%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	804121	804405	.	-	.	ID=gene669;Name=rplW;gbkey=Gene;gene=rplW;locus_tag=MMSYN1_0669
CP002027.1	Genbank	CDS	804121	804405	.	-	0	ID=cds609;Parent=gene669;Dbxref=NCBI_GP:ADH21593.1;Name=ADH21593.1;Note=identified by match to protein family HMM PF00276;gbkey=CDS;gene=rplW;product=ribosomal protein L23;protein_id=ADH21593.1;transl_table=4
CP002027.1	Genbank	gene	804405	805031	.	-	.	ID=gene670;Name=rplD;gbkey=Gene;gene=rplD;locus_tag=MMSYN1_0670
CP002027.1	Genbank	CDS	804405	805031	.	-	0	ID=cds610;Parent=gene670;Dbxref=NCBI_GP:ADH21484.1;Name=ADH21484.1;Note=identified by match to protein family HMM PF00573;gbkey=CDS;gene=rplD;product=ribosomal protein L4/L1 family;protein_id=ADH21484.1;transl_table=4
CP002027.1	Genbank	sequence_feature	804561	805640	.	+	.	ID=id840;Note=mmyc526%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	805044	805715	.	-	.	ID=gene671;Name=rplC;gbkey=Gene;gene=rplC;locus_tag=MMSYN1_0671
CP002027.1	Genbank	CDS	805044	805715	.	-	0	ID=cds611;Parent=gene671;Dbxref=NCBI_GP:ADH22226.1;Name=ADH22226.1;Note=identified by match to protein family HMM PF00297%3B match to protein family HMM TIGR03625;gbkey=CDS;gene=rplC;product=50S ribosomal protein L3;protein_id=ADH22226.1;transl_table=4
CP002027.1	Genbank	sequence_feature	805561	806640	.	+	.	ID=id841;Note=mmyc527%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	805791	806099	.	-	.	ID=gene672;Name=rpsJ;gbkey=Gene;gene=rpsJ;locus_tag=MMSYN1_0672
CP002027.1	Genbank	CDS	805791	806099	.	-	0	ID=cds612;Parent=gene672;Dbxref=NCBI_GP:ADH22144.1;Name=ADH22144.1;Note=identified by match to protein family HMM PF00338%3B match to protein family HMM TIGR01049;gbkey=CDS;gene=rpsJ;product=ribosomal protein S10;protein_id=ADH22144.1;transl_table=4
CP002027.1	Genbank	gene	806351	807349	.	-	.	ID=gene673;Name=dhaK;gbkey=Gene;gene=dhaK;locus_tag=MMSYN1_0673
CP002027.1	Genbank	CDS	806351	807349	.	-	0	ID=cds613;Parent=gene673;Dbxref=NCBI_GP:ADH22153.1;Name=ADH22153.1;Note=identified by match to protein family HMM PF02733%3B match to protein family HMM TIGR02363;gbkey=CDS;gene=dhaK;product=dihydroxyacetone kinase%2C DhaK subunit;protein_id=ADH22153.1;transl_table=4
CP002027.1	Genbank	sequence_feature	806561	807640	.	+	.	ID=id842;Note=mmyc528f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	807457	809085	.	-	.	ID=gene674;Name=MMSYN1_0674;gbkey=Gene;locus_tag=MMSYN1_0674
CP002027.1	Genbank	CDS	807457	809085	.	-	0	ID=cds614;Parent=gene674;Dbxref=NCBI_GP:ADH22219.1;Name=ADH22219.1;Note=identified by match to protein family HMM PF00128;gbkey=CDS;product=trehalose-6-phosphate hydrolase (Alpha%2Calpha-phosphotrehalase);protein_id=ADH22219.1;transl_table=4
CP002027.1	Genbank	sequence_feature	807561	808640	.	+	.	ID=id843;Note=mmyc529f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	808561	809640	.	+	.	ID=id844;Note=mmyc530%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	809093	810640	.	-	.	ID=gene675;Name=MMSYN1_0675;gbkey=Gene;locus_tag=MMSYN1_0675
CP002027.1	Genbank	CDS	809093	810640	.	-	0	ID=cds615;Parent=gene675;Dbxref=NCBI_GP:ADH21884.1;Name=ADH21884.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system%2C trehalose-specific iibc component;protein_id=ADH21884.1;transl_table=4
CP002027.1	Genbank	sequence_feature	809561	810640	.	+	.	ID=id845;Note=mmyc531%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	810561	811640	.	+	.	ID=id846;Note=mmyc532%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	810706	811692	.	-	.	ID=gene676;Name=MMSYN1_0676;gbkey=Gene;locus_tag=MMSYN1_0676
CP002027.1	Genbank	CDS	810706	811692	.	-	0	ID=cds616;Parent=gene676;Dbxref=NCBI_GP:ADH22018.1;Name=ADH22018.1;gbkey=CDS;product=transcription regulator%2C LacI family;protein_id=ADH22018.1;transl_table=4
CP002027.1	Genbank	sequence_feature	811561	812640	.	+	.	ID=id847;Note=mmyc533%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	812217	813128	.	+	.	ID=gene677;Name=MMSYN1_0677;gbkey=Gene;locus_tag=MMSYN1_0677
CP002027.1	Genbank	CDS	812217	813128	.	+	0	ID=cds617;Parent=gene677;Dbxref=NCBI_GP:ADH22271.1;Name=ADH22271.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22271.1;transl_table=4
CP002027.1	Genbank	sequence_feature	812561	813640	.	+	.	ID=id848;Note=mmyc534%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	813370	813445	.	-	.	ID=gene678;Name=MMSYN1_0678;gbkey=Gene;locus_tag=MMSYN1_0678
CP002027.1	Genbank	tRNA	813370	813445	.	-	.	ID=rna27;Parent=gene678;gbkey=tRNA;product=tRNA-Thr
CP002027.1	Genbank	exon	813370	813445	.	-	.	ID=id849;Parent=rna27;gbkey=tRNA;product=tRNA-Thr
CP002027.1	Genbank	gene	813458	813533	.	-	.	ID=gene679;Name=MMSYN1_0679;gbkey=Gene;locus_tag=MMSYN1_0679
CP002027.1	Genbank	tRNA	813458	813533	.	-	.	ID=rna28;Parent=gene679;gbkey=tRNA;product=tRNA-Val
CP002027.1	Genbank	exon	813458	813533	.	-	.	ID=id850;Parent=rna28;gbkey=tRNA;product=tRNA-Val
CP002027.1	Genbank	gene	813541	813616	.	-	.	ID=gene680;Name=MMSYN1_0680;gbkey=Gene;locus_tag=MMSYN1_0680
CP002027.1	Genbank	tRNA	813541	813616	.	-	.	ID=rna29;Parent=gene680;gbkey=tRNA;product=tRNA-Glu
CP002027.1	Genbank	exon	813541	813616	.	-	.	ID=id851;Parent=rna29;gbkey=tRNA;product=tRNA-Glu
CP002027.1	Genbank	sequence_feature	813561	814640	.	+	.	ID=id852;Note=mmyc535%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	813624	813699	.	-	.	ID=gene681;Name=MMSYN1_0681;gbkey=Gene;locus_tag=MMSYN1_0681
CP002027.1	Genbank	tRNA	813624	813699	.	-	.	ID=rna30;Parent=gene681;gbkey=tRNA;product=tRNA-Asn
CP002027.1	Genbank	exon	813624	813699	.	-	.	ID=id853;Parent=rna30;gbkey=tRNA;product=tRNA-Asn
CP002027.1	Genbank	gene	813801	814964	.	-	.	ID=gene682;Name=MMSYN1_0682;gbkey=Gene;locus_tag=MMSYN1_0682
CP002027.1	Genbank	CDS	813801	814964	.	-	0	ID=cds618;Parent=gene682;Dbxref=NCBI_GP:ADH21552.1;Name=ADH21552.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=putative liporotein;protein_id=ADH21552.1;transl_table=4
CP002027.1	Genbank	sequence_feature	814561	815640	.	+	.	ID=id854;Note=mmyc536%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	815077	815832	.	-	.	ID=gene683;Name=MMSYN1_0683;gbkey=Gene;locus_tag=MMSYN1_0683
CP002027.1	Genbank	CDS	815077	815832	.	-	0	ID=cds619;Parent=gene683;Dbxref=NCBI_GP:ADH21716.1;Name=ADH21716.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21716.1;transl_table=4
CP002027.1	Genbank	sequence_feature	815561	816640	.	+	.	ID=id855;Note=mmyc537%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	815822	816688	.	-	.	ID=gene684;Name=folD;gbkey=Gene;gene=folD;locus_tag=MMSYN1_0684
CP002027.1	Genbank	CDS	815822	816688	.	-	0	ID=cds620;Parent=gene684;Dbxref=NCBI_GP:ADH21604.1;Name=ADH21604.1;Note=identified by match to protein family HMM PF00763%3B match to protein family HMM PF02882;gbkey=CDS;gene=folD;product=bifunctional protein FolD;protein_id=ADH21604.1;transl_table=4
CP002027.1	Genbank	sequence_feature	816561	817640	.	+	.	ID=id856;Note=mmyc538%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	816697	818298	.	-	.	ID=gene685;Name=MMSYN1_0685;gbkey=Gene;locus_tag=MMSYN1_0685
CP002027.1	Genbank	CDS	816697	818298	.	-	0	ID=cds621;Parent=gene685;Dbxref=NCBI_GP:ADH21969.1;Name=ADH21969.1;Note=identified by match to protein family HMM PF02386;gbkey=CDS;product=sodium transport protein;protein_id=ADH21969.1;transl_table=4
CP002027.1	Genbank	sequence_feature	817561	818640	.	+	.	ID=id857;Note=mmyc539%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	818377	819105	.	+	.	ID=gene686;Name=MMSYN1_0686;gbkey=Gene;locus_tag=MMSYN1_0686
CP002027.1	Genbank	CDS	818377	819105	.	+	0	ID=cds622;Parent=gene686;Dbxref=NCBI_GP:ADH21988.1;Name=ADH21988.1;Note=identified by match to protein family HMM PF02080%3B match to protein family HMM PF02254;gbkey=CDS;product=K+%2C Na+ uptake protein integral membrane subunit;protein_id=ADH21988.1;transl_table=4
CP002027.1	Genbank	sequence_feature	818561	819640	.	+	.	ID=id858;Note=mmyc540%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	819132	820571	.	-	.	ID=gene687;Name=gatB;gbkey=Gene;gene=gatB;locus_tag=MMSYN1_0687
CP002027.1	Genbank	CDS	819132	820571	.	-	0	ID=cds623;Parent=gene687;Dbxref=NCBI_GP:ADH22116.1;Name=ADH22116.1;Note=identified by match to protein family HMM PF01162%3B match to protein family HMM PF02637%3B match to protein family HMM PF02934%3B match to protein family HMM TIGR00133;gbkey=CDS;gene=gatB;product=glutamyl-tRNA(Gln) amidotransferase%2C B subunit;protein_id=ADH22116.1;transl_table=4
CP002027.1	Genbank	sequence_feature	819561	820640	.	+	.	ID=id859;Note=mmyc541%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	820561	821640	.	+	.	ID=id860;Note=mmyc542%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	820573	822030	.	-	.	ID=gene688;Name=gatA;gbkey=Gene;gene=gatA;locus_tag=MMSYN1_0688
CP002027.1	Genbank	CDS	820573	822030	.	-	0	ID=cds624;Parent=gene688;Dbxref=NCBI_GP:ADH21982.1;Name=ADH21982.1;Note=identified by match to protein family HMM PF01425;gbkey=CDS;gene=gatA;product=glutamyl-tRNA(Gln) amidotransferase subunit A (Glu-ADTsubunit A);protein_id=ADH21982.1;transl_table=4
CP002027.1	Genbank	sequence_feature	821561	822640	.	+	.	ID=id861;Note=mmyc543%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	822030	822326	.	-	.	ID=gene689;Name=gatC;gbkey=Gene;gene=gatC;locus_tag=MMSYN1_0689
CP002027.1	Genbank	CDS	822030	822326	.	-	0	ID=cds625;Parent=gene689;Dbxref=NCBI_GP:ADH21502.1;Name=ADH21502.1;Note=identified by match to protein family HMM PF02686%3B match to protein family HMM TIGR00135;gbkey=CDS;gene=gatC;product=glutamyl-tRNA(Gln) amidotransferase%2C C subunit;protein_id=ADH21502.1;transl_table=4
CP002027.1	Genbank	gene	822328	824334	.	-	.	ID=gene690;Name=ligA;gbkey=Gene;gene=ligA;locus_tag=MMSYN1_0690
CP002027.1	Genbank	CDS	822328	824334	.	-	0	ID=cds626;Parent=gene690;Dbxref=NCBI_GP:ADH22231.1;Name=ADH22231.1;Note=identified by match to protein family HMM PF00533%3B match to protein family HMM PF01653%3B match to protein family HMM PF03119%3B match to protein family HMM PF03120%3B match to protein family HMM TIGR00575;gbkey=CDS;gene=ligA;product=DNA ligase%2C NAD-dependent;protein_id=ADH22231.1;transl_table=4
CP002027.1	Genbank	sequence_feature	822561	823640	.	+	.	ID=id862;Note=mmyc544%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	823561	824640	.	+	.	ID=id863;Note=mmyc545%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	824338	826359	.	-	.	ID=gene691;Name=MMSYN1_0691;gbkey=Gene;locus_tag=MMSYN1_0691
CP002027.1	Genbank	CDS	824338	826359	.	-	0	ID=cds627;Parent=gene691;Dbxref=NCBI_GP:ADH21759.1;Name=ADH21759.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21759.1;transl_table=4
CP002027.1	Genbank	sequence_feature	824561	825640	.	+	.	ID=id864;Note=mmyc546%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	825561	826640	.	+	.	ID=id865;Note=mmyc547%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	826362	827270	.	-	.	ID=gene692;Name=MMSYN1_0692;gbkey=Gene;locus_tag=MMSYN1_0692
CP002027.1	Genbank	CDS	826362	827270	.	-	0	ID=cds628;Parent=gene692;Dbxref=NCBI_GP:ADH21840.1;Name=ADH21840.1;Note=identified by match to protein family HMM PF00849%3B match to protein family HMM PF01479;gbkey=CDS;product=23S rRNA pseudouridine synthase;protein_id=ADH21840.1;transl_table=4
CP002027.1	Genbank	sequence_feature	826561	827640	.	+	.	ID=id866;Note=mmyc548%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	827273	828241	.	-	.	ID=gene693;Name=MMSYN1_0693;gbkey=Gene;locus_tag=MMSYN1_0693
CP002027.1	Genbank	CDS	827273	828241	.	-	0	ID=cds629;Parent=gene693;Dbxref=NCBI_GP:ADH21474.1;Name=ADH21474.1;Note=identified by match to protein family HMM PF02517;gbkey=CDS;product=conserved %2C caax amino protease family;protein_id=ADH21474.1;transl_table=4
CP002027.1	Genbank	sequence_feature	827561	828640	.	+	.	ID=id867;Note=mmyc549%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	828297	828566	.	-	.	ID=gene694;Name=MMSYN1_0694;gbkey=Gene;locus_tag=MMSYN1_0694
CP002027.1	Genbank	CDS	828297	828566	.	-	0	ID=cds630;Parent=gene694;Dbxref=NCBI_GP:ADH21764.1;Name=ADH21764.1;Note=identified by match to protein family HMM PF00381%3B match to protein family HMM TIGR01003;gbkey=CDS;product=phosphocarrier%2C HPr family;protein_id=ADH21764.1;transl_table=4
CP002027.1	Genbank	sequence_feature	828561	829640	.	+	.	ID=id868;Note=mmyc550%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	828631	830799	.	-	.	ID=gene695;Name=MMSYN1_0695;gbkey=Gene;locus_tag=MMSYN1_0695
CP002027.1	Genbank	CDS	828631	830799	.	-	0	ID=cds631;Parent=gene695;Dbxref=NCBI_GP:ADH22249.1;Name=ADH22249.1;Note=identified by match to protein family HMM PF00580;gbkey=CDS;product=UvrD/REP helicase domain protein;protein_id=ADH22249.1;transl_table=4
CP002027.1	Genbank	sequence_feature	829561	830640	.	+	.	ID=id869;Note=mmyc551%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	830561	831640	.	+	.	ID=id870;Note=mmyc552%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	830816	831571	.	-	.	ID=gene696;Name=MMSYN1_0696;gbkey=Gene;locus_tag=MMSYN1_0696
CP002027.1	Genbank	CDS	830816	831571	.	-	0	ID=cds632;Parent=gene696;Dbxref=NCBI_GP:ADH21578.1;Name=ADH21578.1;Note=identified by match to protein family HMM PF06271;gbkey=CDS;product=RDD family protein;protein_id=ADH21578.1;transl_table=4
CP002027.1	Genbank	sequence_feature	831561	832640	.	+	.	ID=id871;Note=mmyc553%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	831571	832527	.	-	.	ID=gene697;Name=MMSYN1_0697;gbkey=Gene;locus_tag=MMSYN1_0697
CP002027.1	Genbank	CDS	831571	832527	.	-	0	ID=cds633;Parent=gene697;Dbxref=NCBI_GP:ADH21959.1;Name=ADH21959.1;gbkey=CDS;product=glycosyltransferase;protein_id=ADH21959.1;transl_table=4
CP002027.1	Genbank	sequence_feature	832561	833640	.	+	.	ID=id872;Note=mmyc554%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	832678	833904	.	-	.	ID=gene698;Name=MMSYN1_0698;gbkey=Gene;locus_tag=MMSYN1_0698
CP002027.1	Genbank	CDS	832678	833904	.	-	0	ID=cds634;Parent=gene698;Dbxref=NCBI_GP:ADH22270.1;Name=ADH22270.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=lipoprotein. putative;protein_id=ADH22270.1;transl_table=4
CP002027.1	Genbank	sequence_feature	833561	834640	.	+	.	ID=id873;Note=mmyc555%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	833993	834922	.	-	.	ID=gene699;Name=msrA/B;gbkey=Gene;gene=msrA/B;locus_tag=MMSYN1_0699
CP002027.1	Genbank	CDS	833993	834922	.	-	0	ID=cds635;Parent=gene699;Dbxref=NCBI_GP:ADH21837.1;Name=ADH21837.1;Note=identified by match to protein family HMM PF01625%3B match to protein family HMM PF01641%3B match to protein family HMM TIGR00357%3B match to protein family HMM TIGR00401;gbkey=CDS;gene=msrA/B;product=peptide methionine sulfoxide reductase MsrA/msrB;protein_id=ADH21837.1;transl_table=4
CP002027.1	Genbank	sequence_feature	834561	835640	.	+	.	ID=id874;Note=mmyc556%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	835036	837222	.	-	.	ID=gene700;Name=MMSYN1_0700;gbkey=Gene;locus_tag=MMSYN1_0700
CP002027.1	Genbank	CDS	835036	837222	.	-	0	ID=cds636;Parent=gene700;Dbxref=NCBI_GP:ADH21752.1;Name=ADH21752.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21752.1;transl_table=4
CP002027.1	Genbank	sequence_feature	835561	836640	.	+	.	ID=id875;Note=mmyc557%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	836561	837640	.	+	.	ID=id876;Note=mmyc558%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	837470	839818	.	-	.	ID=gene701;Name=MMSYN1_0701;gbkey=Gene;locus_tag=MMSYN1_0701
CP002027.1	Genbank	CDS	837470	839818	.	-	0	ID=cds637;Parent=gene701;Dbxref=NCBI_GP:ADH22211.1;Name=ADH22211.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22211.1;transl_table=4
CP002027.1	Genbank	sequence_feature	837561	838640	.	+	.	ID=id877;Note=mmyc559%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	838561	839640	.	+	.	ID=id878;Note=mmyc560%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	839561	840640	.	+	.	ID=id879;Note=mmyc561%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	839827	840729	.	-	.	ID=gene702;Name=MMSYN1_0702;gbkey=Gene;locus_tag=MMSYN1_0702
CP002027.1	Genbank	CDS	839827	840729	.	-	0	ID=cds638;Parent=gene702;Dbxref=NCBI_GP:ADH22092.1;Name=ADH22092.1;gbkey=CDS;product=transmembrane protein;protein_id=ADH22092.1;transl_table=4
CP002027.1	Genbank	sequence_feature	840561	841640	.	+	.	ID=id880;Note=mmyc562%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	840856	842691	.	-	.	ID=gene703;Name=MMSYN1_0703;gbkey=Gene;locus_tag=MMSYN1_0703
CP002027.1	Genbank	CDS	840856	842691	.	-	0	ID=cds639;Parent=gene703;Dbxref=NCBI_GP:ADH21974.1;Name=ADH21974.1;Note=identified by match to protein family HMM PF03235%3B match to protein family HMM PF07510;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21974.1;transl_table=4
CP002027.1	Genbank	sequence_feature	841561	842640	.	+	.	ID=id881;Note=mmyc563%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	842561	843640	.	+	.	ID=id882;Note=mmyc564%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	842694	843260	.	-	.	ID=gene704;Name=MMSYN1_0704;gbkey=Gene;locus_tag=MMSYN1_0704
CP002027.1	Genbank	CDS	842694	843260	.	-	0	ID=cds640;Parent=gene704;Dbxref=NCBI_GP:ADH21666.1;Name=ADH21666.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21666.1;transl_table=4
CP002027.1	Genbank	gene	843263	844099	.	-	.	ID=gene705;Name=MMSYN1_0705;gbkey=Gene;locus_tag=MMSYN1_0705
CP002027.1	Genbank	CDS	843263	844099	.	-	0	ID=cds641;Parent=gene705;Dbxref=NCBI_GP:ADH21804.1;Name=ADH21804.1;gbkey=CDS;product=C-5 cytosine-specific DNA methylase;protein_id=ADH21804.1;transl_table=4
CP002027.1	Genbank	sequence_feature	843561	844640	.	+	.	ID=id883;Note=mmyc565%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	844369	846117	.	-	.	ID=gene706;Name=MMSYN1_0706;gbkey=Gene;locus_tag=MMSYN1_0706
CP002027.1	Genbank	CDS	844369	846117	.	-	0	ID=cds642;Parent=gene706;Dbxref=NCBI_GP:ADH21479.1;Name=ADH21479.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=alkylphosphonate ABC transporter%2C permease component;protein_id=ADH21479.1;transl_table=4
CP002027.1	Genbank	sequence_feature	844561	845640	.	+	.	ID=id884;Note=mmyc566%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	845561	846640	.	+	.	ID=id885;Note=mmyc567%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	846081	846830	.	-	.	ID=gene707;Name=MMSYN1_0707;gbkey=Gene;locus_tag=MMSYN1_0707
CP002027.1	Genbank	CDS	846081	846830	.	-	0	ID=cds643;Parent=gene707;Dbxref=NCBI_GP:ADH21644.1;Name=ADH21644.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=alkylphosphonate ABC transporter%2C ATP-binding component;protein_id=ADH21644.1;transl_table=4
CP002027.1	Genbank	sequence_feature	846561	847640	.	+	.	ID=id886;Note=mmyc568%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	846844	848307	.	-	.	ID=gene708;Name=MMSYN1_0708;gbkey=Gene;locus_tag=MMSYN1_0708
CP002027.1	Genbank	CDS	846844	848307	.	-	0	ID=cds644;Parent=gene708;Dbxref=NCBI_GP:ADH22261.1;Name=ADH22261.1;gbkey=CDS;product=alkylphosphonate ABC transporter%2C substrate-bindin;protein_id=ADH22261.1;transl_table=4
CP002027.1	Genbank	sequence_feature	847561	848640	.	+	.	ID=id887;Note=mmyc569%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	binding_site	848364	848454	.	-	.	ID=id888;Note=TPP riboswitch (THI element)%3B Rfam score 44.51;bound_moiety=thiamine/thiamin pyrophosphate;gbkey=misc_binding;inference=nucleotide motif:RFAM:RF00059
CP002027.1	Genbank	gene	848530	849393	.	-	.	ID=gene709;Name=MMSYN1_0710;gbkey=Gene;locus_tag=MMSYN1_0710
CP002027.1	Genbank	CDS	848530	849393	.	-	0	ID=cds645;Parent=gene709;Dbxref=NCBI_GP:ADH21960.1;Name=ADH21960.1;Note=identified by match to protein family HMM PF00702%3B match to protein family HMM PF05116%3B match to protein family HMM PF08282%3B match to protein family HMM TIGR00099%3B match to protein family HMM TIGR01484;gbkey=CDS;product=hydrolase of the HAD family;protein_id=ADH21960.1;transl_table=4
CP002027.1	Genbank	sequence_feature	848561	849640	.	+	.	ID=id889;Note=mmyc570%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	849525	850715	.	+	.	ID=gene710;Name=MMSYN1_0711;gbkey=Gene;locus_tag=MMSYN1_0711
CP002027.1	Genbank	CDS	849525	850715	.	+	0	ID=cds646;Parent=gene710;Dbxref=NCBI_GP:ADH22034.1;Name=ADH22034.1;Note=identified by match to protein family HMM PF00155;gbkey=CDS;product=aminotransferase;protein_id=ADH22034.1;transl_table=4
CP002027.1	Genbank	sequence_feature	849561	850640	.	+	.	ID=id890;Note=mmyc571%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	850561	851640	.	+	.	ID=id891;Note=mmyc572%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	850725	851126	.	+	.	ID=gene711;Name=MMSYN1_0712;gbkey=Gene;locus_tag=MMSYN1_0712
CP002027.1	Genbank	CDS	850725	851126	.	+	0	ID=cds647;Parent=gene711;Dbxref=NCBI_GP:ADH22158.1;Name=ADH22158.1;Note=identified by match to protein family HMM PF01042%3B match to protein family HMM TIGR00004;gbkey=CDS;product=endoribonuclease L-PSP%2C putative;protein_id=ADH22158.1;transl_table=4
CP002027.1	Genbank	gene	851162	852493	.	-	.	ID=gene712;Name=MMSYN1_0713;gbkey=Gene;locus_tag=MMSYN1_0713
CP002027.1	Genbank	CDS	851162	852493	.	-	0	ID=cds648;Parent=gene712;Dbxref=NCBI_GP:ADH22068.1;Name=ADH22068.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22068.1;transl_table=4
CP002027.1	Genbank	sequence_feature	851561	852640	.	+	.	ID=id892;Note=mmyc573%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	852523	853779	.	-	.	ID=gene713;Name=MMSYN1_0714;gbkey=Gene;locus_tag=MMSYN1_0714
CP002027.1	Genbank	CDS	852523	853779	.	-	0	ID=cds649;Parent=gene713;Dbxref=NCBI_GP:ADH21965.1;Name=ADH21965.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21965.1;transl_table=4
CP002027.1	Genbank	sequence_feature	852561	853640	.	+	.	ID=id893;Note=mmyc574%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	853561	854640	.	+	.	ID=id894;Note=mmyc575%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	853966	855234	.	-	.	ID=gene714;Name=MMSYN1_0715;gbkey=Gene;locus_tag=MMSYN1_0715
CP002027.1	Genbank	CDS	853966	855234	.	-	0	ID=cds650;Parent=gene714;Dbxref=NCBI_GP:ADH22064.1;Name=ADH22064.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22064.1;transl_table=4
CP002027.1	Genbank	sequence_feature	854561	855640	.	+	.	ID=id895;Note=mmyc576%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	855376	856518	.	+	.	ID=gene715;Name=MMSYN1_0716;gbkey=Gene;locus_tag=MMSYN1_0716
CP002027.1	Genbank	CDS	855376	856518	.	+	0	ID=cds651;Parent=gene715;Dbxref=NCBI_GP:ADH21701.1;Name=ADH21701.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21701.1;transl_table=4
CP002027.1	Genbank	sequence_feature	855561	856640	.	+	.	ID=id896;Note=mmyc577%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	856561	857640	.	+	.	ID=id897;Note=mmyc578f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	856724	856800	.	+	.	ID=gene716;Name=MMSYN1_0717;gbkey=Gene;locus_tag=MMSYN1_0717
CP002027.1	Genbank	tRNA	856724	856800	.	+	.	ID=rna31;Parent=gene716;gbkey=tRNA;product=tRNA-Arg
CP002027.1	Genbank	exon	856724	856800	.	+	.	ID=id898;Parent=rna31;gbkey=tRNA;product=tRNA-Arg
CP002027.1	Genbank	gene	856848	856924	.	+	.	ID=gene717;Name=MMSYN1_0718;gbkey=Gene;locus_tag=MMSYN1_0718
CP002027.1	Genbank	tRNA	856848	856924	.	+	.	ID=rna32;Parent=gene717;gbkey=tRNA;product=tRNA-Pro
CP002027.1	Genbank	exon	856848	856924	.	+	.	ID=id899;Parent=rna32;gbkey=tRNA;product=tRNA-Pro
CP002027.1	Genbank	gene	856935	857010	.	+	.	ID=gene718;Name=MMSYN1_0719;gbkey=Gene;locus_tag=MMSYN1_0719
CP002027.1	Genbank	tRNA	856935	857010	.	+	.	ID=rna33;Parent=gene718;gbkey=tRNA;product=tRNA-Ala
CP002027.1	Genbank	exon	856935	857010	.	+	.	ID=id900;Parent=rna33;gbkey=tRNA;product=tRNA-Ala
CP002027.1	Genbank	gene	857015	857091	.	+	.	ID=gene719;Name=MMSYN1_0720;gbkey=Gene;locus_tag=MMSYN1_0720
CP002027.1	Genbank	tRNA	857015	857091	.	+	.	ID=rna34;Parent=gene719;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	exon	857015	857091	.	+	.	ID=id901;Parent=rna34;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	gene	857103	857179	.	+	.	ID=gene720;Name=MMSYN1_0721;gbkey=Gene;locus_tag=MMSYN1_0721
CP002027.1	Genbank	tRNA	857103	857179	.	+	.	ID=rna35;Parent=gene720;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	exon	857103	857179	.	+	.	ID=id902;Parent=rna35;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	gene	857222	857314	.	+	.	ID=gene721;Name=MMSYN1_0722;gbkey=Gene;locus_tag=MMSYN1_0722
CP002027.1	Genbank	tRNA	857222	857314	.	+	.	ID=rna36;Parent=gene721;gbkey=tRNA;product=tRNA-Ser
CP002027.1	Genbank	exon	857222	857314	.	+	.	ID=id903;Parent=rna36;gbkey=tRNA;product=tRNA-Ser
CP002027.1	Genbank	gene	857337	857412	.	+	.	ID=gene722;Name=MMSYN1_0723;gbkey=Gene;locus_tag=MMSYN1_0723
CP002027.1	Genbank	tRNA	857337	857412	.	+	.	ID=rna37;Parent=gene722;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	exon	857337	857412	.	+	.	ID=id904;Parent=rna37;gbkey=tRNA;product=tRNA-Met
CP002027.1	Genbank	gene	857415	857491	.	+	.	ID=gene723;Name=MMSYN1_0724;gbkey=Gene;locus_tag=MMSYN1_0724
CP002027.1	Genbank	tRNA	857415	857491	.	+	.	ID=rna38;Parent=gene723;gbkey=tRNA;product=tRNA-Asp
CP002027.1	Genbank	exon	857415	857491	.	+	.	ID=id905;Parent=rna38;gbkey=tRNA;product=tRNA-Asp
CP002027.1	Genbank	gene	857500	857575	.	+	.	ID=gene724;Name=MMSYN1_0725;gbkey=Gene;locus_tag=MMSYN1_0725
CP002027.1	Genbank	tRNA	857500	857575	.	+	.	ID=rna39;Parent=gene724;gbkey=tRNA;product=tRNA-Phe
CP002027.1	Genbank	exon	857500	857575	.	+	.	ID=id906;Parent=rna39;gbkey=tRNA;product=tRNA-Phe
CP002027.1	Genbank	sequence_feature	857561	858640	.	+	.	ID=id907;Note=mmyc579f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	857683	858417	.	+	.	ID=gene725;Name=nagB;gbkey=Gene;gene=nagB;locus_tag=MMSYN1_0726
CP002027.1	Genbank	CDS	857683	858417	.	+	0	ID=cds652;Parent=gene725;Dbxref=NCBI_GP:ADH21809.1;Name=ADH21809.1;Note=identified by match to protein family HMM PF01182%3B match to protein family HMM TIGR00502;gbkey=CDS;gene=nagB;product=glucosamine-6-phosphate deaminase;protein_id=ADH21809.1;transl_table=4
CP002027.1	Genbank	gene	858515	859261	.	+	.	ID=gene726;Name=tpiA;gbkey=Gene;gene=tpiA;locus_tag=MMSYN1_0727
CP002027.1	Genbank	CDS	858515	859261	.	+	0	ID=cds653;Parent=gene726;Dbxref=NCBI_GP:ADH21521.1;Name=ADH21521.1;Note=identified by match to protein family HMM PF00121%3B match to protein family HMM TIGR00419;gbkey=CDS;gene=tpiA;product=triose-phosphate isomerase;protein_id=ADH21521.1;transl_table=4
CP002027.1	Genbank	sequence_difference	859029	859029	.	+	.	ID=id908;Note=SNP%3B G (JCVI-syn1) -> A (sMmYCp235-1)%2C Gly (JCVI-syn1) -> Glu (sMmYCp235-1)%2C CDS: tpiA;gbkey=misc_difference;gene=tpiA;replace=g
CP002027.1	Genbank	sequence_difference	859037	859037	.	+	.	ID=id909;Note=SNP%3B G (JCVI-syn1) -> T (sMmYCp235-1)%2C Ala (JCVI-syn1) -> Ser (sMmYCp235-1)%2C CDS: tpiA;gbkey=misc_difference;gene=tpiA;replace=g
CP002027.1	Genbank	sequence_feature	858561	859640	.	+	.	ID=id910;Note=mmyc580%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	859254	860090	.	+	.	ID=gene727;Name=MMSYN1_0728;gbkey=Gene;locus_tag=MMSYN1_0728
CP002027.1	Genbank	CDS	859254	860090	.	+	0	ID=cds654;Parent=gene727;Dbxref=NCBI_GP:ADH22257.1;Name=ADH22257.1;Note=identified by match to protein family HMM PF08282%3B match to protein family HMM TIGR01484;gbkey=CDS;product=HAD-superfamily hydrolase subfamily IIB%2C protein;protein_id=ADH22257.1;transl_table=4
CP002027.1	Genbank	sequence_feature	859561	860640	.	+	.	ID=id911;Note=mmyc581%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	860093	861688	.	+	.	ID=gene728;Name=gpmI;gbkey=Gene;gene=gpmI;locus_tag=MMSYN1_0729
CP002027.1	Genbank	CDS	860093	861688	.	+	0	ID=cds655;Parent=gene728;Dbxref=NCBI_GP:ADH21981.1;Name=ADH21981.1;Note=identified by match to protein family HMM PF01676%3B match to protein family HMM PF06415%3B match to protein family HMM TIGR01307;gbkey=CDS;gene=gpmI;product=2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase;protein_id=ADH21981.1;transl_table=4
CP002027.1	Genbank	sequence_feature	860561	861640	.	+	.	ID=id912;Note=mmyc582%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=gpmI
CP002027.1	Genbank	sequence_feature	861561	862640	.	+	.	ID=id913;Note=mmyc583%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	861788	862387	.	+	.	ID=gene729;Name=MMSYN1_0730;gbkey=Gene;locus_tag=MMSYN1_0730
CP002027.1	Genbank	CDS	861788	862387	.	+	0	ID=cds656;Parent=gene729;Dbxref=NCBI_GP:ADH21870.1;Name=ADH21870.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21870.1;transl_table=4
CP002027.1	Genbank	gene	862389	863402	.	+	.	ID=gene730;Name=MMSYN1_0731;gbkey=Gene;locus_tag=MMSYN1_0731
CP002027.1	Genbank	CDS	862389	863402	.	+	0	ID=cds657;Parent=gene730;Dbxref=NCBI_GP:ADH21917.1;Name=ADH21917.1;Note=identified by match to protein family HMM PF08843;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21917.1;transl_table=4
CP002027.1	Genbank	sequence_feature	862561	863640	.	+	.	ID=id914;Note=mmyc584%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	863454	864122	.	-	.	ID=gene731;Name=deoC;gbkey=Gene;gene=deoC;locus_tag=MMSYN1_0732
CP002027.1	Genbank	CDS	863454	864122	.	-	0	ID=cds658;Parent=gene731;Dbxref=NCBI_GP:ADH22274.1;Name=ADH22274.1;Note=identified by match to protein family HMM PF01791%3B match to protein family HMM TIGR00126;gbkey=CDS;gene=deoC;product=deoxyribose-phosphate aldolase;protein_id=ADH22274.1;transl_table=4
CP002027.1	Genbank	sequence_feature	863561	864640	.	+	.	ID=id915;Note=mmyc585%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	864134	865810	.	-	.	ID=gene732;Name=MMSYN1_0733;gbkey=Gene;locus_tag=MMSYN1_0733
CP002027.1	Genbank	CDS	864134	865810	.	-	0	ID=cds659;Parent=gene732;Dbxref=NCBI_GP:ADH22123.1;Name=ADH22123.1;Note=identified by match to protein family HMM PF00408%3B match to protein family HMM PF02878%3B match to protein family HMM PF02879;gbkey=CDS;product=phosphoglucomutase or phosphomannomutase;protein_id=ADH22123.1;transl_table=4
CP002027.1	Genbank	sequence_feature	864561	865640	.	+	.	ID=id916;Note=mmyc586%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	865561	866640	.	+	.	ID=id917;Note=mmyc587%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	865972	867285	.	+	.	ID=gene733;Name=pdp;gbkey=Gene;gene=pdp;locus_tag=MMSYN1_0734
CP002027.1	Genbank	CDS	865972	867285	.	+	0	ID=cds660;Parent=gene733;Dbxref=NCBI_GP:ADH21556.1;Name=ADH21556.1;Note=identified by match to protein family HMM PF00591%3B match to protein family HMM PF02885%3B match to protein family HMM PF07831%3B match to protein family HMM TIGR02644;gbkey=CDS;gene=pdp;product=pyrimidine-nucleoside phosphorylase;protein_id=ADH21556.1;transl_table=4
CP002027.1	Genbank	sequence_feature	866561	867640	.	+	.	ID=id918;Note=mmyc588%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	867340	868071	.	-	.	ID=gene734;Name=tnpB_4;gbkey=Gene;gene=tnpB_4;locus_tag=MMSYN1_0735
CP002027.1	Genbank	CDS	867340	868071	.	-	0	ID=cds661;Parent=gene734;Dbxref=NCBI_GP:ADH21834.1;Name=ADH21834.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_4;product=IS1296 transposase protein B;protein_id=ADH21834.1;transl_table=4
CP002027.1	Genbank	sequence_feature	867561	868640	.	+	.	ID=id919;Note=mmyc589%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	868209	868751	.	-	.	ID=gene735;Name=tnpA_4;gbkey=Gene;gene=tnpA_4;locus_tag=MMSYN1_0736
CP002027.1	Genbank	CDS	868209	868751	.	-	0	ID=cds662;Parent=gene735;Dbxref=NCBI_GP:ADH21800.1;Name=ADH21800.1;gbkey=CDS;gene=tnpA_4;product=IS1296 transposase protein A;protein_id=ADH21800.1;transl_table=4
CP002027.1	Genbank	sequence_feature	868561	869640	.	+	.	ID=id920;Note=mmyc590%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	868816	869103	.	-	.	ID=gene736;Name=MMSYN1_0737;Note=PTS system%2C fructose-specific iibc component%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0737;pseudo=true
CP002027.1	Genbank	gene	869142	869264	.	-	.	ID=gene737;Name=MMSYN1_0738;gbkey=Gene;locus_tag=MMSYN1_0738
CP002027.1	Genbank	CDS	869142	869264	.	-	0	ID=cds663;Parent=gene737;Dbxref=NCBI_GP:ADH21971.1;Name=ADH21971.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21971.1;transl_table=4
CP002027.1	Genbank	pseudogene	869269	869403	.	-	.	ID=gene738;Name=MMSYN1_0739;Note=PTS system%2C fructose-specific family%2C iiabc components%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0739;pseudo=true
CP002027.1	Genbank	gene	869453	869608	.	-	.	ID=gene739;Name=MMSYN1_0740;gbkey=Gene;locus_tag=MMSYN1_0740
CP002027.1	Genbank	CDS	869453	869608	.	-	0	ID=cds664;Parent=gene739;Dbxref=NCBI_GP:ADH21997.1;Name=ADH21997.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH21997.1;transl_table=4
CP002027.1	Genbank	sequence_feature	869561	870640	.	+	.	ID=id921;Note=mmyc591%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	869727	870719	.	-	.	ID=gene740;Name=mmyCIIR;Note=CCTTC-recognizing Type II restriction modification system (MmyCII) endonuclease subunit%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;gene=mmyCIIR;locus_tag=MMSYN1_0741;pseudo=true
CP002027.1	Genbank	sequence_feature	870561	871640	.	+	.	ID=id922;Note=mmyc592%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	870721	873225	.	-	.	ID=gene741;Name=mmyCIIM;gbkey=Gene;gene=mmyCIIM;locus_tag=MMSYN1_0742
CP002027.1	Genbank	CDS	870721	873225	.	-	0	ID=cds665;Parent=gene741;Dbxref=NCBI_GP:ADH21829.1;Name=ADH21829.1;Note=identified by match to protein family HMM PF00145;gbkey=CDS;gene=mmyCIIM;product=CCTTC-recognizing Type II restriction modification system (MmyCII) adenine/cytosine DNA methyltransferase subunit;protein_id=ADH21829.1;transl_table=4
CP002027.1	Genbank	sequence_feature	871561	872640	.	+	.	ID=id923;Note=mmyc593%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	872561	873640	.	+	.	ID=id924;Note=mmyc594%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	873360	875396	.	-	.	ID=gene742;Name=fruA;gbkey=Gene;gene=fruA;locus_tag=MMSYN1_0743
CP002027.1	Genbank	CDS	873360	875396	.	-	0	ID=cds666;Parent=gene742;Dbxref=NCBI_GP:ADH21862.1;Name=ADH21862.1;Note=identified by match to protein family HMM PF00359%3B match to protein family HMM PF02378%3B match to protein family HMM PF02379%3B match to protein family HMM TIGR00829%3B match to protein family HMM TIGR00848%3B match to protein family HMM TIGR01427;gbkey=CDS;gene=fruA;product=PTS system%2C Fructose specific IIB subunit family;protein_id=ADH21862.1;transl_table=4
CP002027.1	Genbank	sequence_feature	873561	874640	.	+	.	ID=id925;Note=mmyc595%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	874561	875640	.	+	.	ID=id926;Note=mmyc596%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	875399	876334	.	-	.	ID=gene743;Name=pfkB;gbkey=Gene;gene=pfkB;locus_tag=MMSYN1_0744
CP002027.1	Genbank	CDS	875399	876334	.	-	0	ID=cds667;Parent=gene743;Dbxref=NCBI_GP:ADH21570.1;Name=ADH21570.1;Note=identified by match to protein family HMM PF00294%3B match to protein family HMM TIGR03168%3B match to protein family HMM TIGR03828;gbkey=CDS;gene=pfkB;product=1-phosphofructokinase;protein_id=ADH21570.1;transl_table=4
CP002027.1	Genbank	sequence_feature	875561	876640	.	+	.	ID=id927;Note=mmyc597%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	876334	877032	.	-	.	ID=gene744;Name=MMSYN1_0745;gbkey=Gene;locus_tag=MMSYN1_0745
CP002027.1	Genbank	CDS	876334	877032	.	-	0	ID=cds668;Parent=gene744;Dbxref=NCBI_GP:ADH21639.1;Name=ADH21639.1;Note=identified by match to protein family HMM PF00455%3B match to protein family HMM PF08220;gbkey=CDS;product=transcriptional regulator of the fructose operon%2C DeoR family;protein_id=ADH21639.1;transl_table=4
CP002027.1	Genbank	sequence_feature	876561	877640	.	+	.	ID=id928;Note=mmyc598%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	877185	878165	.	+	.	ID=gene745;Name=MMSYN1_0746;gbkey=Gene;locus_tag=MMSYN1_0746
CP002027.1	Genbank	CDS	877185	878165	.	+	0	ID=cds669;Parent=gene745;Dbxref=NCBI_GP:ADH22175.1;Name=ADH22175.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22175.1;transl_table=4
CP002027.1	Genbank	sequence_feature	877561	878640	.	+	.	ID=id929;Note=mmyc599%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	878368	879021	.	+	.	ID=gene746;Name=MMSYN1_0747;gbkey=Gene;locus_tag=MMSYN1_0747
CP002027.1	Genbank	CDS	878368	879021	.	+	0	ID=cds670;Parent=gene746;Dbxref=NCBI_GP:ADH21896.1;Name=ADH21896.1;Note=identified by match to protein family HMM PF01048;gbkey=CDS;product=purine nucleoside phosphorylase;protein_id=ADH21896.1;transl_table=4
CP002027.1	Genbank	sequence_feature	878561	879640	.	+	.	ID=id930;Note=mmyc600%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	879069	879533	.	-	.	ID=gene747;Name=MMSYN1_0748;gbkey=Gene;locus_tag=MMSYN1_0748
CP002027.1	Genbank	CDS	879069	879533	.	-	0	ID=cds671;Parent=gene747;Dbxref=NCBI_GP:ADH21985.1;Name=ADH21985.1;gbkey=CDS;product=IS1296 transposase EH;protein_id=ADH21985.1;transl_table=4
CP002027.1	Genbank	sequence_feature	879561	880640	.	+	.	ID=id931;Note=mmyc601%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	879588	880493	.	-	.	ID=gene748;Name=MMSYN1_0749;gbkey=Gene;locus_tag=MMSYN1_0749
CP002027.1	Genbank	CDS	879588	880493	.	-	0	ID=cds672;Parent=gene748;Dbxref=NCBI_GP:ADH21772.1;Name=ADH21772.1;Note=identified by match to protein family HMM PF00561;gbkey=CDS;product=lysophospholipase;protein_id=ADH21772.1;transl_table=4
CP002027.1	Genbank	sequence_feature	880561	881640	.	+	.	ID=id932;Note=mmyc602%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	880596	883649	.	-	.	ID=gene749;Name=MMSYN1_0750;gbkey=Gene;locus_tag=MMSYN1_0750
CP002027.1	Genbank	CDS	880596	883649	.	-	0	ID=cds673;Parent=gene749;Dbxref=NCBI_GP:ADH21707.1;Name=ADH21707.1;gbkey=CDS;product=viral A-type inclusion protein%2C putative;protein_id=ADH21707.1;transl_table=4
CP002027.1	Genbank	sequence_feature	881561	882640	.	+	.	ID=id933;Note=mmyc603%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	882561	883640	.	+	.	ID=id934;Note=mmyc604%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	883561	884640	.	+	.	ID=id935;Note=mmyc605%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	883674	886715	.	-	.	ID=gene750;Name=MMSYN1_0751;gbkey=Gene;locus_tag=MMSYN1_0751
CP002027.1	Genbank	CDS	883674	886715	.	-	0	ID=cds674;Parent=gene750;Dbxref=NCBI_GP:ADH21583.1;Name=ADH21583.1;gbkey=CDS;product=viral A-type inclusion protein%2C putative;protein_id=ADH21583.1;transl_table=4
CP002027.1	Genbank	sequence_feature	884561	885640	.	+	.	ID=id936;Note=mmyc606%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	885561	886640	.	+	.	ID=id937;Note=mmyc607%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	886561	887640	.	+	.	ID=id938;Note=mmyc608%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	887085	887657	.	+	.	ID=gene751;Name=MMSYN1_0752;gbkey=Gene;locus_tag=MMSYN1_0752
CP002027.1	Genbank	CDS	887085	887657	.	+	0	ID=cds675;Parent=gene751;Dbxref=NCBI_GP:ADH21806.1;Name=ADH21806.1;Note=identified by match to protein family HMM PF02661;gbkey=CDS;product=cell filamentation protein (fic);protein_id=ADH21806.1;transl_table=4
CP002027.1	Genbank	sequence_feature	887561	888640	.	+	.	ID=id939;Note=mmyc609%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	887865	888137	.	+	.	ID=gene752;Name=MMSYN1_0753;gbkey=Gene;locus_tag=MMSYN1_0753
CP002027.1	Genbank	CDS	887865	888137	.	+	0	ID=cds676;Parent=gene752;Dbxref=NCBI_GP:ADH22275.1;Name=ADH22275.1;Note=identified by match to protein family HMM PF04221%3B match to protein family HMM TIGR02384;gbkey=CDS;product=DNA-damage-inducible protein J;protein_id=ADH22275.1;transl_table=4
CP002027.1	Genbank	pseudogene	888176	889081	.	-	.	ID=gene753;Name=mmyCIIIM1;Note=GCATC--recognizing Type II restriction modification system (MmyCIII) adenine DNA methyltransferase subunit 1%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF02086%3B match to protein family HMM TIGR00571;gbkey=Gene;gene=mmyCIIIM1;locus_tag=MMSYN1_0754;pseudo=true
CP002027.1	Genbank	sequence_feature	888561	889640	.	+	.	ID=id940;Note=mmyc610%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	889074	890162	.	-	.	ID=gene754;Name=mmyCIIIM2;gbkey=Gene;gene=mmyCIIIM2;locus_tag=MMSYN1_0755
CP002027.1	Genbank	CDS	889074	890162	.	-	0	ID=cds677;Parent=gene754;Dbxref=NCBI_GP:ADH21784.1;Name=ADH21784.1;Note=identified by match to protein family HMM PF02086;gbkey=CDS;gene=mmyCIIIM2;product=GCATC--recognizing Type II restriction modification system (MmyCIII) adenine DNA methyltransferase subunit 2;protein_id=ADH21784.1;transl_table=4
CP002027.1	Genbank	sequence_feature	889561	890640	.	+	.	ID=id941;Note=mmyc611%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	890279	892318	.	+	.	ID=gene755;Name=mmyCIIIR;gbkey=Gene;gene=mmyCIIIR;locus_tag=MMSYN1_0756
CP002027.1	Genbank	CDS	890279	892318	.	+	0	ID=cds678;Parent=gene755;Dbxref=NCBI_GP:ADH21671.1;Name=ADH21671.1;Note=identified by match to protein family HMM PF09491;gbkey=CDS;gene=mmyCIIIR;product=GCATC--recognizing Type II restriction modification system (MmyCIII) endonuclease subunit;protein_id=ADH21671.1;transl_table=4
CP002027.1	Genbank	sequence_feature	890561	891640	.	+	.	ID=id942;Note=mmyc612%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=mmyCIIIR
CP002027.1	Genbank	sequence_feature	891561	892640	.	+	.	ID=id943;Note=mmyc613%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	892356	893441	.	-	.	ID=gene756;Name=MMSYN1_0757;gbkey=Gene;locus_tag=MMSYN1_0757
CP002027.1	Genbank	CDS	892356	893441	.	-	0	ID=cds679;Parent=gene756;Dbxref=NCBI_GP:ADH22044.1;Name=ADH22044.1;Note=identified by match to protein family HMM PF05913;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22044.1;transl_table=4
CP002027.1	Genbank	sequence_feature	892561	893640	.	+	.	ID=id944;Note=mmyc614%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	893443	894831	.	-	.	ID=gene757;Name=MMSYN1_0758;gbkey=Gene;locus_tag=MMSYN1_0758
CP002027.1	Genbank	CDS	893443	894831	.	-	0	ID=cds680;Parent=gene757;Dbxref=NCBI_GP:ADH21945.1;Name=ADH21945.1;Note=identified by match to protein family HMM PF00232;gbkey=CDS;product=beta-glucosidase;protein_id=ADH21945.1;transl_table=4
CP002027.1	Genbank	sequence_feature	893561	894640	.	+	.	ID=id945;Note=mmyc615%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	894561	895640	.	+	.	ID=id946;Note=mmyc616%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	894824	895702	.	-	.	ID=gene758;Name=MMSYN1_0759;gbkey=Gene;locus_tag=MMSYN1_0759
CP002027.1	Genbank	CDS	894824	895702	.	-	0	ID=cds681;Parent=gene758;Dbxref=NCBI_GP:ADH22174.1;Name=ADH22174.1;Note=identified by match to protein family HMM PF00480;gbkey=CDS;product=sugar kinase%2C ROK family;protein_id=ADH22174.1;transl_table=4
CP002027.1	Genbank	sequence_feature	895561	896640	.	+	.	ID=id947;Note=mmyc617%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	895704	896162	.	-	.	ID=gene759;Name=MMSYN1_0760;gbkey=Gene;locus_tag=MMSYN1_0760
CP002027.1	Genbank	CDS	895704	896162	.	-	0	ID=cds682;Parent=gene759;Dbxref=NCBI_GP:ADH21979.1;Name=ADH21979.1;Note=identified by match to protein family HMM PF00359%3B match to protein family HMM TIGR00848;gbkey=CDS;product=PTS system%2C fructose-specific IIA component;protein_id=ADH21979.1;transl_table=4
CP002027.1	Genbank	gene	896176	898842	.	-	.	ID=gene760;Name=MMSYN1_0761;gbkey=Gene;locus_tag=MMSYN1_0761
CP002027.1	Genbank	CDS	896176	898842	.	-	0	ID=cds683;Parent=gene760;Dbxref=NCBI_GP:ADH21705.1;Name=ADH21705.1;Note=identified by match to protein family HMM PF01074;gbkey=CDS;product=glycosyl hydrolase%2C family 38;protein_id=ADH21705.1;transl_table=4
CP002027.1	Genbank	sequence_feature	896561	897640	.	+	.	ID=id948;Note=mmyc618%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	897561	898640	.	+	.	ID=id949;Note=mmyc619%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	898561	899640	.	+	.	ID=id950;Note=mmyc620%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	898854	900695	.	-	.	ID=gene761;Name=MMSYN1_0762;gbkey=Gene;locus_tag=MMSYN1_0762
CP002027.1	Genbank	CDS	898854	900695	.	-	0	ID=cds684;Parent=gene761;Dbxref=NCBI_GP:ADH21563.1;Name=ADH21563.1;Note=identified by match to protein family HMM PF02378%3B match to protein family HMM PF02379%3B match to protein family HMM TIGR00829%3B match to protein family HMM TIGR01427;gbkey=CDS;product=PTS system%2C fructose-specific iibc component;protein_id=ADH21563.1;transl_table=4
CP002027.1	Genbank	sequence_feature	899561	900640	.	+	.	ID=id951;Note=mmyc621%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	900561	901640	.	+	.	ID=id952;Note=mmyc622%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	900710	901486	.	-	.	ID=gene762;Name=MMSYN1_0763;gbkey=Gene;locus_tag=MMSYN1_0763
CP002027.1	Genbank	CDS	900710	901486	.	-	0	ID=cds685;Parent=gene762;Dbxref=NCBI_GP:ADH22008.1;Name=ADH22008.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22008.1;transl_table=4
CP002027.1	Genbank	sequence_feature	901561	902640	.	+	.	ID=id953;Note=mmyc623%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	901652	902203	.	-	.	ID=gene763;Name=hpt_2;gbkey=Gene;gene=hpt_2;locus_tag=MMSYN1_0764
CP002027.1	Genbank	CDS	901652	902203	.	-	0	ID=cds686;Parent=gene763;Dbxref=NCBI_GP:ADH21890.1;Name=ADH21890.1;Note=identified by match to protein family HMM PF00156%3B match to protein family HMM TIGR01203;gbkey=CDS;gene=hpt_2;product=hypoxanthine phosphoribosyltransferase;protein_id=ADH21890.1;transl_table=4
CP002027.1	Genbank	gene	902239	903537	.	-	.	ID=gene764;Name=purB;gbkey=Gene;gene=purB;locus_tag=MMSYN1_0765
CP002027.1	Genbank	CDS	902239	903537	.	-	0	ID=cds687;Parent=gene764;Dbxref=NCBI_GP:ADH21751.1;Name=ADH21751.1;Note=identified by match to protein family HMM PF00206%3B match to protein family HMM TIGR00928;gbkey=CDS;gene=purB;product=adenylosuccinate lyase;protein_id=ADH21751.1;transl_table=4
CP002027.1	Genbank	sequence_feature	902561	903640	.	+	.	ID=id954;Note=mmyc624%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	903530	904828	.	-	.	ID=gene765;Name=purA;gbkey=Gene;gene=purA;locus_tag=MMSYN1_0766
CP002027.1	Genbank	CDS	903530	904828	.	-	0	ID=cds688;Parent=gene765;Dbxref=NCBI_GP:ADH22082.1;Name=ADH22082.1;Note=identified by match to protein family HMM PF00709%3B match to protein family HMM TIGR00184;gbkey=CDS;gene=purA;product=adenylosuccinate synthase;protein_id=ADH22082.1;transl_table=4
CP002027.1	Genbank	sequence_feature	903561	904640	.	+	.	ID=id955;Note=mmyc625%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	904561	905640	.	+	.	ID=id956;Note=mmyc626%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	905049	905201	.	-	.	ID=gene766;Name=MMSYN1_0767;gbkey=Gene;locus_tag=MMSYN1_0767
CP002027.1	Genbank	CDS	905049	905201	.	-	0	ID=cds689;Parent=gene766;Dbxref=NCBI_GP:ADH21470.1;Name=ADH21470.1;gbkey=CDS;product=ribonucleoside-diphosphate reductase subunit alpha (Ribonucleotide reductase);protein_id=ADH21470.1;transl_table=4
CP002027.1	Genbank	gene	905182	905697	.	-	.	ID=gene767;Name=mmyCIVR;gbkey=Gene;gene=mmyCIVR;locus_tag=MMSYN1_0768
CP002027.1	Genbank	CDS	905182	905697	.	-	0	ID=cds690;Parent=gene767;Dbxref=NCBI_GP:ADH21631.1;Name=ADH21631.1;gbkey=CDS;gene=mmyCIVR;product=GANTC--recognizing Type II restriction modification system (MmyCIV) endonuclease subunit;protein_id=ADH21631.1;transl_table=4
CP002027.1	Genbank	sequence_feature	905561	906640	.	+	.	ID=id957;Note=mmyc627%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	905859	906578	.	-	.	ID=gene768;Name=mmyCIVM;gbkey=Gene;gene=mmyCIVM;locus_tag=MMSYN1_0769
CP002027.1	Genbank	CDS	905859	906578	.	-	0	ID=cds691;Parent=gene768;Dbxref=NCBI_GP:ADH21822.1;Name=ADH21822.1;Note=identified by match to protein family HMM PF01555;gbkey=CDS;gene=mmyCIVM;product=GANTC--recognizing Type II restriction modification system (MmyCIV) adenine DNA methylase subunit;protein_id=ADH21822.1;transl_table=4
CP002027.1	Genbank	sequence_feature	906561	907640	.	+	.	ID=id958;Note=mmyc628%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	906639	907484	.	-	.	ID=gene769;Name=MMSYN1_0770;gbkey=Gene;locus_tag=MMSYN1_0770
CP002027.1	Genbank	CDS	906639	907484	.	-	0	ID=cds692;Parent=gene769;Dbxref=NCBI_GP:ADH21937.1;Name=ADH21937.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21937.1;transl_table=4
CP002027.1	Genbank	sequence_feature	907561	908640	.	+	.	ID=id959;Note=mmyc629%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	907590	909752	.	-	.	ID=gene770;Name=nrdE;gbkey=Gene;gene=nrdE;locus_tag=MMSYN1_0771
CP002027.1	Genbank	CDS	907590	909752	.	-	0	ID=cds693;Parent=gene770;Dbxref=NCBI_GP:ADH22105.1;Name=ADH22105.1;Note=identified by match to protein family HMM PF00317%3B match to protein family HMM PF02867%3B match to protein family HMM PF08343%3B match to protein family HMM TIGR02506;gbkey=CDS;gene=nrdE;product=ribonucleoside-diphosphate reductase%2C alpha subunit;protein_id=ADH22105.1;transl_table=4
CP002027.1	Genbank	sequence_feature	908561	909640	.	+	.	ID=id960;Note=mmyc630%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	909561	910640	.	+	.	ID=id961;Note=mmyc631%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	909739	910212	.	-	.	ID=gene771;Name=nrdI;gbkey=Gene;gene=nrdI;locus_tag=MMSYN1_0772
CP002027.1	Genbank	CDS	909739	910212	.	-	0	ID=cds694;Parent=gene771;Dbxref=NCBI_GP:ADH21587.1;Name=ADH21587.1;Note=identified by match to protein family HMM PF07972%3B match to protein family HMM TIGR00333;gbkey=CDS;gene=nrdI;product=NrdI protein;protein_id=ADH21587.1;transl_table=4
CP002027.1	Genbank	gene	910221	911240	.	-	.	ID=gene772;Name=nrdF;gbkey=Gene;gene=nrdF;locus_tag=MMSYN1_0773
CP002027.1	Genbank	CDS	910221	911240	.	-	0	ID=cds695;Parent=gene772;Dbxref=NCBI_GP:ADH21505.1;Name=ADH21505.1;Note=identified by match to protein family HMM PF00268;gbkey=CDS;gene=nrdF;product=ribonucleoside-diphosphate reductase%2C beta subunit;protein_id=ADH21505.1;transl_table=4
CP002027.1	Genbank	sequence_feature	910561	911640	.	+	.	ID=id962;Note=mmyc632f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	911539	911823	.	+	.	ID=gene773;Name=secG;gbkey=Gene;gene=secG;locus_tag=MMSYN1_0774
CP002027.1	Genbank	CDS	911539	911823	.	+	0	ID=cds696;Parent=gene773;Dbxref=NCBI_GP:ADH21503.1;Name=ADH21503.1;Note=identified by match to protein family HMM TIGR00810;gbkey=CDS;gene=secG;product=preprotein translocase%2C SecG subunit;protein_id=ADH21503.1;transl_table=4
CP002027.1	Genbank	sequence_feature	911561	912640	.	+	.	ID=id963;Note=mmyc633%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	911859	913973	.	+	.	ID=gene774;Name=MMSYN1_0775;gbkey=Gene;locus_tag=MMSYN1_0775
CP002027.1	Genbank	CDS	911859	913973	.	+	0	ID=cds697;Parent=gene774;Dbxref=NCBI_GP:ADH21586.1;Name=ADH21586.1;Note=identified by match to protein family HMM PF00575%3B match to protein family HMM PF00773%3B match to protein family HMM PF08206%3B match to protein family HMM TIGR00358;gbkey=CDS;product=3'-5' exoribonuclease%2C VacB/RNase II family;protein_id=ADH21586.1;transl_table=4
CP002027.1	Genbank	sequence_feature	912561	913640	.	+	.	ID=id964;Note=mmyc634%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	913561	914640	.	+	.	ID=id965;Note=mmyc635%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	913983	914429	.	+	.	ID=gene775;Name=smpB;gbkey=Gene;gene=smpB;locus_tag=MMSYN1_0776
CP002027.1	Genbank	CDS	913983	914429	.	+	0	ID=cds698;Parent=gene775;Dbxref=NCBI_GP:ADH22110.1;Name=ADH22110.1;Note=identified by match to protein family HMM PF01668%3B match to protein family HMM TIGR00086;gbkey=CDS;gene=smpB;product=SsrA-binding protein;protein_id=ADH22110.1;transl_table=4
CP002027.1	Genbank	gene	914429	914914	.	+	.	ID=gene776;Name=MMSYN1_0777;gbkey=Gene;locus_tag=MMSYN1_0777
CP002027.1	Genbank	CDS	914429	914914	.	+	0	ID=cds699;Parent=gene776;Dbxref=NCBI_GP:ADH22251.1;Name=ADH22251.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22251.1;transl_table=4
CP002027.1	Genbank	sequence_feature	914561	915640	.	+	.	ID=id966;Note=mmyc636%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	915034	915285	.	+	.	ID=gene777;Name=MMSYN1_0778;gbkey=Gene;locus_tag=MMSYN1_0778
CP002027.1	Genbank	CDS	915034	915285	.	+	0	ID=cds700;Parent=gene777;Dbxref=NCBI_GP:ADH22059.1;Name=ADH22059.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22059.1;transl_table=4
CP002027.1	Genbank	gene	915336	917573	.	+	.	ID=gene778;Name=MMSYN1_0779;gbkey=Gene;locus_tag=MMSYN1_0779
CP002027.1	Genbank	CDS	915336	917573	.	+	0	ID=cds701;Parent=gene778;Dbxref=NCBI_GP:ADH21715.1;Name=ADH21715.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378%3B match to protein family HMM TIGR00826;gbkey=CDS;product=PTS system%2C eiic domain protein;protein_id=ADH21715.1;transl_table=4
CP002027.1	Genbank	sequence_feature	915561	916640	.	+	.	ID=id967;Note=mmyc637%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	916561	917640	.	+	.	ID=id968;Note=mmyc638%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	917561	918640	.	+	.	ID=id969;Note=mmyc639%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	917651	918193	.	+	.	ID=gene779;Name=tnpA_5;gbkey=Gene;gene=tnpA_5;locus_tag=MMSYN1_0780
CP002027.1	Genbank	CDS	917651	918193	.	+	0	ID=cds702;Parent=gene779;Dbxref=NCBI_GP:ADH21856.1;Name=ADH21856.1;gbkey=CDS;gene=tnpA_5;product=IS1296 transposase protein A;protein_id=ADH21856.1;transl_table=4
CP002027.1	Genbank	gene	918331	919062	.	+	.	ID=gene780;Name=tnpB_5;gbkey=Gene;gene=tnpB_5;locus_tag=MMSYN1_0781
CP002027.1	Genbank	CDS	918331	919062	.	+	0	ID=cds703;Parent=gene780;Dbxref=NCBI_GP:ADH21771.1;Name=ADH21771.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_5;product=IS1296 transposase protein B;protein_id=ADH21771.1;transl_table=4
CP002027.1	Genbank	sequence_feature	918561	919640	.	+	.	ID=id970;Note=mmyc640%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	919157	920284	.	+	.	ID=gene781;Name=MMSYN1_0782;Note=beta-lactamase%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF00144;gbkey=Gene;locus_tag=MMSYN1_0782;pseudo=true
CP002027.1	Genbank	sequence_feature	919561	920640	.	+	.	ID=id971;Note=mmyc641%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	920380	921345	.	+	.	ID=gene782;Name=MMSYN1_0783;gbkey=Gene;locus_tag=MMSYN1_0783
CP002027.1	Genbank	CDS	920380	921345	.	+	0	ID=cds704;Parent=gene782;Dbxref=NCBI_GP:ADH21533.1;Name=ADH21533.1;Note=identified by match to protein family HMM PF00480;gbkey=CDS;product=glucokinase;protein_id=ADH21533.1;transl_table=4
CP002027.1	Genbank	sequence_feature	920561	921640	.	+	.	ID=id972;Note=mmyc642f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	921413	922345	.	-	.	ID=gene783;Name=arcC_2;gbkey=Gene;gene=arcC_2;locus_tag=MMSYN1_0784
CP002027.1	Genbank	CDS	921413	922345	.	-	0	ID=cds705;Parent=gene783;Dbxref=NCBI_GP:ADH22122.1;Name=ADH22122.1;Note=identified by match to protein family HMM PF00696;gbkey=CDS;gene=arcC_2;product=carbamate kinase 1;protein_id=ADH22122.1;transl_table=4
CP002027.1	Genbank	sequence_feature	921561	922640	.	+	.	ID=id973;Note=mmyc643%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	922358	923821	.	-	.	ID=gene784;Name=MMSYN1_0785;gbkey=Gene;locus_tag=MMSYN1_0785
CP002027.1	Genbank	CDS	922358	923821	.	-	0	ID=cds706;Parent=gene784;Dbxref=NCBI_GP:ADH21618.1;Name=ADH21618.1;Note=identified by match to protein family HMM PF03606%3B match to protein family HMM PF06808;gbkey=CDS;product=arginine/ornithine antiporter;protein_id=ADH21618.1;transl_table=4
CP002027.1	Genbank	sequence_feature	922561	923640	.	+	.	ID=id974;Note=mmyc644%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	923561	924640	.	+	.	ID=id975;Note=mmyc645%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	923900	924895	.	-	.	ID=gene785;Name=arcB;gbkey=Gene;gene=arcB;locus_tag=MMSYN1_0786
CP002027.1	Genbank	CDS	923900	924895	.	-	0	ID=cds707;Parent=gene785;Dbxref=NCBI_GP:ADH22213.1;Name=ADH22213.1;Note=identified by match to protein family HMM PF00185%3B match to protein family HMM PF02729%3B match to protein family HMM TIGR00658;gbkey=CDS;gene=arcB;product=ornithine carbamoyltransferase (ArcB);protein_id=ADH22213.1;transl_table=4
CP002027.1	Genbank	sequence_feature	924561	925640	.	+	.	ID=id976;Note=mmyc646%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	925156	927984	.	-	.	ID=gene786;Name=mgtA;gbkey=Gene;gene=mgtA;locus_tag=MMSYN1_0787
CP002027.1	Genbank	CDS	925156	927984	.	-	0	ID=cds708;Parent=gene786;Dbxref=NCBI_GP:ADH22141.1;Name=ADH22141.1;Note=identified by match to protein family HMM PF00122%3B match to protein family HMM PF00690%3B match to protein family HMM PF00702%3B match to protein family HMM TIGR01494%3B match to protein family HMM TIGR01524;gbkey=CDS;gene=mgtA;product=magnesium-importing ATPase;protein_id=ADH22141.1;transl_table=4
CP002027.1	Genbank	sequence_feature	925561	926640	.	+	.	ID=id977;Note=mmyc647%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	926561	927640	.	+	.	ID=id978;Note=mmyc648%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	927561	928640	.	+	.	ID=id979;Note=mmyc649%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	928331	929518	.	+	.	ID=gene787;Name=MMSYN1_0788;gbkey=Gene;locus_tag=MMSYN1_0788
CP002027.1	Genbank	CDS	928331	929518	.	+	0	ID=cds709;Parent=gene787;Dbxref=NCBI_GP:ADH22041.1;Name=ADH22041.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22041.1;transl_table=4
CP002027.1	Genbank	sequence_feature	928561	929640	.	+	.	ID=id980;Note=mmyc650%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	929561	930640	.	+	.	ID=id981;Note=mmyc651%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	929590	929889	.	-	.	ID=gene788;Name=atpC;gbkey=Gene;gene=atpC;locus_tag=MMSYN1_0789
CP002027.1	Genbank	CDS	929590	929889	.	-	0	ID=cds710;Parent=gene788;Dbxref=NCBI_GP:ADH21923.1;Name=ADH21923.1;Note=identified by match to protein family HMM PF02823;gbkey=CDS;gene=atpC;product=ATP synthase%2C delta subunit;protein_id=ADH21923.1;transl_table=4
CP002027.1	Genbank	gene	929889	931316	.	-	.	ID=gene789;Name=atpD_2;gbkey=Gene;gene=atpD_2;locus_tag=MMSYN1_0790
CP002027.1	Genbank	CDS	929889	931316	.	-	0	ID=cds711;Parent=gene789;Dbxref=NCBI_GP:ADH21741.1;Name=ADH21741.1;Note=identified by match to protein family HMM PF00006%3B match to protein family HMM PF00306%3B match to protein family HMM PF02874%3B match to protein family HMM TIGR01039;gbkey=CDS;gene=atpD_2;product=ATP synthase F1%2C beta subunit;protein_id=ADH21741.1;transl_table=4
CP002027.1	Genbank	sequence_feature	930561	931640	.	+	.	ID=id982;Note=mmyc652%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	931325	932167	.	-	.	ID=gene790;Name=atpG;gbkey=Gene;gene=atpG;locus_tag=MMSYN1_0791
CP002027.1	Genbank	CDS	931325	932167	.	-	0	ID=cds712;Parent=gene790;Dbxref=NCBI_GP:ADH21790.1;Name=ADH21790.1;Note=identified by match to protein family HMM PF00231%3B match to protein family HMM TIGR01146;gbkey=CDS;gene=atpG;product=ATP synthase F1%2C gamma subunit;protein_id=ADH21790.1;transl_table=4
CP002027.1	Genbank	sequence_feature	931561	932640	.	+	.	ID=id983;Note=mmyc653%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	932169	933746	.	-	.	ID=gene791;Name=atpA;gbkey=Gene;gene=atpA;locus_tag=MMSYN1_0792
CP002027.1	Genbank	CDS	932169	933746	.	-	0	ID=cds713;Parent=gene791;Dbxref=NCBI_GP:ADH21457.1;Name=ADH21457.1;Note=identified by match to protein family HMM PF00006%3B match to protein family HMM PF00306%3B match to protein family HMM PF02874%3B match to protein family HMM PF09378%3B match to protein family HMM TIGR00962;gbkey=CDS;gene=atpA;product=ATP synthase F1%2C alpha subunit;protein_id=ADH21457.1;transl_table=4
CP002027.1	Genbank	sequence_feature	932561	933640	.	+	.	ID=id984;Note=mmyc654%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	933561	934640	.	+	.	ID=id985;Note=mmyc655%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	933758	934303	.	-	.	ID=gene792;Name=atpH;gbkey=Gene;gene=atpH;locus_tag=MMSYN1_0793
CP002027.1	Genbank	CDS	933758	934303	.	-	0	ID=cds714;Parent=gene792;Dbxref=NCBI_GP:ADH21559.1;Name=ADH21559.1;Note=identified by match to protein family HMM PF00213%3B match to protein family HMM TIGR01145;gbkey=CDS;gene=atpH;product=ATP synthase F1%2C delta subunit;protein_id=ADH21559.1;transl_table=4
CP002027.1	Genbank	gene	934305	934850	.	-	.	ID=gene793;Name=atpF;gbkey=Gene;gene=atpF;locus_tag=MMSYN1_0794
CP002027.1	Genbank	CDS	934305	934850	.	-	0	ID=cds715;Parent=gene793;Dbxref=NCBI_GP:ADH21886.1;Name=ADH21886.1;Note=identified by match to protein family HMM PF00430%3B match to protein family HMM TIGR01144;gbkey=CDS;gene=atpF;product=ATP synthase F0%2C B subunit;protein_id=ADH21886.1;transl_table=4
CP002027.1	Genbank	sequence_feature	934561	935640	.	+	.	ID=id986;Note=mmyc656%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	934879	935184	.	-	.	ID=gene794;Name=atpE;gbkey=Gene;gene=atpE;locus_tag=MMSYN1_0795
CP002027.1	Genbank	CDS	934879	935184	.	-	0	ID=cds716;Parent=gene794;Dbxref=NCBI_GP:ADH21919.1;Name=ADH21919.1;Note=identified by match to protein family HMM PF00137%3B match to protein family HMM TIGR01260;gbkey=CDS;gene=atpE;product=ATP synthase c chain;protein_id=ADH21919.1;transl_table=4
CP002027.1	Genbank	gene	935214	936077	.	-	.	ID=gene795;Name=atpB;gbkey=Gene;gene=atpB;locus_tag=MMSYN1_0796
CP002027.1	Genbank	CDS	935214	936077	.	-	0	ID=cds717;Parent=gene795;Dbxref=NCBI_GP:ADH21731.1;Name=ADH21731.1;Note=identified by match to protein family HMM PF00119;gbkey=CDS;gene=atpB;product=ATP synthase FO%2C A subunit;protein_id=ADH21731.1;transl_table=4
CP002027.1	Genbank	sequence_feature	935561	936640	.	+	.	ID=id987;Note=mmyc657%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	936077	936313	.	-	.	ID=gene796;Name=MMSYN1_0797;gbkey=Gene;locus_tag=MMSYN1_0797
CP002027.1	Genbank	CDS	936077	936313	.	-	0	ID=cds718;Parent=gene796;Dbxref=NCBI_GP:ADH21680.1;Name=ADH21680.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21680.1;transl_table=4
CP002027.1	Genbank	sequence_feature	936561	937640	.	+	.	ID=id988;Note=mmyc658%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	936615	937238	.	-	.	ID=gene797;Name=upp;gbkey=Gene;gene=upp;locus_tag=MMSYN1_0798
CP002027.1	Genbank	CDS	936615	937238	.	-	0	ID=cds719;Parent=gene797;Dbxref=NCBI_GP:ADH21459.1;Name=ADH21459.1;Note=identified by match to protein family HMM PF00156%3B match to protein family HMM TIGR01091;gbkey=CDS;gene=upp;product=uracil phosphoribosyltransferase;protein_id=ADH21459.1;transl_table=4
CP002027.1	Genbank	gene	937338	938579	.	-	.	ID=gene798;Name=glyA;gbkey=Gene;gene=glyA;locus_tag=MMSYN1_0799
CP002027.1	Genbank	CDS	937338	938579	.	-	0	ID=cds720;Parent=gene798;Dbxref=NCBI_GP:ADH21726.1;Name=ADH21726.1;Note=identified by match to protein family HMM PF00464;gbkey=CDS;gene=glyA;product=glycine hydroxymethyltransferase;protein_id=ADH21726.1;transl_table=4
CP002027.1	Genbank	sequence_feature	937561	938640	.	+	.	ID=id989;Note=mmyc659%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	938561	939640	.	+	.	ID=id990;Note=mmyc660%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	938563	939006	.	-	.	ID=gene799;Name=rpiB;gbkey=Gene;gene=rpiB;locus_tag=MMSYN1_0800
CP002027.1	Genbank	CDS	938563	939006	.	-	0	ID=cds721;Parent=gene799;Dbxref=NCBI_GP:ADH22048.1;Name=ADH22048.1;Note=identified by match to protein family HMM PF02502%3B match to protein family HMM TIGR00689%3B match to protein family HMM TIGR01120;gbkey=CDS;gene=rpiB;product=ribose 5-phosphate isomerase B;protein_id=ADH22048.1;transl_table=4
CP002027.1	Genbank	gene	939085	939381	.	+	.	ID=gene800;Name=MMSYN1_0801;gbkey=Gene;locus_tag=MMSYN1_0801
CP002027.1	Genbank	CDS	939085	939381	.	+	0	ID=cds722;Parent=gene800;Dbxref=NCBI_GP:ADH21799.1;Name=ADH21799.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21799.1;transl_table=4
CP002027.1	Genbank	gene	939386	941581	.	-	.	ID=gene801;Name=MMSYN1_0802;gbkey=Gene;locus_tag=MMSYN1_0802
CP002027.1	Genbank	CDS	939386	941581	.	-	0	ID=cds723;Parent=gene801;Dbxref=NCBI_GP:ADH22265.1;Name=ADH22265.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22265.1;transl_table=4
CP002027.1	Genbank	sequence_feature	939561	940640	.	+	.	ID=id991;Note=mmyc661%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	940561	941640	.	+	.	ID=id992;Note=mmyc662%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	941561	942640	.	+	.	ID=id993;Note=mmyc663%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	941671	945438	.	-	.	ID=gene802;Name=rpoC;gbkey=Gene;gene=rpoC;locus_tag=MMSYN1_0803
CP002027.1	Genbank	CDS	941671	945438	.	-	0	ID=cds724;Parent=gene802;Dbxref=NCBI_GP:ADH22166.1;Name=ADH22166.1;Note=identified by match to protein family HMM PF00623%3B match to protein family HMM PF04983%3B match to protein family HMM PF04997%3B match to protein family HMM PF04998%3B match to protein family HMM PF05000%3B match to protein family HMM TIGR02386;gbkey=CDS;gene=rpoC;product=DNA-directed RNA polymerase%2C beta' subunit;protein_id=ADH22166.1;transl_table=4
CP002027.1	Genbank	sequence_feature	942561	943640	.	+	.	ID=id994;Note=mmyc664%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	943561	944640	.	+	.	ID=id995;Note=mmyc665%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	944561	945640	.	+	.	ID=id996;Note=mmyc666%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	945450	949325	.	-	.	ID=gene803;Name=rpoB;gbkey=Gene;gene=rpoB;locus_tag=MMSYN1_0804
CP002027.1	Genbank	CDS	945450	949325	.	-	0	ID=cds725;Parent=gene803;Dbxref=NCBI_GP:ADH21582.1;Name=ADH21582.1;Note=identified by match to protein family HMM PF00562%3B match to protein family HMM PF04560%3B match to protein family HMM PF04561%3B match to protein family HMM PF04563%3B match to protein family HMM PF04565%3B match to protein family HMM TIGR02013;gbkey=CDS;gene=rpoB;product=DNA-directed RNA polymerase%2C beta subunit;protein_id=ADH21582.1;transl_table=4
CP002027.1	Genbank	sequence_feature	945561	946640	.	+	.	ID=id997;Note=mmyc667%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	946561	947640	.	+	.	ID=id998;Note=mmyc668%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	947561	948640	.	+	.	ID=id999;Note=mmyc669%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	948561	949640	.	+	.	ID=id1000;Note=mmyc670%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	949315	950490	.	-	.	ID=gene804;Name=MMSYN1_0805;gbkey=Gene;locus_tag=MMSYN1_0805
CP002027.1	Genbank	CDS	949315	950490	.	-	0	ID=cds726;Parent=gene804;Dbxref=NCBI_GP:ADH21473.1;Name=ADH21473.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21473.1;transl_table=4
CP002027.1	Genbank	sequence_feature	949561	950640	.	+	.	ID=id1001;Note=mmyc671%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	950561	951640	.	+	.	ID=id1002;Note=mmyc672%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	950661	951029	.	-	.	ID=gene805;Name=rplL;gbkey=Gene;gene=rplL;locus_tag=MMSYN1_0806
CP002027.1	Genbank	CDS	950661	951029	.	-	0	ID=cds727;Parent=gene805;Dbxref=NCBI_GP:ADH21625.1;Name=ADH21625.1;Note=identified by match to protein family HMM PF00542%3B match to protein family HMM TIGR00855;gbkey=CDS;gene=rplL;product=ribosomal protein L7/L12;protein_id=ADH21625.1;transl_table=4
CP002027.1	Genbank	gene	951098	951595	.	-	.	ID=gene806;Name=rplJ;gbkey=Gene;gene=rplJ;locus_tag=MMSYN1_0807
CP002027.1	Genbank	CDS	951098	951595	.	-	0	ID=cds728;Parent=gene806;Dbxref=NCBI_GP:ADH21517.1;Name=ADH21517.1;Note=identified by match to protein family HMM PF00466;gbkey=CDS;gene=rplJ;product=50S ribosomal protein L10;protein_id=ADH21517.1;transl_table=4
CP002027.1	Genbank	sequence_feature	951561	952640	.	+	.	ID=id1003;Note=mmyc673%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	951613	951749	.	-	.	ID=id1004;Note=Ribosomal protein L10 leader;gbkey=misc_feature
CP002027.1	Genbank	gene	951822	952502	.	-	.	ID=gene807;Name=rplA;gbkey=Gene;gene=rplA;locus_tag=MMSYN1_0809
CP002027.1	Genbank	CDS	951822	952502	.	-	0	ID=cds729;Parent=gene807;Dbxref=NCBI_GP:ADH21824.1;Name=ADH21824.1;Note=identified by match to protein family HMM PF00687%3B match to protein family HMM TIGR01169;gbkey=CDS;gene=rplA;product=ribosomal protein L1;protein_id=ADH21824.1;transl_table=4
CP002027.1	Genbank	gene	952502	952930	.	-	.	ID=gene808;Name=rplK;gbkey=Gene;gene=rplK;locus_tag=MMSYN1_0810
CP002027.1	Genbank	CDS	952502	952930	.	-	0	ID=cds730;Parent=gene808;Dbxref=NCBI_GP:ADH21717.1;Name=ADH21717.1;Note=identified by match to protein family HMM PF00298%3B match to protein family HMM PF03946%3B match to protein family HMM TIGR01632;gbkey=CDS;gene=rplK;product=ribosomal protein L11;protein_id=ADH21717.1;transl_table=4
CP002027.1	Genbank	sequence_feature	952561	953640	.	+	.	ID=id1005;Note=mmyc674%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	953142	954020	.	-	.	ID=gene809;Name=galU;gbkey=Gene;gene=galU;locus_tag=MMSYN1_0811
CP002027.1	Genbank	CDS	953142	954020	.	-	0	ID=cds731;Parent=gene809;Dbxref=NCBI_GP:ADH21733.1;Name=ADH21733.1;Note=identified by match to protein family HMM PF00483;gbkey=CDS;gene=galU;product=UTP-glucose-1-phosphate uridylyltransferase;protein_id=ADH21733.1;transl_table=4
CP002027.1	Genbank	sequence_feature	953561	954640	.	+	.	ID=id1006;Note=mmyc675%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	954550	955926	.	-	.	ID=gene810;Name=MMSYN1_0812;gbkey=Gene;locus_tag=MMSYN1_0812
CP002027.1	Genbank	CDS	954550	955926	.	-	0	ID=cds732;Parent=gene810;Dbxref=NCBI_GP:ADH21603.1;Name=ADH21603.1;Note=identified by match to protein family HMM PF00535;gbkey=CDS;product=glycosyltransferase;protein_id=ADH21603.1;transl_table=4
CP002027.1	Genbank	sequence_feature	954561	955640	.	+	.	ID=id1007;Note=mmyc676%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	955561	956640	.	+	.	ID=id1008;Note=mmyc677%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	956226	957224	.	+	.	ID=gene811;Name=galE;gbkey=Gene;gene=galE;locus_tag=MMSYN1_0813
CP002027.1	Genbank	CDS	956226	957224	.	+	0	ID=cds733;Parent=gene811;Dbxref=NCBI_GP:ADH21520.1;Name=ADH21520.1;Note=identified by match to protein family HMM PF01073%3B match to protein family HMM PF01370%3B match to protein family HMM PF07993%3B match to protein family HMM TIGR01179;gbkey=CDS;gene=galE;product=UDP-glucose 4-epimerase;protein_id=ADH21520.1;transl_table=4
CP002027.1	Genbank	sequence_feature	956561	957640	.	+	.	ID=id1009;Note=mmyc678%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	957238	958425	.	+	.	ID=gene812;Name=glf;gbkey=Gene;gene=glf;locus_tag=MMSYN1_0814
CP002027.1	Genbank	CDS	957238	958425	.	+	0	ID=cds734;Parent=gene812;Dbxref=NCBI_GP:ADH22268.1;Name=ADH22268.1;Note=identified by match to protein family HMM PF03275%3B match to protein family HMM TIGR00031;gbkey=CDS;gene=glf;product=UDP-galactopyranose mutase;protein_id=ADH22268.1;transl_table=4
CP002027.1	Genbank	sequence_feature	957561	958640	.	+	.	ID=id1010;Note=mmyc679%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	958511	958648	.	+	.	ID=gene813;Name=MMSYN1_0815;gbkey=Gene;locus_tag=MMSYN1_0815
CP002027.1	Genbank	CDS	958511	958648	.	+	0	ID=cds735;Parent=gene813;Dbxref=NCBI_GP:ADH22132.1;Name=ADH22132.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22132.1;transl_table=4
CP002027.1	Genbank	sequence_feature	958561	959766	.	+	.	ID=id1011;Note=mmycWM4%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	958936	959442	.	-	.	ID=gene814;Name=MMSYN1_0928;gbkey=Gene;locus_tag=MMSYN1_0928
CP002027.1	Genbank	CDS	958936	959442	.	-	0	ID=cds736;Parent=gene814;Dbxref=NCBI_GP:ADH22042.1;Name=ADH22042.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22042.1;transl_table=4
CP002027.1	Genbank	gene	959417	959686	.	+	.	ID=gene815;Name=MMSYN1_0929;gbkey=Gene;locus_tag=MMSYN1_0929
CP002027.1	Genbank	CDS	959417	959686	.	+	0	ID=cds737;Parent=gene815;Dbxref=NCBI_GP:ADH21794.1;Name=ADH21794.1;gbkey=CDS;product=conserved domain protein;protein_id=ADH21794.1;transl_table=4
CP002027.1	Genbank	sequence_feature	959687	960766	.	+	.	ID=id1012;Note=mmyc681%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	959695	960048	.	+	.	ID=gene816;Name=MMSYN1_0816;gbkey=Gene;locus_tag=MMSYN1_0816
CP002027.1	Genbank	CDS	959695	960048	.	+	0	ID=cds738;Parent=gene816;Dbxref=NCBI_GP:ADH21763.1;Name=ADH21763.1;gbkey=CDS;product=integrase core domain protein;protein_id=ADH21763.1;transl_table=4
CP002027.1	Genbank	gene	960185	961114	.	-	.	ID=gene817;Name=MMSYN1_0817;gbkey=Gene;locus_tag=MMSYN1_0817
CP002027.1	Genbank	CDS	960185	961114	.	-	0	ID=cds739;Parent=gene817;Dbxref=NCBI_GP:ADH21645.1;Name=ADH21645.1;Note=identified by match to protein family HMM PF02650%3B match to protein family HMM TIGR00647;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21645.1;transl_table=4
CP002027.1	Genbank	sequence_feature	960687	961766	.	+	.	ID=id1013;Note=mmyc682%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	961127	962557	.	-	.	ID=gene818;Name=MMSYN1_0818;gbkey=Gene;locus_tag=MMSYN1_0818
CP002027.1	Genbank	CDS	961127	962557	.	-	0	ID=cds740;Parent=gene818;Dbxref=NCBI_GP:ADH22152.1;Name=ADH22152.1;Note=identified by match to protein family HMM PF01790;gbkey=CDS;product=prolipoprotein diacylglyceryl transferase;protein_id=ADH22152.1;transl_table=4
CP002027.1	Genbank	sequence_feature	961687	962766	.	+	.	ID=id1014;Note=mmyc683%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	962566	963498	.	-	.	ID=gene819;Name=trxB;gbkey=Gene;gene=trxB;locus_tag=MMSYN1_0819
CP002027.1	Genbank	CDS	962566	963498	.	-	0	ID=cds741;Parent=gene819;Dbxref=NCBI_GP:ADH21662.1;Name=ADH21662.1;Note=identified by match to protein family HMM PF00070%3B match to protein family HMM PF01134%3B match to protein family HMM PF03486%3B match to protein family HMM PF07992%3B match to protein family HMM TIGR01292;gbkey=CDS;gene=trxB;product=thioredoxin-disulfide reductase;protein_id=ADH21662.1;transl_table=4
CP002027.1	Genbank	sequence_feature	962687	963766	.	+	.	ID=id1015;Note=mmyc684%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	963482	965062	.	-	.	ID=gene820;Name=MMSYN1_0820;gbkey=Gene;locus_tag=MMSYN1_0820
CP002027.1	Genbank	CDS	963482	965062	.	-	0	ID=cds742;Parent=gene820;Dbxref=NCBI_GP:ADH21964.1;Name=ADH21964.1;Note=identified by match to protein family HMM PF01790;gbkey=CDS;product=prolipoprotein diacylglyceryl transferase;protein_id=ADH21964.1;transl_table=4
CP002027.1	Genbank	sequence_feature	963687	964766	.	+	.	ID=id1016;Note=mmyc685%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	964687	965766	.	+	.	ID=id1017;Note=mmyc686%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	965073	966014	.	-	.	ID=gene821;Name=hprK;gbkey=Gene;gene=hprK;locus_tag=MMSYN1_0821
CP002027.1	Genbank	CDS	965073	966014	.	-	0	ID=cds743;Parent=gene821;Dbxref=NCBI_GP:ADH22233.1;Name=ADH22233.1;Note=identified by match to protein family HMM PF02603%3B match to protein family HMM PF07475;gbkey=CDS;gene=hprK;product=HPr kinase/phosphorylase (HPrK/P) (HPr(Ser)kinase/phosphorylase);protein_id=ADH22233.1;transl_table=4
CP002027.1	Genbank	sequence_feature	965687	966766	.	+	.	ID=id1018;Note=mmyc687%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	966098	966772	.	-	.	ID=gene822;Name=MMSYN1_0822;gbkey=Gene;locus_tag=MMSYN1_0822
CP002027.1	Genbank	CDS	966098	966772	.	-	0	ID=cds744;Parent=gene822;Dbxref=NCBI_GP:ADH22089.1;Name=ADH22089.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22089.1;transl_table=4
CP002027.1	Genbank	sequence_feature	966687	967766	.	+	.	ID=id1019;Note=mmyc688%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	966789	967904	.	-	.	ID=gene823;Name=folC;gbkey=Gene;gene=folC;locus_tag=MMSYN1_0823
CP002027.1	Genbank	CDS	966789	967904	.	-	0	ID=cds745;Parent=gene823;Dbxref=NCBI_GP:ADH21647.1;Name=ADH21647.1;Note=identified by match to protein family HMM PF08245%3B match to protein family HMM TIGR01499;gbkey=CDS;gene=folC;product=folate synthetase-polyglutamyl folate synthetase;protein_id=ADH21647.1;transl_table=4
CP002027.1	Genbank	sequence_feature	967687	968766	.	+	.	ID=id1020;Note=mmyc689%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	967897	970737	.	-	.	ID=gene824;Name=uvrA;gbkey=Gene;gene=uvrA;locus_tag=MMSYN1_0824
CP002027.1	Genbank	CDS	967897	970737	.	-	0	ID=cds746;Parent=gene824;Dbxref=NCBI_GP:ADH21541.1;Name=ADH21541.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM TIGR00630;gbkey=CDS;gene=uvrA;product=excinuclease ABC subunit A;protein_id=ADH21541.1;transl_table=4
CP002027.1	Genbank	sequence_feature	968687	969766	.	+	.	ID=id1021;Note=mmyc690%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	969687	970766	.	+	.	ID=id1022;Note=mmyc691%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	970687	971766	.	+	.	ID=id1023;Note=mmyc692%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	970746	972743	.	-	.	ID=gene825;Name=uvrB;gbkey=Gene;gene=uvrB;locus_tag=MMSYN1_0825
CP002027.1	Genbank	CDS	970746	972743	.	-	0	ID=cds747;Parent=gene825;Dbxref=NCBI_GP:ADH21778.1;Name=ADH21778.1;Note=identified by match to protein family HMM PF00271%3B match to protein family HMM PF02151%3B match to protein family HMM TIGR00631;gbkey=CDS;gene=uvrB;product=excinuclease ABC subunit B;protein_id=ADH21778.1;transl_table=4
CP002027.1	Genbank	sequence_feature	971687	972766	.	+	.	ID=id1024;Note=mmyc693%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	972687	973766	.	+	.	ID=id1025;Note=mmyc694%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	973028	973978	.	+	.	ID=gene826;Name=holA;gbkey=Gene;gene=holA;locus_tag=MMSYN1_0826
CP002027.1	Genbank	CDS	973028	973978	.	+	0	ID=cds748;Parent=gene826;Dbxref=NCBI_GP:ADH21650.1;Name=ADH21650.1;Note=identified by match to protein family HMM PF06144%3B match to protein family HMM TIGR01128;gbkey=CDS;gene=holA;product=DNA polymerase III%2C delta subunit;protein_id=ADH21650.1;transl_table=4
CP002027.1	Genbank	sequence_feature	973687	974766	.	+	.	ID=id1026;Note=mmyc695%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	973981	975447	.	+	.	ID=gene827;Name=MMSYN1_0827;gbkey=Gene;locus_tag=MMSYN1_0827
CP002027.1	Genbank	CDS	973981	975447	.	+	0	ID=cds749;Parent=gene827;Dbxref=NCBI_GP:ADH22096.1;Name=ADH22096.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22096.1;transl_table=4
CP002027.1	Genbank	sequence_feature	974687	975766	.	+	.	ID=id1027;Note=mmyc696%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	975613	975687	.	+	.	ID=gene828;Name=MMSYN1_0828;gbkey=Gene;locus_tag=MMSYN1_0828
CP002027.1	Genbank	tRNA	975613	975687	.	+	.	ID=rna40;Parent=gene828;gbkey=tRNA;product=tRNA-Cys
CP002027.1	Genbank	exon	975613	975687	.	+	.	ID=id1028;Parent=rna40;gbkey=tRNA;product=tRNA-Cys
CP002027.1	Genbank	sequence_feature	975687	976766	.	+	.	ID=id1029;Note=mmyc697%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	975825	976622	.	+	.	ID=gene829;Name=MMSYN1_0829;gbkey=Gene;locus_tag=MMSYN1_0829
CP002027.1	Genbank	CDS	975825	976622	.	+	0	ID=cds750;Parent=gene829;Dbxref=NCBI_GP:ADH22255.1;Name=ADH22255.1;Note=identified by match to protein family HMM PF01026%3B match to protein family HMM TIGR00010;gbkey=CDS;product=deoxyribonuclease%2C TatD family;protein_id=ADH22255.1;transl_table=4
CP002027.1	Genbank	gene	976624	976884	.	+	.	ID=gene830;Name=MMSYN1_0830;gbkey=Gene;locus_tag=MMSYN1_0830
CP002027.1	Genbank	CDS	976624	976884	.	+	0	ID=cds751;Parent=gene830;Dbxref=NCBI_GP:ADH22134.1;Name=ADH22134.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22134.1;transl_table=4
CP002027.1	Genbank	sequence_feature	976687	977766	.	+	.	ID=id1030;Note=mmyc698%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	977064	978098	.	+	.	ID=gene831;Name=prs;gbkey=Gene;gene=prs;locus_tag=MMSYN1_0831
CP002027.1	Genbank	CDS	977064	978098	.	+	0	ID=cds752;Parent=gene831;Dbxref=NCBI_GP:ADH21944.1;Name=ADH21944.1;Note=identified by match to protein family HMM PF00156%3B match to protein family HMM TIGR01251;gbkey=CDS;gene=prs;product=ribose-Phosphate pyrophosphokinase (rppk) (phosphoribosylpyrophosphate synthetase) (p-rib-pp synthetase) (prpp synthetase);protein_id=ADH21944.1;transl_table=4
CP002027.1	Genbank	sequence_feature	977687	978766	.	+	.	ID=id1031;Note=mmyc699%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	978524	979084	.	+	.	ID=gene832;Name=pth;gbkey=Gene;gene=pth;locus_tag=MMSYN1_0832
CP002027.1	Genbank	CDS	978524	979084	.	+	0	ID=cds753;Parent=gene832;Dbxref=NCBI_GP:ADH21490.1;Name=ADH21490.1;Note=identified by match to protein family HMM PF01195%3B match to protein family HMM TIGR00447;gbkey=CDS;gene=pth;product=aminoacyl-tRNA hydrolase;protein_id=ADH21490.1;transl_table=4
CP002027.1	Genbank	sequence_feature	978687	979766	.	+	.	ID=id1032;Note=mmyc700%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	979205	979648	.	+	.	ID=gene833;Name=rplI;gbkey=Gene;gene=rplI;locus_tag=MMSYN1_0833
CP002027.1	Genbank	CDS	979205	979648	.	+	0	ID=cds754;Parent=gene833;Dbxref=NCBI_GP:ADH22125.1;Name=ADH22125.1;Note=identified by match to protein family HMM PF01281%3B match to protein family HMM PF03948%3B match to protein family HMM TIGR00158;gbkey=CDS;gene=rplI;product=ribosomal protein L9;protein_id=ADH22125.1;transl_table=4
CP002027.1	Genbank	gene	979651	980967	.	+	.	ID=gene834;Name=dnaB;gbkey=Gene;gene=dnaB;locus_tag=MMSYN1_0834
CP002027.1	Genbank	CDS	979651	980967	.	+	0	ID=cds755;Parent=gene834;Dbxref=NCBI_GP:ADH21756.1;Name=ADH21756.1;Note=identified by match to protein family HMM PF00772%3B match to protein family HMM PF03796%3B match to protein family HMM TIGR00665;gbkey=CDS;gene=dnaB;product=replicative DNA helicase;protein_id=ADH21756.1;transl_table=4
CP002027.1	Genbank	sequence_feature	979687	980766	.	+	.	ID=id1033;Note=mmyc701%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature;gene=dnaB
CP002027.1	Genbank	sequence_feature	980687	981766	.	+	.	ID=id1034;Note=mmyc702%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	981034	982341	.	+	.	ID=gene835;Name=MMSYN1_0835;gbkey=Gene;locus_tag=MMSYN1_0835
CP002027.1	Genbank	CDS	981034	982341	.	+	0	ID=cds756;Parent=gene835;Dbxref=NCBI_GP:ADH21711.1;Name=ADH21711.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21711.1;transl_table=4
CP002027.1	Genbank	sequence_feature	981687	982766	.	+	.	ID=id1035;Note=mmyc703%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	982483	983409	.	+	.	ID=gene836;Name=MMSYN1_0836;gbkey=Gene;locus_tag=MMSYN1_0836
CP002027.1	Genbank	CDS	982483	983409	.	+	0	ID=cds757;Parent=gene836;Dbxref=NCBI_GP:ADH22058.1;Name=ADH22058.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22058.1;transl_table=4
CP002027.1	Genbank	sequence_feature	982687	983766	.	+	.	ID=id1036;Note=mmyc704%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	983418	984743	.	+	.	ID=gene837;Name=cysS;gbkey=Gene;gene=cysS;locus_tag=MMSYN1_0837
CP002027.1	Genbank	CDS	983418	984743	.	+	0	ID=cds758;Parent=gene837;Dbxref=NCBI_GP:ADH21943.1;Name=ADH21943.1;Note=identified by match to protein family HMM PF01406%3B match to protein family HMM PF09334%3B match to protein family HMM TIGR00435;gbkey=CDS;gene=cysS;product=cysteine--tRNA ligase;protein_id=ADH21943.1;transl_table=4
CP002027.1	Genbank	sequence_feature	983687	984766	.	+	.	ID=id1037;Note=mmyc705%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	984687	985766	.	+	.	ID=id1038;Note=mmyc706%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	984745	985479	.	+	.	ID=gene838;Name=MMSYN1_0838;gbkey=Gene;locus_tag=MMSYN1_0838
CP002027.1	Genbank	CDS	984745	985479	.	+	0	ID=cds759;Parent=gene838;Dbxref=NCBI_GP:ADH22043.1;Name=ADH22043.1;Note=identified by match to protein family HMM PF00588%3B match to protein family HMM PF08032%3B match to protein family HMM TIGR00186;gbkey=CDS;product=RNA methyltransferase%2C TrmH family%2C group 3;protein_id=ADH22043.1;transl_table=4
CP002027.1	Genbank	sequence_feature	985687	986766	.	+	.	ID=id1039;Note=mmyc707%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	985701	986024	.	+	.	ID=gene839;Name=secE;gbkey=Gene;gene=secE;locus_tag=MMSYN1_0839
CP002027.1	Genbank	CDS	985701	986024	.	+	0	ID=cds760;Parent=gene839;Dbxref=NCBI_GP:ADH21962.1;Name=ADH21962.1;Note=identified by match to protein family HMM TIGR00964;gbkey=CDS;gene=secE;product=preprotein translocase%2C SecE subunit;protein_id=ADH21962.1;transl_table=4
CP002027.1	Genbank	gene	986041	986682	.	+	.	ID=gene840;Name=nusG;gbkey=Gene;gene=nusG;locus_tag=MMSYN1_0840
CP002027.1	Genbank	CDS	986041	986682	.	+	0	ID=cds761;Parent=gene840;Dbxref=NCBI_GP:ADH21622.1;Name=ADH21622.1;Note=identified by match to protein family HMM PF02357;gbkey=CDS;gene=nusG;product=transcription antitermination protein nusG;protein_id=ADH21622.1;transl_table=4
CP002027.1	Genbank	sequence_feature	986687	987766	.	+	.	ID=id1040;Note=mmyc708%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	987122	993043	.	+	.	ID=gene841;Name=MMSYN1_0841;gbkey=Gene;locus_tag=MMSYN1_0841
CP002027.1	Genbank	CDS	987122	993043	.	+	0	ID=cds762;Parent=gene841;Dbxref=NCBI_GP:ADH22129.1;Name=ADH22129.1;Note=identified by glimmer%3B putative;gbkey=CDS;product=hypothetical protein;protein_id=ADH22129.1;transl_table=4
CP002027.1	Genbank	sequence_feature	987687	988766	.	+	.	ID=id1041;Note=mmyc709%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	988687	989766	.	+	.	ID=id1042;Note=mmyc710%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	989687	990766	.	+	.	ID=id1043;Note=mmyc711%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	990687	991766	.	+	.	ID=id1044;Note=mmyc712%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	991687	992766	.	+	.	ID=id1045;Note=mmyc713%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	992687	993766	.	+	.	ID=id1046;Note=mmyc714%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	993053	996010	.	+	.	ID=gene842;Name=MMSYN1_0842;gbkey=Gene;locus_tag=MMSYN1_0842
CP002027.1	Genbank	CDS	993053	996010	.	+	0	ID=cds763;Parent=gene842;Dbxref=NCBI_GP:ADH21768.1;Name=ADH21768.1;Note=identified by match to protein family HMM PF00496;gbkey=CDS;product=oligopeptide ABC transporter%2C solute-binding protein;protein_id=ADH21768.1;transl_table=4
CP002027.1	Genbank	sequence_feature	993687	994766	.	+	.	ID=id1047;Note=mmyc715%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	994687	995766	.	+	.	ID=id1048;Note=mmyc716%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	995687	996766	.	+	.	ID=id1049;Note=mmyc717%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	996010	997083	.	+	.	ID=gene843;Name=MMSYN1_0843;gbkey=Gene;locus_tag=MMSYN1_0843
CP002027.1	Genbank	CDS	996010	997083	.	+	0	ID=cds764;Parent=gene843;Dbxref=NCBI_GP:ADH21529.1;Name=ADH21529.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=oligopeptide ABC transporter%2C permease component;protein_id=ADH21529.1;transl_table=4
CP002027.1	Genbank	sequence_feature	996687	997766	.	+	.	ID=id1050;Note=mmyc718%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	997085	998095	.	+	.	ID=gene844;Name=MMSYN1_0844;gbkey=Gene;locus_tag=MMSYN1_0844
CP002027.1	Genbank	CDS	997085	998095	.	+	0	ID=cds765;Parent=gene844;Dbxref=NCBI_GP:ADH22102.1;Name=ADH22102.1;Note=identified by match to protein family HMM PF00528;gbkey=CDS;product=oligopeptide ABC transporter%2C permease component;protein_id=ADH22102.1;transl_table=4
CP002027.1	Genbank	sequence_feature	997687	998766	.	+	.	ID=id1051;Note=mmyc719%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	998103	999548	.	+	.	ID=gene845;Name=MMSYN1_0845;gbkey=Gene;locus_tag=MMSYN1_0845
CP002027.1	Genbank	CDS	998103	999548	.	+	0	ID=cds766;Parent=gene845;Dbxref=NCBI_GP:ADH22223.1;Name=ADH22223.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF08352%3B match to protein family HMM TIGR01727;gbkey=CDS;product=oligopeptide ABC transporter%2C ATP-binding component;protein_id=ADH22223.1;transl_table=4
CP002027.1	Genbank	sequence_feature	998687	999766	.	+	.	ID=id1052;Note=mmyc720%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	999541	1000863	.	+	.	ID=gene846;Name=MMSYN1_0846;gbkey=Gene;locus_tag=MMSYN1_0846
CP002027.1	Genbank	CDS	999541	1000863	.	+	0	ID=cds767;Parent=gene846;Dbxref=NCBI_GP:ADH21860.1;Name=ADH21860.1;Note=identified by match to protein family HMM PF00005%3B match to protein family HMM PF08352;gbkey=CDS;product=oligopeptide ABC transporter%2C ATP-binding component;protein_id=ADH21860.1;transl_table=4
CP002027.1	Genbank	sequence_feature	999687	1000766	.	+	.	ID=id1053;Note=mmyc721%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1000687	1001766	.	+	.	ID=id1054;Note=mmyc722%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1000900	1001631	.	-	.	ID=gene847;Name=tnpB_6;gbkey=Gene;gene=tnpB_6;locus_tag=MMSYN1_0267
CP002027.1	Genbank	CDS	1000900	1001631	.	-	0	ID=cds768;Parent=gene847;Dbxref=NCBI_GP:ADH21927.1;Name=ADH21927.1;Note=identified by match to protein family HMM PF00665;gbkey=CDS;gene=tnpB_6;product=IS1296 transposase protein B;protein_id=ADH21927.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1001687	1002766	.	+	.	ID=id1055;Note=mmyc723%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1001769	1002311	.	-	.	ID=gene848;Name=tnpA_6;gbkey=Gene;gene=tnpA_6;locus_tag=MMSYN1_0265
CP002027.1	Genbank	CDS	1001769	1002311	.	-	0	ID=cds769;Parent=gene848;Dbxref=NCBI_GP:ADH21611.1;Name=ADH21611.1;gbkey=CDS;gene=tnpA_6;product=IS1296 transposase protein A;protein_id=ADH21611.1;transl_table=4
CP002027.1	Genbank	gene	1002392	1002898	.	-	.	ID=gene849;Name=MMSYN1_0849;gbkey=Gene;locus_tag=MMSYN1_0849
CP002027.1	Genbank	CDS	1002392	1002898	.	-	0	ID=cds770;Parent=gene849;Dbxref=NCBI_GP:ADH21496.1;Name=ADH21496.1;gbkey=CDS;product=lipoprotein;protein_id=ADH21496.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1002687	1003766	.	+	.	ID=id1056;Note=mmyc724%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1003095	1003970	.	-	.	ID=gene850;Name=MMSYN1_0850;gbkey=Gene;locus_tag=MMSYN1_0850
CP002027.1	Genbank	CDS	1003095	1003970	.	-	0	ID=cds771;Parent=gene850;Dbxref=NCBI_GP:ADH22224.1;Name=ADH22224.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22224.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1003687	1004766	.	+	.	ID=id1057;Note=mmyc725%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1004037	1004219	.	-	.	ID=gene851;Name=MMSYN1_0851;gbkey=Gene;locus_tag=MMSYN1_0851
CP002027.1	Genbank	CDS	1004037	1004219	.	-	0	ID=cds772;Parent=gene851;Dbxref=NCBI_GP:ADH22101.1;Name=ADH22101.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22101.1;transl_table=4
CP002027.1	Genbank	gene	1004385	1004615	.	-	.	ID=gene852;Name=MMSYN1_0852;gbkey=Gene;locus_tag=MMSYN1_0852
CP002027.1	Genbank	CDS	1004385	1004615	.	-	0	ID=cds773;Parent=gene852;Dbxref=NCBI_GP:ADH21994.1;Name=ADH21994.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21994.1;transl_table=4
CP002027.1	Genbank	gene	1004605	1005324	.	-	.	ID=gene853;Name=MMSYN1_0853;gbkey=Gene;locus_tag=MMSYN1_0853
CP002027.1	Genbank	CDS	1004605	1005324	.	-	0	ID=cds774;Parent=gene853;Dbxref=NCBI_GP:ADH21828.1;Name=ADH21828.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21828.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1004687	1005766	.	+	.	ID=id1058;Note=mmyc726%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1005324	1005833	.	-	.	ID=gene854;Name=MMSYN1_0854;gbkey=Gene;locus_tag=MMSYN1_0854
CP002027.1	Genbank	CDS	1005324	1005833	.	-	0	ID=cds775;Parent=gene854;Dbxref=NCBI_GP:ADH22254.1;Name=ADH22254.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22254.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1005687	1006766	.	+	.	ID=id1059;Note=mmyc727%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1005833	1007533	.	-	.	ID=gene855;Name=MMSYN1_0855;gbkey=Gene;locus_tag=MMSYN1_0855
CP002027.1	Genbank	CDS	1005833	1007533	.	-	0	ID=cds776;Parent=gene855;Dbxref=NCBI_GP:ADH21519.1;Name=ADH21519.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system%2C iibc component%2C putative;protein_id=ADH21519.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1006687	1007766	.	+	.	ID=id1060;Note=mmyc728%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1007610	1009322	.	-	.	ID=gene856;Name=MMSYN1_0856;gbkey=Gene;locus_tag=MMSYN1_0856
CP002027.1	Genbank	CDS	1007610	1009322	.	-	0	ID=cds777;Parent=gene856;Dbxref=NCBI_GP:ADH21573.1;Name=ADH21573.1;Note=identified by match to protein family HMM PF00367%3B match to protein family HMM PF02378;gbkey=CDS;product=PTS system%2C iibc component%2C putative;protein_id=ADH21573.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1007687	1008766	.	+	.	ID=id1061;Note=mmyc729%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1008687	1009766	.	+	.	ID=id1062;Note=mmyc730%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1009630	1011018	.	+	.	ID=gene857;Name=MMSYN1_0858;gbkey=Gene;locus_tag=MMSYN1_0858
CP002027.1	Genbank	CDS	1009630	1011018	.	+	0	ID=cds778;Parent=gene857;Dbxref=NCBI_GP:ADH22054.1;Name=ADH22054.1;Note=identified by match to protein family HMM PF04326%3B match to protein family HMM PF08220%3B match to protein family HMM PF08279;gbkey=CDS;product=putative transcriptional regulator;protein_id=ADH22054.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1009687	1010766	.	+	.	ID=id1063;Note=mmyc731%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1010687	1011766	.	+	.	ID=id1064;Note=mmyc732%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1011005	1011820	.	-	.	ID=gene858;Name=MMSYN1_0857;gbkey=Gene;locus_tag=MMSYN1_0857
CP002027.1	Genbank	CDS	1011005	1011820	.	-	0	ID=cds779;Parent=gene858;Dbxref=NCBI_GP:ADH21566.1;Name=ADH21566.1;Note=identified by match to protein family HMM PF01380;gbkey=CDS;product=SIS domain protein;protein_id=ADH21566.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1011687	1012766	.	+	.	ID=id1065;Note=mmyc733%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1012008	1013969	.	+	.	ID=gene859;Name=MMSYN1_0859;gbkey=Gene;locus_tag=MMSYN1_0859
CP002027.1	Genbank	CDS	1012008	1013969	.	+	0	ID=cds780;Parent=gene859;Dbxref=NCBI_GP:ADH21941.1;Name=ADH21941.1;Note=identified by match to protein family HMM PF01131%3B match to protein family HMM PF01396%3B match to protein family HMM PF01751;gbkey=CDS;product=DNA topoisomerase domain protein;protein_id=ADH21941.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1012687	1013766	.	+	.	ID=id1066;Note=mmyc734%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1013687	1014766	.	+	.	ID=id1067;Note=mmyc735%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1014116	1014841	.	-	.	ID=gene860;Name=MMSYN1_0860;gbkey=Gene;locus_tag=MMSYN1_0860
CP002027.1	Genbank	CDS	1014116	1014841	.	-	0	ID=cds781;Parent=gene860;Dbxref=NCBI_GP:ADH21814.1;Name=ADH21814.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21814.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1014687	1015766	.	+	.	ID=id1068;Note=mmyc736%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1015242	1016126	.	-	.	ID=gene861;Name=MMSYN1_0861;gbkey=Gene;locus_tag=MMSYN1_0861
CP002027.1	Genbank	CDS	1015242	1016126	.	-	0	ID=cds782;Parent=gene861;Dbxref=NCBI_GP:ADH21874.1;Name=ADH21874.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21874.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1015687	1016766	.	+	.	ID=id1069;Note=mmyc737%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1016113	1016943	.	-	.	ID=gene862;Name=MMSYN1_0862;gbkey=Gene;locus_tag=MMSYN1_0862
CP002027.1	Genbank	CDS	1016113	1016943	.	-	0	ID=cds783;Parent=gene862;Dbxref=NCBI_GP:ADH21532.1;Name=ADH21532.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21532.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1016687	1017766	.	+	.	ID=id1070;Note=mmyc738%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1016930	1018279	.	-	.	ID=gene863;Name=MMSYN1_0863;gbkey=Gene;locus_tag=MMSYN1_0863
CP002027.1	Genbank	CDS	1016930	1018279	.	-	0	ID=cds784;Parent=gene863;Dbxref=NCBI_GP:ADH22074.1;Name=ADH22074.1;gbkey=CDS;product=putative liporotein;protein_id=ADH22074.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1017687	1018766	.	+	.	ID=id1071;Note=mmyc739%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1018257	1018961	.	-	.	ID=gene864;Name=MMSYN1_0864;gbkey=Gene;locus_tag=MMSYN1_0864
CP002027.1	Genbank	CDS	1018257	1018961	.	-	0	ID=cds785;Parent=gene864;Dbxref=NCBI_GP:ADH21980.1;Name=ADH21980.1;Note=identified by match to protein family HMM PF00005;gbkey=CDS;product=ABC transporter%2C ATP-binding protein;protein_id=ADH21980.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1018687	1019766	.	+	.	ID=id1072;Note=mmyc740%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1018963	1020834	.	-	.	ID=gene865;Name=MMSYN1_0865;gbkey=Gene;locus_tag=MMSYN1_0865
CP002027.1	Genbank	CDS	1018963	1020834	.	-	0	ID=cds786;Parent=gene865;Dbxref=NCBI_GP:ADH22049.1;Name=ADH22049.1;gbkey=CDS;product=ABC transporter%2C permease protein;protein_id=ADH22049.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1019687	1020766	.	+	.	ID=id1073;Note=mmyc741%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1020687	1021766	.	+	.	ID=id1074;Note=mmyc742%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1020973	1021860	.	-	.	ID=gene866;Name=MMSYN1_0866;gbkey=Gene;locus_tag=MMSYN1_0866
CP002027.1	Genbank	CDS	1020973	1021860	.	-	0	ID=cds787;Parent=gene866;Dbxref=NCBI_GP:ADH21833.1;Name=ADH21833.1;gbkey=CDS;product=putative liporotein;protein_id=ADH21833.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1021687	1022766	.	+	.	ID=id1075;Note=mmyc743%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1021862	1022692	.	-	.	ID=gene867;Name=MMSYN1_0867;gbkey=Gene;locus_tag=MMSYN1_0867
CP002027.1	Genbank	CDS	1021862	1022692	.	-	0	ID=cds788;Parent=gene867;Dbxref=NCBI_GP:ADH21760.1;Name=ADH21760.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21760.1;transl_table=4
CP002027.1	Genbank	gene	1022679	1023872	.	-	.	ID=gene868;Name=MMSYN1_0868;gbkey=Gene;locus_tag=MMSYN1_0868
CP002027.1	Genbank	CDS	1022679	1023872	.	-	0	ID=cds789;Parent=gene868;Dbxref=NCBI_GP:ADH21682.1;Name=ADH21682.1;gbkey=CDS;product=lipoprotein. putative;protein_id=ADH21682.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1022687	1023766	.	+	.	ID=id1076;Note=mmyc744%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1023687	1024766	.	+	.	ID=id1077;Note=mmyc745%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1023891	1025786	.	-	.	ID=gene869;Name=MMSYN1_0869;gbkey=Gene;locus_tag=MMSYN1_0869
CP002027.1	Genbank	CDS	1023891	1025786	.	-	0	ID=cds790;Parent=gene869;Dbxref=NCBI_GP:ADH21534.1;Name=ADH21534.1;gbkey=CDS;product=ABC transporter%2C permease component;protein_id=ADH21534.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1024687	1025766	.	+	.	ID=id1078;Note=mmyc746%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1025687	1026766	.	+	.	ID=id1079;Note=mmyc747%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1025896	1027662	.	-	.	ID=gene870;Name=MMSYN1_0870;gbkey=Gene;locus_tag=MMSYN1_0870
CP002027.1	Genbank	CDS	1025896	1027662	.	-	0	ID=cds791;Parent=gene870;Dbxref=NCBI_GP:ADH22237.1;Name=ADH22237.1;Note=identified by match to protein family HMM PF03606;gbkey=CDS;product=C4-dicarboxylate anaerobic carrier superfamily;protein_id=ADH22237.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1026687	1027766	.	+	.	ID=id1080;Note=mmyc748%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1027687	1028766	.	+	.	ID=id1081;Note=mmyc749%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1027731	1028438	.	-	.	ID=gene871;Name=MMSYN1_0871;gbkey=Gene;locus_tag=MMSYN1_0871
CP002027.1	Genbank	CDS	1027731	1028438	.	-	0	ID=cds792;Parent=gene871;Dbxref=NCBI_GP:ADH21873.1;Name=ADH21873.1;Note=identified by match to protein family HMM PF01863;gbkey=CDS;product=zinc metalloprotease;protein_id=ADH21873.1;transl_table=4
CP002027.1	Genbank	gene	1028410	1029504	.	-	.	ID=gene872;Name=ychF;gbkey=Gene;gene=ychF;locus_tag=MMSYN1_0872
CP002027.1	Genbank	CDS	1028410	1029504	.	-	0	ID=cds793;Parent=gene872;Dbxref=NCBI_GP:ADH22173.1;Name=ADH22173.1;Note=identified by match to protein family HMM PF01926%3B match to protein family HMM PF06071%3B match to protein family HMM TIGR00092;gbkey=CDS;gene=ychF;product=GTP-binding protein YchF;protein_id=ADH22173.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1028687	1029766	.	+	.	ID=id1082;Note=mmyc750%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1029540	1029740	.	-	.	ID=gene873;Name=MMSYN1_0873;gbkey=Gene;locus_tag=MMSYN1_0873
CP002027.1	Genbank	CDS	1029540	1029740	.	-	0	ID=cds794;Parent=gene873;Dbxref=NCBI_GP:ADH21600.1;Name=ADH21600.1;Note=identified by match to protein family HMM PF06107;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21600.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1029687	1030766	.	+	.	ID=id1083;Note=mmyc751%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1029742	1030437	.	-	.	ID=gene874;Name=gidB;gbkey=Gene;gene=gidB;locus_tag=MMSYN1_0874
CP002027.1	Genbank	CDS	1029742	1030437	.	-	0	ID=cds795;Parent=gene874;Dbxref=NCBI_GP:ADH21696.1;Name=ADH21696.1;Note=identified by match to protein family HMM PF02527%3B match to protein family HMM TIGR00138;gbkey=CDS;gene=gidB;product=16S rRNA methyltransferase GidB;protein_id=ADH21696.1;transl_table=4
CP002027.1	Genbank	gene	1030437	1031033	.	-	.	ID=gene875;Name=pgsA;gbkey=Gene;gene=pgsA;locus_tag=MMSYN1_0875
CP002027.1	Genbank	CDS	1030437	1031033	.	-	0	ID=cds796;Parent=gene875;Dbxref=NCBI_GP:ADH21807.1;Name=ADH21807.1;Note=identified by match to protein family HMM PF01066%3B match to protein family HMM TIGR00560;gbkey=CDS;gene=pgsA;product=CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase;protein_id=ADH21807.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1030687	1031766	.	+	.	ID=id1084;Note=mmyc752%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1031135	1032715	.	-	.	ID=gene876;Name=MMSYN1_0876;gbkey=Gene;locus_tag=MMSYN1_0876
CP002027.1	Genbank	CDS	1031135	1032715	.	-	0	ID=cds797;Parent=gene876;Dbxref=NCBI_GP:ADH21489.1;Name=ADH21489.1;gbkey=CDS;product=amino acid permease;protein_id=ADH21489.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1031687	1032766	.	+	.	ID=id1085;Note=mmyc753%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1032687	1033766	.	+	.	ID=id1086;Note=mmyc754%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1032862	1033542	.	-	.	ID=gene877;Name=MMSYN1_0877;gbkey=Gene;locus_tag=MMSYN1_0877
CP002027.1	Genbank	CDS	1032862	1033542	.	-	0	ID=cds798;Parent=gene877;Dbxref=NCBI_GP:ADH21620.1;Name=ADH21620.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21620.1;transl_table=4
CP002027.1	Genbank	gene	1033514	1035007	.	-	.	ID=gene878;Name=MMSYN1_0878;gbkey=Gene;locus_tag=MMSYN1_0878
CP002027.1	Genbank	CDS	1033514	1035007	.	-	0	ID=cds799;Parent=gene878;Dbxref=NCBI_GP:ADH22273.1;Name=ADH22273.1;gbkey=CDS;product=amino acid permease;protein_id=ADH22273.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1033687	1034766	.	+	.	ID=id1087;Note=mmyc755%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1034687	1035766	.	+	.	ID=id1088;Note=mmyc756%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1035110	1037767	.	-	.	ID=gene879;Name=MMSYN1_0879;gbkey=Gene;locus_tag=MMSYN1_0879
CP002027.1	Genbank	CDS	1035110	1037767	.	-	0	ID=cds800;Parent=gene879;Dbxref=NCBI_GP:ADH22055.1;Name=ADH22055.1;Note=identified by match to protein family HMM PF00122%3B match to protein family HMM PF00702%3B match to protein family HMM TIGR01494;gbkey=CDS;product=E1-E2 ATPase subfamily%2C putative;protein_id=ADH22055.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1035687	1036766	.	+	.	ID=id1089;Note=mmyc757%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1036687	1037766	.	+	.	ID=id1090;Note=mmyc758%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1037687	1038778	.	+	.	ID=id1091;Note=mmyc759f%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_difference	1037850	1037850	.	+	.	ID=id1092;Note=SNP%3B C (JCVI-syn1) -> G (sMmYCp235-1)%2C No gene affected;gbkey=misc_difference;replace=c
CP002027.1	Genbank	pseudogene	1037851	1038822	.	-	.	ID=gene880;Name=hup;Note=DNA-binding protein HU%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF00216;gbkey=Gene;gene=hup;locus_tag=MMSYN1_0880;pseudo=true
CP002027.1	Genbank	sequence_feature	1038699	1039778	.	+	.	ID=id1093;Note=mmyc760%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1039138	1040565	.	-	.	ID=gene881;Name=MMSYN1_0881;gbkey=Gene;locus_tag=MMSYN1_0881
CP002027.1	Genbank	CDS	1039138	1040565	.	-	0	ID=cds801;Parent=gene881;Dbxref=NCBI_GP:ADH22276.1;Name=ADH22276.1;Note=identified by match to protein family HMM PF07672%3B match to protein family HMM PF07690;gbkey=CDS;product=hexose phosphate transport protein;protein_id=ADH22276.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1039699	1040778	.	+	.	ID=id1094;Note=mmyc761%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1040699	1041778	.	+	.	ID=id1095;Note=mmyc762%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1040770	1041414	.	-	.	ID=gene882;Name=MMSYN1_0882;gbkey=Gene;locus_tag=MMSYN1_0882
CP002027.1	Genbank	CDS	1040770	1041414	.	-	0	ID=cds802;Parent=gene882;Dbxref=NCBI_GP:ADH21766.1;Name=ADH21766.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21766.1;transl_table=4
CP002027.1	Genbank	gene	1041471	1042451	.	-	.	ID=gene883;Name=asnA;gbkey=Gene;gene=asnA;locus_tag=MMSYN1_0883
CP002027.1	Genbank	CDS	1041471	1042451	.	-	0	ID=cds803;Parent=gene883;Dbxref=NCBI_GP:ADH21453.1;Name=ADH21453.1;Note=identified by match to protein family HMM PF03590%3B match to protein family HMM TIGR00669;gbkey=CDS;gene=asnA;product=aspartate--ammonia ligase;protein_id=ADH21453.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1041699	1042778	.	+	.	ID=id1096;Note=mmyc763%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1042655	1043413	.	+	.	ID=gene884;Name=MMSYN1_0884;gbkey=Gene;locus_tag=MMSYN1_0884
CP002027.1	Genbank	CDS	1042655	1043413	.	+	0	ID=cds804;Parent=gene884;Dbxref=NCBI_GP:ADH21955.1;Name=ADH21955.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21955.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1042699	1043778	.	+	.	ID=id1097;Note=mmyc764%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1043673	1045562	.	-	.	ID=gene885;Name=gidA;gbkey=Gene;gene=gidA;locus_tag=MMSYN1_0885
CP002027.1	Genbank	CDS	1043673	1045562	.	-	0	ID=cds805;Parent=gene885;Dbxref=NCBI_GP:ADH21683.1;Name=ADH21683.1;Note=identified by match to protein family HMM PF01134%3B match to protein family HMM TIGR00136;gbkey=CDS;gene=gidA;product=tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA;protein_id=ADH21683.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1043699	1044778	.	+	.	ID=id1098;Note=mmyc765%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1044699	1045778	.	+	.	ID=id1099;Note=mmyc766%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1045699	1046778	.	+	.	ID=id1100;Note=mmyc767%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1045710	1047287	.	-	.	ID=gene886;Name=MMSYN1_0886;gbkey=Gene;locus_tag=MMSYN1_0886
CP002027.1	Genbank	CDS	1045710	1047287	.	-	0	ID=cds806;Parent=gene886;Dbxref=NCBI_GP:ADH22139.1;Name=ADH22139.1;Note=identified by match to protein family HMM PF00375;gbkey=CDS;product=proton/glutamate symporter;protein_id=ADH22139.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1046699	1047778	.	+	.	ID=id1101;Note=mmyc768%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	1047307	1048650	.	-	.	ID=gene887;Name=MMSYN1_0887;Note=pyridine nucleotide-disulphide oxidoreductase%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF00070%3B match to protein family HMM PF02852%3B match to protein family HMM PF07992;gbkey=Gene;locus_tag=MMSYN1_0887;pseudo=true
CP002027.1	Genbank	sequence_feature	1047699	1048778	.	+	.	ID=id1102;Note=mmyc769%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1048699	1049778	.	+	.	ID=id1103;Note=mmyc770%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1048868	1049368	.	+	.	ID=gene888;Name=MMSYN1_0888;gbkey=Gene;locus_tag=MMSYN1_0888
CP002027.1	Genbank	CDS	1048868	1049368	.	+	0	ID=cds807;Parent=gene888;Dbxref=NCBI_GP:ADH22260.1;Name=ADH22260.1;Note=identified by match to protein family HMM PF00857;gbkey=CDS;product=pyrazinamidase/nicotinamidase;protein_id=ADH22260.1;transl_table=4
CP002027.1	Genbank	pseudogene	1049414	1050091	.	-	.	ID=gene889;Name=MMSYN1_0889;Note=conserved hypothetical protein%2C authentic frameshift%3B this gene contains a frame shift which may be the result of a sequencing error%3B identified by match to protein family HMM PF08843;gbkey=Gene;locus_tag=MMSYN1_0889;pseudo=true
CP002027.1	Genbank	sequence_feature	1049699	1050778	.	+	.	ID=id1104;Note=mmyc771%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1050248	1050847	.	-	.	ID=gene890;Name=MMSYN1_0890;gbkey=Gene;locus_tag=MMSYN1_0890
CP002027.1	Genbank	CDS	1050248	1050847	.	-	0	ID=cds808;Parent=gene890;Dbxref=NCBI_GP:ADH21740.1;Name=ADH21740.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21740.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1050699	1051778	.	+	.	ID=id1105;Note=mmyc772%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1051424	1052758	.	+	.	ID=gene891;Name=lppQ;gbkey=Gene;gene=lppQ;locus_tag=MMSYN1_0891
CP002027.1	Genbank	CDS	1051424	1052758	.	+	0	ID=cds809;Parent=gene891;Dbxref=NCBI_GP:ADH21847.1;Name=ADH21847.1;Note=identified by match to protein family HMM PF03382%3B match to protein family HMM TIGR02167;gbkey=CDS;gene=lppQ;product=lipoprotein Q%2C putative (LppQ);protein_id=ADH21847.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1051699	1052778	.	+	.	ID=id1106;Note=mmyc773%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1052699	1053778	.	+	.	ID=id1107;Note=mmyc774%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1053008	1054231	.	+	.	ID=gene892;Name=MMSYN1_0892;gbkey=Gene;locus_tag=MMSYN1_0892
CP002027.1	Genbank	CDS	1053008	1054231	.	+	0	ID=cds810;Parent=gene892;Dbxref=NCBI_GP:ADH21930.1;Name=ADH21930.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH21930.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1053699	1054778	.	+	.	ID=id1108;Note=mmyc775%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1054362	1055567	.	+	.	ID=gene893;Name=MMSYN1_0893;gbkey=Gene;locus_tag=MMSYN1_0893
CP002027.1	Genbank	CDS	1054362	1055567	.	+	0	ID=cds811;Parent=gene893;Dbxref=NCBI_GP:ADH22040.1;Name=ADH22040.1;gbkey=CDS;product=putative membrane protein;protein_id=ADH22040.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1054699	1055778	.	+	.	ID=id1109;Note=mmyc776%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1055650	1057914	.	-	.	ID=gene894;Name=MMSYN1_0894;gbkey=Gene;locus_tag=MMSYN1_0894
CP002027.1	Genbank	CDS	1055650	1057914	.	-	0	ID=cds812;Parent=gene894;Dbxref=NCBI_GP:ADH21494.1;Name=ADH21494.1;gbkey=CDS;product=viral A-type inclusion protein repeat protein;protein_id=ADH21494.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1055699	1056778	.	+	.	ID=id1110;Note=mmyc777%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1056699	1057778	.	+	.	ID=id1111;Note=mmyc778%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1057699	1058778	.	+	.	ID=id1112;Note=mmyc779%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1057924	1060185	.	-	.	ID=gene895;Name=MMSYN1_0895;gbkey=Gene;locus_tag=MMSYN1_0895
CP002027.1	Genbank	CDS	1057924	1060185	.	-	0	ID=cds813;Parent=gene895;Dbxref=NCBI_GP:ADH21609.1;Name=ADH21609.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21609.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1058699	1059778	.	+	.	ID=id1113;Note=mmyc780%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1059699	1060778	.	+	.	ID=id1114;Note=mmyc781%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1060502	1062757	.	-	.	ID=gene896;Name=MMSYN1_0896;gbkey=Gene;locus_tag=MMSYN1_0896
CP002027.1	Genbank	CDS	1060502	1062757	.	-	0	ID=cds814;Parent=gene896;Dbxref=NCBI_GP:ADH22097.1;Name=ADH22097.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22097.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1060699	1061778	.	+	.	ID=id1115;Note=mmyc782%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1061699	1062778	.	+	.	ID=id1116;Note=mmyc783%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1062699	1063778	.	+	.	ID=id1117;Note=mmyc784%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1062767	1065028	.	-	.	ID=gene897;Name=MMSYN1_0897;gbkey=Gene;locus_tag=MMSYN1_0897
CP002027.1	Genbank	CDS	1062767	1065028	.	-	0	ID=cds815;Parent=gene897;Dbxref=NCBI_GP:ADH22222.1;Name=ADH22222.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH22222.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1063699	1064778	.	+	.	ID=id1118;Note=mmyc785%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1064699	1065778	.	+	.	ID=id1119;Note=mmyc786%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1065223	1067475	.	-	.	ID=gene898;Name=MMSYN1_0898;gbkey=Gene;locus_tag=MMSYN1_0898
CP002027.1	Genbank	CDS	1065223	1067475	.	-	0	ID=cds816;Parent=gene898;Dbxref=NCBI_GP:ADH21735.1;Name=ADH21735.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21735.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1065699	1066778	.	+	.	ID=id1120;Note=mmyc787%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1066699	1067778	.	+	.	ID=id1121;Note=mmyc788%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1067499	1069739	.	-	.	ID=gene899;Name=MMSYN1_0899;gbkey=Gene;locus_tag=MMSYN1_0899
CP002027.1	Genbank	CDS	1067499	1069739	.	-	0	ID=cds817;Parent=gene899;Dbxref=NCBI_GP:ADH21601.1;Name=ADH21601.1;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21601.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1067699	1068778	.	+	.	ID=id1122;Note=mmyc789%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1068699	1069778	.	+	.	ID=id1123;Note=mmyc790%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	sequence_feature	1069699	1070778	.	+	.	ID=id1124;Note=mmyc791%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1070055	1070690	.	+	.	ID=gene900;Name=vlcF;gbkey=Gene;gene=vlcF;locus_tag=MMSYN1_0900
CP002027.1	Genbank	CDS	1070055	1070690	.	+	0	ID=cds818;Parent=gene900;Dbxref=NCBI_GP:ADH21688.1;Name=ADH21688.1;gbkey=CDS;gene=vlcF;product=lipoprotein%2C putative (VlcF);protein_id=ADH21688.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1070699	1071778	.	+	.	ID=id1125;Note=mmyc792%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1070923	1071534	.	+	.	ID=gene901;Name=vlcG;gbkey=Gene;gene=vlcG;locus_tag=MMSYN1_0901
CP002027.1	Genbank	CDS	1070923	1071534	.	+	0	ID=cds819;Parent=gene901;Dbxref=NCBI_GP:ADH21801.1;Name=ADH21801.1;gbkey=CDS;gene=vlcG;product=lipoprotein%2C putative (VlcG);protein_id=ADH21801.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1071699	1072778	.	+	.	ID=id1126;Note=mmyc793%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1071824	1072303	.	+	.	ID=gene902;Name=vlcH;gbkey=Gene;gene=vlcH;locus_tag=MMSYN1_0902
CP002027.1	Genbank	CDS	1071824	1072303	.	+	0	ID=cds820;Parent=gene902;Dbxref=NCBI_GP:ADH22024.1;Name=ADH22024.1;gbkey=CDS;gene=vlcH;product=lipoprotein%2C putative (VlcH);protein_id=ADH22024.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1072699	1073778	.	+	.	ID=id1127;Note=mmyc794%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1072804	1073379	.	+	.	ID=gene903;Name=vlcI;gbkey=Gene;gene=vlcI;locus_tag=MMSYN1_0903
CP002027.1	Genbank	CDS	1072804	1073379	.	+	0	ID=cds821;Parent=gene903;Dbxref=NCBI_GP:ADH22133.1;Name=ADH22133.1;gbkey=CDS;gene=vlcI;product=lipoprotein (VlcI);protein_id=ADH22133.1;transl_table=4
CP002027.1	Genbank	gene	1073640	1074323	.	+	.	ID=gene904;Name=vlcJ;gbkey=Gene;gene=vlcJ;locus_tag=MMSYN1_0904
CP002027.1	Genbank	CDS	1073640	1074323	.	+	0	ID=cds822;Parent=gene904;Dbxref=NCBI_GP:ADH22172.1;Name=ADH22172.1;gbkey=CDS;gene=vlcJ;product=prolipoprotein%2C putative (VlcJ);protein_id=ADH22172.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1073699	1074778	.	+	.	ID=id1128;Note=mmyc795%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	pseudogene	1074592	1074750	.	-	.	ID=gene905;Name=MMSYN1_0905;Note=AAA family ATPase%3B this gene contains a frame shift which may be the result of a sequencing error;gbkey=Gene;locus_tag=MMSYN1_0905;pseudo=true
CP002027.1	Genbank	sequence_feature	1074699	1075778	.	+	.	ID=id1129;Note=mmyc796%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1075251	1075967	.	-	.	ID=gene906;Name=MMSYN1_0906;gbkey=Gene;locus_tag=MMSYN1_0906
CP002027.1	Genbank	CDS	1075251	1075967	.	-	0	ID=cds823;Parent=gene906;Dbxref=NCBI_GP:ADH21501.1;Name=ADH21501.1;Note=identified by match to protein family HMM PF01633%3B match to protein family HMM PF01636;gbkey=CDS;product=choline/ethanolamine kinase%2C putative;protein_id=ADH21501.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1075699	1076778	.	+	.	ID=id1130;Note=mmyc797%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1075967	1076761	.	-	.	ID=gene907;Name=MMSYN1_0907;gbkey=Gene;locus_tag=MMSYN1_0907
CP002027.1	Genbank	CDS	1075967	1076761	.	-	0	ID=cds824;Parent=gene907;Dbxref=NCBI_GP:ADH21709.1;Name=ADH21709.1;Note=identified by match to protein family HMM PF08282%3B match to protein family HMM TIGR00099%3B match to protein family HMM TIGR01484;gbkey=CDS;product=conserved hypothetical protein;protein_id=ADH21709.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1076699	1077778	.	+	.	ID=id1131;Note=mmyc798%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1076838	1078028	.	-	.	ID=gene908;Name=oxaA;gbkey=Gene;gene=oxaA;locus_tag=MMSYN1_0908
CP002027.1	Genbank	CDS	1076838	1078028	.	-	0	ID=cds825;Parent=gene908;Dbxref=NCBI_GP:ADH21872.1;Name=ADH21872.1;Note=identified by match to protein family HMM PF02096%3B match to protein family HMM TIGR03592;gbkey=CDS;gene=oxaA;product=membrane protein OxaA;protein_id=ADH21872.1;transl_table=4
CP002027.1	Genbank	sequence_feature	1077699	1078809	.	+	.	ID=id1132;Note=mmyc799a%3B The sequence of this cassette represents the sequence of one of 1078 individual chemically synthesized DNA cassettes that were subsequently assembled by recombination of their overlapping termini to yield the intact synthetic Mycoplasma mycoides JCVI-syn1.0 clone sMmYCp235-1 (Gibson%2C et al. Science in press. 2010);gbkey=misc_feature
CP002027.1	Genbank	gene	1078046	1078375	.	-	.	ID=gene909;Name=rnpA;gbkey=Gene;gene=rnpA;locus_tag=MMSYN1_0909
CP002027.1	Genbank	CDS	1078046	1078375	.	-	0	ID=cds826;Parent=gene909;Dbxref=NCBI_GP:ADH21991.1;Name=ADH21991.1;Note=identified by match to protein family HMM PF00825%3B match to protein family HMM TIGR00188;gbkey=CDS;gene=rnpA;product=ribonuclease P protein component;protein_id=ADH21991.1;transl_table=4
CP002027.1	Genbank	gene	1078382	1078516	.	-	.	ID=gene910;Name=rpmH;gbkey=Gene;gene=rpmH;locus_tag=MMSYN1_0910
CP002027.1	Genbank	CDS	1078382	1078516	.	-	0	ID=cds827;Parent=gene910;Dbxref=NCBI_GP:ADH22072.1;Name=ADH22072.1;Note=identified by match to protein family HMM PF00468%3B match to protein family HMM TIGR01030;gbkey=CDS;gene=rpmH;product=ribosomal protein L34;protein_id=ADH22072.1;transl_table=4
###